ID: 1071451322

View in Genome Browser
Species Human (GRCh38)
Location 10:85793587-85793609
Sequence CAGGGTCTGATGGTCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071451316_1071451322 10 Left 1071451316 10:85793554-85793576 CCAACAGCTATCATGTGAGTTTT 0: 1
1: 0
2: 1
3: 10
4: 177
Right 1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG No data
1071451314_1071451322 18 Left 1071451314 10:85793546-85793568 CCCTTGGACCAACAGCTATCATG 0: 1
1: 0
2: 1
3: 13
4: 102
Right 1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG No data
1071451315_1071451322 17 Left 1071451315 10:85793547-85793569 CCTTGGACCAACAGCTATCATGT 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG No data
1071451313_1071451322 27 Left 1071451313 10:85793537-85793559 CCAGTTCTGCCCTTGGACCAACA 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071451322 Original CRISPR CAGGGTCTGATGGTCTCTGC AGG Intronic
No off target data available for this crispr