ID: 1071455960

View in Genome Browser
Species Human (GRCh38)
Location 10:85851881-85851903
Sequence AGGGAGAAAAAAATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1803
Summary {0: 1, 1: 0, 2: 8, 3: 133, 4: 1661}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071455960 Original CRISPR AGGGAGAAAAAAATTGAGGA TGG (reversed) Intronic
900234414 1:1580620-1580642 AGGGACACAAACACTGAGGAAGG + Intergenic
900539497 1:3195815-3195837 AGGAAGAAAGAAAGGGAGGAAGG - Intronic
900681769 1:3920409-3920431 AGGGAGAGAAAAAGAGAGGGAGG - Intergenic
900681835 1:3920607-3920629 AGGGAGAGAAAAAGAGAGGGAGG - Intergenic
900899990 1:5509763-5509785 AGGGAGAGACAACTTGGGGACGG + Intergenic
901419770 1:9143060-9143082 AGGGAGGAAAAAAGGAAGGAAGG - Intergenic
901584954 1:10282244-10282266 AGGAAGAAAAAAAGACAGGAAGG - Intronic
901718734 1:11177847-11177869 AAAAAGAAAAAAATGGAGGAGGG + Intronic
902759492 1:18571883-18571905 AGAGAAATAAAAATGGAGGACGG - Intergenic
903088280 1:20883723-20883745 AAGGAGAAAACACTTTAGGAAGG + Intronic
903539296 1:24087715-24087737 AAGGAGAAAGACATTGAGCAGGG - Intronic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904030646 1:27531595-27531617 AGGGGGAAAAAAATAAAGGAAGG + Intergenic
904269281 1:29338747-29338769 AGGGACACAAAAACTGCGGAAGG - Intergenic
904272501 1:29359603-29359625 AGGGACACAAAAACTGCGGAAGG + Intergenic
904840790 1:33370643-33370665 GGGGAGAAAGAAATGGATGAGGG - Intronic
904870845 1:33617131-33617153 AGGGAGAGAGAATTTGGGGAAGG + Intronic
904893852 1:33799508-33799530 AGGGAGAAATAAATGGAGGAAGG - Intronic
904951716 1:34246677-34246699 AGAGAAAAATAAATTGAGGCAGG + Intergenic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905053484 1:35073324-35073346 AGGGAGAAAGAAAGAAAGGAAGG + Intronic
905179559 1:36157362-36157384 AGAGAGAAAAAAAGAGAGTAAGG - Intronic
905630731 1:39516831-39516853 ATGGAGATAAAAACTGACGAGGG + Intronic
905667029 1:39769339-39769361 ATGGAGATAAAAACTGACGAGGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906076550 1:43056249-43056271 AGGGAGAAAGAAACAGAGGGGGG - Intergenic
906275222 1:44510276-44510298 AGGGAGAAAAGAAGGAAGGAAGG + Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
906955734 1:50372158-50372180 AGGGAGACATAAATTTCGGAGGG + Intergenic
907078039 1:51595542-51595564 AGGGAGGAAGAAATGGGGGAGGG + Intronic
907270503 1:53288254-53288276 AGAGAGAAAGAAACTGAGGCTGG - Intronic
907374191 1:54022151-54022173 AGGCTGAAAATAATTGAGGCTGG - Intergenic
907430535 1:54408725-54408747 AGGGAGAGAAAAATATAGGAGGG - Intronic
907724556 1:57007013-57007035 AGAGAGAAAAAAAAGGAGGTAGG - Intronic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
907784297 1:57596665-57596687 AGGAAGAAAAAAATGAAGAAAGG + Intronic
907866188 1:58401439-58401461 TGTGAGCAAAGAATTGAGGAAGG - Intronic
907956900 1:59237605-59237627 AGGGAGAAAAAGATAGAGCAGGG - Intergenic
907977392 1:59445137-59445159 AGGGAGAGAAAGAGGGAGGAGGG + Intronic
908292225 1:62679451-62679473 AGGGAAAAAACAATGGAGGAGGG + Intronic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908581711 1:65524259-65524281 ATGGAGACAAAAATTGAGGTAGG - Intronic
908645692 1:66275524-66275546 AGGGAGATAAAAAAGGAGGTTGG + Intronic
908770048 1:67587663-67587685 AAGAAAAAAAAAATTGAGAATGG - Intergenic
908902842 1:68976100-68976122 AGAGAGAAAGAAAGAGAGGAGGG - Intergenic
908989411 1:70068578-70068600 AGGAAGAAAGAAACAGAGGAAGG - Intronic
909101323 1:71352876-71352898 AGAGAGAAAAAAAGAGAGAAAGG - Intergenic
909413167 1:75377363-75377385 AGGGACACAAAAACTGCGGAAGG + Intronic
909413818 1:75382768-75382790 AGGGACACAAAAACTGCGGAAGG + Intronic
909651805 1:77983538-77983560 AGGGACACAAAAACTGTGGAAGG - Intronic
909772161 1:79437442-79437464 AAGAAAAAGAAAATTGAGGATGG + Intergenic
909888592 1:80973805-80973827 AGGGAGAAAAAAAAAGGGAATGG - Intergenic
909949444 1:81702466-81702488 AGGAAGAAGAAAATCCAGGATGG + Intronic
910036288 1:82792798-82792820 ATAGAGAAAAAAATTGAATATGG + Intergenic
910241182 1:85087681-85087703 GGGGAAAAAAGAATGGAGGAGGG + Intronic
910243140 1:85109924-85109946 AGGAAGAAAAAAAAGGAGGTGGG + Intronic
910356760 1:86366256-86366278 AGGAAGAAAAAAATTGGGTTGGG + Intronic
910408973 1:86920199-86920221 ATGGGGAAAATAATTGAGAATGG + Intronic
910599483 1:89015630-89015652 AAATAGAAAAAAACTGAGGAAGG + Intronic
910604402 1:89067531-89067553 AGGGACACAAAAACTGTGGAAGG - Intergenic
910976135 1:92908076-92908098 AAGGACAAAAACATTGGGGAAGG + Intronic
911010673 1:93277450-93277472 AGGGACACAAAAACTGCGGAAGG - Intronic
911223160 1:95273703-95273725 TGGGTGAAAGAAATTGAAGAGGG + Intergenic
911268120 1:95767535-95767557 AGAGAGAAAAAAACTGGGAATGG + Intergenic
911352797 1:96774712-96774734 AGCGAGAAAAAAATTCCAGAAGG - Intronic
911486927 1:98514269-98514291 AGGGATAAAGAAAGTGAAGAAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911763738 1:101647581-101647603 AGGGAGAAAAGAAAAAAGGAAGG - Intergenic
911779048 1:101852244-101852266 AGGAAGAGAGAAATTGAAGATGG - Intronic
911876989 1:103179106-103179128 AGTAAGAAAGAAATTGAGGCCGG + Intergenic
911947401 1:104129788-104129810 AAGAAAAAAAAAATTCAGGATGG - Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912278835 1:108290986-108291008 AGAGAGAAATAAGTTGAAGATGG - Intergenic
912289391 1:108403371-108403393 AGAGAGAAATAAGTTGAAGATGG + Intronic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
913376780 1:118161416-118161438 AGGGAAGATAAAATTGTGGAGGG + Intronic
913505982 1:119516588-119516610 AGGCAGAAAAACAAGGAGGAAGG - Intergenic
913673447 1:121119191-121119213 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914025224 1:143906547-143906569 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914663662 1:149814261-149814283 AGGGAGAAAAGACTAAAGGAAGG - Intergenic
914702223 1:150145237-150145259 AGGGACAAAAAATTTTTGGATGG - Exonic
915005032 1:152627936-152627958 GGGAAGAAAAAAATGAAGGAAGG - Intergenic
915007764 1:152655888-152655910 AGGGAGGAAGAGATTGGGGAAGG - Intergenic
915015986 1:152734317-152734339 AGAGAGAAAAGAAAAGAGGAAGG - Intergenic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915332283 1:155120548-155120570 AGGGAGAAAAGAGTAGAGCAGGG - Intergenic
915401822 1:155627334-155627356 AGGGACACAAAAACTGCGGAAGG - Intergenic
915402726 1:155635546-155635568 AGGGACACAAAAACTGCGGAAGG - Intergenic
915480216 1:156179500-156179522 AGGGACACAAAAACTGCGGAAGG + Intergenic
916048269 1:161017113-161017135 AGGGACAAAAACACTGCGGAAGG + Intronic
916176918 1:162049562-162049584 AGGGAGATAAAGATTGGAGAAGG + Intergenic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916325335 1:163551617-163551639 AGGGAGGAATAAAGTGGGGATGG - Intergenic
916338342 1:163698600-163698622 AGGGAGGAAAAAAGAAAGGAAGG + Intergenic
916409106 1:164527264-164527286 AGGGATAAAAAAAAAGAGGCAGG - Intergenic
916620500 1:166491096-166491118 AGGAAAAAAAAAAAAGAGGATGG + Intergenic
916690718 1:167187463-167187485 AGGGAGGAAATCATTGACGATGG + Intergenic
916836532 1:168551388-168551410 AAGGAGAAAAAAATAAAGGATGG - Intergenic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
917223967 1:172762187-172762209 AGGGAAAAAAAAATGCAAGAAGG - Intergenic
917507746 1:175643565-175643587 AGGGAAAACAAAATAAAGGATGG + Intronic
917534738 1:175866051-175866073 AAGGAGACAAACATTGAAGATGG - Intergenic
917553451 1:176058604-176058626 AGGGACAAAAACACTGCGGAAGG + Intronic
917593237 1:176498954-176498976 AGGGAGAGAAAAAAGAAGGAGGG - Intronic
917660097 1:177169989-177170011 AGGGAGGAAAAAAGGGAGGGAGG - Intergenic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
918008883 1:180567889-180567911 AGTGAGAAAAAAGTTGGGGGTGG - Intergenic
918300503 1:183199497-183199519 AGAGAGAAAGGAATTGAGGGAGG - Intronic
918916707 1:190649914-190649936 AGGGAGGAAAGAAGTAAGGAAGG - Intergenic
919166549 1:193902320-193902342 AGGAAGAAAAACAATGAAGATGG + Intergenic
919481120 1:198091286-198091308 AGGATAAAAAAAATTGAGAAAGG + Intergenic
919534229 1:198766896-198766918 AGGGAGAAAGAAATAAATGAAGG + Intergenic
919590568 1:199496499-199496521 AGGGAAAACAAAAGTGAGCAGGG + Intergenic
919675068 1:200373891-200373913 AGGCAGAAAAAAAGGGGGGAGGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920281010 1:204843671-204843693 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
920377125 1:205514955-205514977 ACCGAGGGAAAAATTGAGGAAGG + Intronic
920592261 1:207231836-207231858 AGAAAGAAAAAACTTGAGGCTGG - Intergenic
920682206 1:208081927-208081949 CGGGAGCAAAGAATTCAGGAAGG - Intronic
920700084 1:208211395-208211417 AGTGAAAAAAAAATTGTGGCCGG + Intronic
920806859 1:209242899-209242921 AGGTAAAAAAAAATTGTGGCTGG - Intergenic
920907694 1:210187415-210187437 AGTGAGGAAAAAATTAAAGATGG - Intergenic
921109207 1:212015553-212015575 AGGGACACAAACACTGAGGAAGG + Intronic
921312326 1:213856496-213856518 AGGGAGAAAGGAATAGAGGAGGG - Intergenic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921413072 1:214857512-214857534 AGGAAGAAAAAAAGCAAGGAAGG + Intergenic
921448492 1:215274693-215274715 AGGGAGAAAAGAAGGAAGGAAGG - Intergenic
921796543 1:219351379-219351401 AGAGAGAAAGGAATTAAGGAGGG + Intergenic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
921837700 1:219794990-219795012 AGCGAGAGAAAAAAAGAGGAGGG - Intronic
921852063 1:219941665-219941687 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
921938445 1:220816019-220816041 AGGCAGAAAGAAATTGGGGAAGG + Exonic
922000376 1:221471579-221471601 ATGATGAAAAAAATTGAGGGAGG - Intergenic
922305393 1:224340108-224340130 AGGGACACAAAAACTGCGGAAGG + Intergenic
922890929 1:229061593-229061615 AGGAAGGAAAAAAGGGAGGAAGG + Intergenic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923412335 1:233722824-233722846 AGGGAGGAAAAAAGGAAGGAAGG - Intergenic
923548680 1:234943834-234943856 AGGGAGAAATAAATGGAGGTGGG - Intergenic
923791179 1:237112414-237112436 AGAGAGATAAAAAGAGAGGAGGG - Intronic
923945964 1:238887948-238887970 AGGGAAAAAGAAAAAGAGGAAGG + Intergenic
924038516 1:239960022-239960044 AGGAAGGAAAAAATGAAGGAAGG - Intergenic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
924454053 1:244203876-244203898 AGGGAAAGAAGAAATGAGGAAGG - Intergenic
924791420 1:247253402-247253424 AGAGAGAAAACAAGTGAGGGAGG - Intergenic
924941923 1:248818044-248818066 AGGGAGACAAAAGTGGAGGCTGG + Intronic
1063007350 10:1985998-1986020 AGGGAAAAACAAATAGATGAAGG + Intergenic
1063049429 10:2430813-2430835 AGGAAGAAAGAAAATAAGGAAGG + Intergenic
1063083750 10:2793755-2793777 AGGAAGAAAAAAATGGAGGGAGG - Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1063306996 10:4911445-4911467 AAAGAGAAAAAAAGTGAGGGGGG - Intergenic
1063580984 10:7306735-7306757 AGGGGGGAAAAAAAAGAGGAAGG + Intronic
1063698029 10:8356541-8356563 AGGGAGAAAATAAATTAAGAAGG - Intergenic
1063794294 10:9493668-9493690 AGAGAGAAAAAAATAAAGAAGGG + Intergenic
1063827732 10:9917228-9917250 GGAGACAAAGAAATTGAGGAAGG + Intergenic
1063838388 10:10042680-10042702 AGAGAGAAACAACTTGAGAATGG - Intergenic
1063919739 10:10920828-10920850 AGGGAGGAAGAAACTTAGGAAGG + Intergenic
1064362770 10:14680724-14680746 AGGGAGTAAAAAAAGGTGGAAGG + Intronic
1064526356 10:16260532-16260554 AGGAAGAAAGAAATGGAGGGAGG + Intergenic
1064526368 10:16260577-16260599 AGGAAGAAAGAAATGGAGGGAGG + Intergenic
1064587309 10:16851953-16851975 AGGGAGGGAAAGATTGAGGGAGG - Intronic
1064662910 10:17624151-17624173 AGGGAAAAGAAAGTTGAGGTAGG + Intergenic
1064686039 10:17863057-17863079 TGAGAGAATAAAATTGAGGGGGG + Intronic
1064724908 10:18269368-18269390 AGGAAGAAAAAAATGGAGACAGG - Intronic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1064983045 10:21183289-21183311 AGGAAGAAATAAAGTGAAGAAGG + Intergenic
1065450165 10:25848440-25848462 AGGGAGGAAAAAAGGGAGGGAGG + Intergenic
1065553723 10:26893747-26893769 AGGGACACAAAAACTGCGGAAGG + Intergenic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065638339 10:27753402-27753424 AGGAAGAAAGAAATGAAGGAAGG - Intergenic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065708766 10:28495363-28495385 AGGGAGAAAGAAAGGAAGGAAGG + Intergenic
1066084343 10:31961902-31961924 AGGAAGAAGAAAATTGTGTACGG + Intergenic
1066116024 10:32241033-32241055 AGGAAGAAAGAAAGAGAGGAAGG - Intergenic
1066129407 10:32377686-32377708 AGGAAGAAAAAAAAAGAGGTGGG - Intronic
1066247547 10:33598048-33598070 CAGGGGAAAAAAATTGAGGCAGG - Intergenic
1066458768 10:35595342-35595364 AGGGAGAAAAGAGGAGAGGAAGG - Intergenic
1067107404 10:43375321-43375343 AAGAAGAAAAAAAGTGAGGCTGG - Intronic
1067203138 10:44192296-44192318 AGGAAGAGAAAAACAGAGGAAGG + Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067304061 10:45042787-45042809 AAGGAGATAAAAATGGAAGAAGG - Intergenic
1067391074 10:45864938-45864960 AGGGACACAAAAACTGCGGAAGG - Intergenic
1067484248 10:46632144-46632166 AGTGAGAAAAAAAATGAGACAGG - Intergenic
1067665216 10:48271761-48271783 AGGGTGAATACAATTCAGGAGGG + Intronic
1067853466 10:49769838-49769860 AGGGAGAAAGAAAGGGAGAAGGG + Intergenic
1067872206 10:49971174-49971196 AGGGACACAAAAACTGCGGAAGG + Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068799171 10:61120086-61120108 AGGAAGGAAAGAAGTGAGGAGGG + Intergenic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069189611 10:65469625-65469647 AGGTAGCAAGAAATTGTGGATGG - Intergenic
1069399226 10:68024713-68024735 AGGTAGAAAAACATTAAGCAAGG + Intronic
1069452066 10:68525946-68525968 AGGGACACAAAAACTGCGGAAGG + Intronic
1069524692 10:69159076-69159098 AGGGTTAAAAAGATTGAGGCCGG + Intronic
1069681469 10:70288640-70288662 AGGGCCAAAAAAGTTGAGGGAGG - Intergenic
1069862871 10:71482211-71482233 AGGGAGGAAGAAAGTGACGAAGG - Intronic
1070138264 10:73715165-73715187 AGGGACACAAAAACTGCGGAAGG - Intergenic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070675028 10:78406441-78406463 AGGGAGAAAAGAAAGGAGCAAGG - Intergenic
1070809563 10:79290820-79290842 AGGAGGAAAAAAATGGAGGGTGG - Intronic
1070888612 10:79925818-79925840 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
1071084121 10:81848283-81848305 AGAGAGAAAGAAATAAAGGAAGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071453270 10:85819952-85819974 AGGGAGAGAAAGAGAGAGGAAGG + Intronic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071625921 10:87169761-87169783 AGTGAGAAAAAAAATGAGACAGG + Intronic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1072343085 10:94474862-94474884 AGCGAGAAAGATATTGAGAAAGG + Intronic
1072645089 10:97247703-97247725 AGGGAGAGAAAAAGAAAGGATGG + Intronic
1072761923 10:98063727-98063749 AGGGAGGAAAGAATGAAGGAAGG - Intergenic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1072926961 10:99624167-99624189 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1072947318 10:99821505-99821527 AGGGACACAAAAACTGCGGAAGG - Intronic
1073677503 10:105665160-105665182 AGGGAGGTAAAAATTAAAGAAGG + Intergenic
1073844820 10:107543435-107543457 GGGGAGAAAAAAATTGGAAAGGG - Intergenic
1073857826 10:107697618-107697640 AGGGAGGAGGAAATGGAGGAGGG - Intergenic
1073937037 10:108645317-108645339 AGGAAGAAAAATATTCAAGAAGG + Intergenic
1073998772 10:109346097-109346119 AGGGAGAGAAAAATGGAACAAGG + Intergenic
1074319785 10:112391370-112391392 AAAAAAAAAAAAATTGAGGAAGG + Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074577768 10:114686592-114686614 AGGGAGAAAGGAAAAGAGGAAGG - Intergenic
1074599863 10:114902572-114902594 CTGGAGAAAAAAATCCAGGAAGG + Intergenic
1075497624 10:122939420-122939442 AGGGAAAAATAAAGTGAGAAAGG + Intronic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1077333767 11:1994486-1994508 AGGGAGGAAGAAGTTGAGGGTGG - Intergenic
1077345038 11:2043651-2043673 AGAGAGAAAGAAATGGAGAAAGG - Intergenic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1077664798 11:4098289-4098311 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1077779287 11:5307746-5307768 AGGGAGAAAGAAAGGAAGGAAGG - Intronic
1077839810 11:5961594-5961616 AGGGACACAAACACTGAGGAAGG + Intergenic
1077903984 11:6514524-6514546 AGGGAGAGAAAAAGGGAGGAAGG - Intronic
1078131471 11:8617621-8617643 AGGCAGAAAAAAATTCACCAAGG + Exonic
1078327429 11:10391977-10391999 AGGGACACAAAAACTGCGGAAGG - Intronic
1078394921 11:10972559-10972581 AGAGAGAAACAAACTGAGAATGG + Intergenic
1078524778 11:12091904-12091926 AGGGAGGAGAAAAGGGAGGAAGG - Intergenic
1078562559 11:12385905-12385927 ATGGGGAATAAAATGGAGGATGG - Intronic
1078648442 11:13164312-13164334 ATGGAGAAAAAAATTGGGCGTGG - Intergenic
1078867748 11:15313508-15313530 AGGGAGAAAAAGACAGAGAAGGG - Intergenic
1078892173 11:15567295-15567317 AGGAAGAAAGAAAAGGAGGAAGG - Intergenic
1078963494 11:16307814-16307836 GGCTAGAAAAAAATTGATGAAGG - Intronic
1079155952 11:17948423-17948445 AGGGAGCAACAAATAGGGGAAGG - Intronic
1079284990 11:19120746-19120768 AGGGAAAAAAAATTTAAAGAGGG - Intronic
1079340329 11:19606470-19606492 AGGGAGAAAAAAGTGGAAAATGG - Intronic
1079470666 11:20774284-20774306 AGGGAGGAAAAAAGGAAGGAAGG - Intronic
1079493536 11:21015672-21015694 AAGGAGAAAGAACTAGAGGAGGG - Intronic
1079569096 11:21920921-21920943 AAGGAGAAAAATTTTGAGAAGGG - Intergenic
1079769957 11:24446363-24446385 AGGGACACAAAAACTGCGGAAGG + Intergenic
1080053247 11:27878590-27878612 AGGGAGAAAAGAAAGAAGGAAGG - Intergenic
1080140367 11:28911268-28911290 AGGGAAAGAAAAATGGAGGATGG - Intergenic
1080305394 11:30829533-30829555 AGGGACAGAATAATTGATGAGGG + Intergenic
1080396634 11:31895873-31895895 AGGCACAAAAAAATTAAGGAAGG - Intronic
1080499209 11:32852701-32852723 AGAGAGGAGAAAATTGAGGTCGG + Intronic
1080928669 11:36784838-36784860 AGGGAGAAAATAATGGAGGGAGG - Intergenic
1080932230 11:36823556-36823578 AGAAAAAAAAAAATTGAGAAAGG - Intergenic
1080944265 11:36953354-36953376 GGGAGGAAAAAAATTAAGGAAGG - Intergenic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1081882872 11:46468841-46468863 AGAGAGAAAGAAAAGGAGGAAGG + Intronic
1081927762 11:46845177-46845199 AGGGTGATGAAAATGGAGGAAGG + Intronic
1082105611 11:48218096-48218118 AGAAAGAAAAGAAGTGAGGAAGG - Intergenic
1082148954 11:48707902-48707924 AGGGACACAAACATTGTGGAAGG + Intergenic
1082281781 11:50278554-50278576 AGGGAAAATAAATTTGAGAAGGG - Intergenic
1082619732 11:55405375-55405397 AGGGGGAAAAAAATTTGGTAAGG + Intergenic
1082785820 11:57315870-57315892 AGGGAAAAAAAAATCGATGCAGG - Intronic
1082852931 11:57781524-57781546 AGGGGCAAAAAAACAGAGGAAGG - Intronic
1082887002 11:58096099-58096121 AGGGAGAAAGAAAGAGAGGGAGG - Intronic
1082953373 11:58842257-58842279 AGTCAGAAAAAAAATTAGGATGG + Intronic
1083041368 11:59690700-59690722 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1083119024 11:60492253-60492275 AGGGACAAAAACACTGCGGAAGG + Intergenic
1083285424 11:61655677-61655699 AGGGACACAAAAACTGCGGAAGG - Intergenic
1083351885 11:62035475-62035497 AAGGAGAAAGAAAGAGAGGAAGG - Intergenic
1083372774 11:62194938-62194960 AGGGACACAAAAACTGCGGAAGG + Intergenic
1083467621 11:62859184-62859206 AGGGACACAAAAACTGCGGAAGG - Intronic
1083543141 11:63528639-63528661 AGGGACACAAAAACTGCGGAAGG - Intergenic
1083543437 11:63530982-63531004 AGGGACACAAAAACTGCGGAAGG - Intergenic
1083549053 11:63572138-63572160 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1083608767 11:63994994-63995016 AGGGTGGGAAAAATTGATGATGG + Intronic
1083771670 11:64871069-64871091 AAGGGGAAAAAAAGTCAGGAGGG + Intronic
1084021776 11:66422055-66422077 AGGCAGAGAAGAAGTGAGGAAGG - Intronic
1084207429 11:67604022-67604044 AGGGACACAAAAACTGCGGAAGG - Exonic
1084247419 11:67868632-67868654 AGGGACACAAAAACTGCGGAAGG - Intergenic
1084415478 11:69030183-69030205 AGAGAGAAAAAAAGAAAGGAGGG - Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1084742696 11:71149889-71149911 AGGAAGGAAAAAAGGGAGGAAGG + Intronic
1084830799 11:71767613-71767635 AGGGACACAAAAACTGCGGAAGG - Intergenic
1084880072 11:72164651-72164673 AGGGACACAAAAACTGCGGAAGG + Intergenic
1084970701 11:72770512-72770534 AGGAAGAAAAAAAGTAAGGCTGG - Intronic
1085076246 11:73595499-73595521 AGACTGAAAAAAAATGAGGAGGG - Intronic
1085103353 11:73820659-73820681 TGGATGAAAAAAATGGAGGATGG - Intronic
1085329912 11:75639744-75639766 AGGGAGAAAACAAGGGAGGGAGG + Intronic
1085479084 11:76806917-76806939 AGAAAGAAAGAAATTAAGGAAGG + Intergenic
1085569518 11:77547248-77547270 AGGGAGAGAGAAAGAGAGGAAGG - Intronic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1085928413 11:81051662-81051684 AGGGACAAAGACATTGGGGAAGG - Intergenic
1085983249 11:81750477-81750499 AGGAAGAATAAAATTAAAGAAGG + Intergenic
1086013036 11:82128681-82128703 AAAGAGAAAAAATTTGTGGAAGG - Intergenic
1086088962 11:82985629-82985651 AGAGAGAAAAAAAATGAGAGTGG + Intronic
1086181121 11:83952915-83952937 TGAAAGAAAAAAATTAAGGAGGG + Intronic
1086608065 11:88721062-88721084 AAGGAGAATAAATTTCAGGAAGG - Intronic
1086777246 11:90853769-90853791 AGGGAGAAAAGAAGGGAGAAAGG + Intergenic
1086821293 11:91439190-91439212 AGGAGGAAAACAATAGAGGAAGG - Intergenic
1087261473 11:96017369-96017391 AGGGAGAAAAGAGGTGGGGAGGG - Intronic
1087318378 11:96631377-96631399 AGGGATGAGAAAATTGATGATGG + Intergenic
1087397330 11:97616736-97616758 AGAGAGACAAAAATAGAGCAAGG + Intergenic
1087423237 11:97959230-97959252 AAGGAGAAAAGGATGGAGGAAGG + Intergenic
1087723705 11:101695340-101695362 AGGGACACAAAAACTGCGGAAGG + Intronic
1087724636 11:101703838-101703860 AGGGACACAAAAACTGCGGAAGG + Intronic
1087845840 11:102971557-102971579 AGGGAGAGAGGAATGGAGGAAGG + Intergenic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1087940812 11:104094515-104094537 AGGAAGACAAACTTTGAGGATGG - Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088019412 11:105101353-105101375 TGGGAGGAAAAAGTTGTGGAAGG - Intronic
1088254651 11:107891859-107891881 AGGGAAAAAAAAAATGAACAGGG - Intronic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088739338 11:112754060-112754082 AGGGAGGAAAAAAATCAGGAAGG + Intergenic
1088868054 11:113867828-113867850 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
1088924964 11:114292781-114292803 GGGTAGAAAAAAATTAATGATGG + Intronic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089323539 11:117642321-117642343 AGCAAGAAAAAAAAAGAGGATGG - Intronic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089493546 11:118897714-118897736 AGGGAGCAATAACTTGAAGAAGG + Exonic
1089663321 11:120000129-120000151 AGAGAGAAACAAATTAAAGATGG + Intergenic
1089703918 11:120263566-120263588 ACGCAGAAAAAAATTGAGTATGG - Intronic
1090168083 11:124572355-124572377 AGCAAGAAAAAAAATGAGCAAGG + Intergenic
1090653386 11:128825124-128825146 AGGGAGAAAAGAATGGAAGAAGG - Intergenic
1090799490 11:130161433-130161455 AGGGAGAACAAACTTGGGGTGGG - Intronic
1091120423 11:133052959-133052981 AGGGAGTGAAAAAGTGAGGGAGG - Intronic
1091138276 11:133212469-133212491 ATGGAGCAAAGACTTGAGGAAGG - Intronic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1092041897 12:5392750-5392772 AGAGTGAAAGAAATTGATGAGGG - Intergenic
1092066310 12:5592338-5592360 GGGAAGAGAAAAACTGAGGATGG + Intronic
1092332978 12:7602629-7602651 AGGAAAAAAAAAATGGAGGCAGG + Intergenic
1092559808 12:9600743-9600765 AGGGACACAAAAACTGCGGAAGG + Intronic
1092620854 12:10265866-10265888 AAGGAGAAAATAATTGAAAAAGG - Intergenic
1092850277 12:12619851-12619873 AGGTAGAAAAGAAGTGTGGAGGG - Intronic
1093007678 12:14068188-14068210 AGGGAGAAAAAGAGGGAGGGAGG - Intergenic
1093124416 12:15311248-15311270 AGAGAGAAAGAAAGAGAGGAAGG - Intronic
1093398107 12:18708154-18708176 AGGGAGAAGAAAATGGAGAAAGG - Intronic
1093657269 12:21709627-21709649 AAGCAAAAAAAAGTTGAGGAAGG - Intronic
1093737728 12:22641170-22641192 AGGGAGAACTACATTGAGAATGG + Intronic
1093844509 12:23952137-23952159 ATAGAGAAAAAAAGTGAAGAAGG + Intergenic
1093917619 12:24823375-24823397 AGGGGGCAAAAAAATGAAGAAGG - Intronic
1093995845 12:25641839-25641861 AGAGTGAAAAAAAATTAGGATGG - Intronic
1094130345 12:27068139-27068161 AGAGAAAGAAAAATTGAGGCAGG + Intergenic
1094183452 12:27616088-27616110 AGAGGGAAAAGAATTGAGAACGG - Intronic
1094245880 12:28292311-28292333 AGGGTGAAATAAATTGAAAACGG - Intronic
1094349202 12:29504570-29504592 AGTGAGAGAAAAAGAGAGGAAGG + Intronic
1094389382 12:29932722-29932744 AGGGACACAAAAACTGCGGAAGG - Intergenic
1094408636 12:30146578-30146600 AGGAAGAGAGAAATTGGGGATGG - Intergenic
1094426560 12:30322464-30322486 AGGGAGAAAAGACTTTAAGAAGG + Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094623192 12:32099788-32099810 AGGGACACAAAAACTGCGGAAGG + Intergenic
1095860705 12:46914832-46914854 GGGGAGATAAGAAGTGAGGATGG + Intergenic
1096064112 12:48725412-48725434 AGGGACACAAACACTGAGGAAGG + Intergenic
1096192617 12:49630434-49630456 AAGGAGCACAAAATTCAGGAGGG - Intronic
1096318203 12:50587626-50587648 AGGAAGAAAAAAATTGAAAATGG - Intronic
1096420713 12:51454955-51454977 AGGGACACAAAAACTGCGGAAGG - Intronic
1096796818 12:54082917-54082939 GGAGAGAAAAAAATTGGGGGGGG + Intergenic
1096940027 12:55333708-55333730 AGGGACACAAAAACTGCGGAAGG + Intergenic
1097076822 12:56401029-56401051 AGGGACACAAAAACTGCGGAAGG - Intergenic
1097190906 12:57219224-57219246 AGGGAGAGAAACCTGGAGGAGGG - Intronic
1097290365 12:57909254-57909276 AGGGAGAAAAGAACTGATGTCGG + Intergenic
1097330543 12:58328127-58328149 AGGGACACAAAAACTGCGGAAGG - Intergenic
1097331478 12:58336616-58336638 AGGGACACAAAAACTGCGGAAGG - Intergenic
1097533919 12:60840896-60840918 AGGGAGGAAAGAAAAGAGGAGGG + Intergenic
1097751664 12:63361348-63361370 AAGATGAAAAAAATTGAAGAGGG - Intergenic
1097776813 12:63656732-63656754 AGAGAAAAAAAAGTGGAGGAAGG - Intronic
1097787140 12:63773268-63773290 AGAAAGAAAAAAATGAAGGAAGG + Intergenic
1097926528 12:65134223-65134245 AGGGAGAGAGAAAGGGAGGAAGG + Intergenic
1097967145 12:65593604-65593626 AAGGGGAAAAAAAGTGAAGAAGG - Intergenic
1098048189 12:66424372-66424394 GGGAAGCAAGAAATTGAGGACGG - Intronic
1098242691 12:68484763-68484785 AGGGACACAAACATTGCGGAAGG + Intergenic
1098990206 12:77057543-77057565 AGGGTGCAAAAAATTAAGAACGG - Intronic
1099213881 12:79830003-79830025 AGGGAGAGAAAATGTGAAGAAGG + Intronic
1099535755 12:83842371-83842393 AGGGAGAACAAAAGTGTGCAAGG - Intergenic
1099712245 12:86242681-86242703 AGAGAGGGAAAAATGGAGGAAGG + Intronic
1099868068 12:88309507-88309529 AGGGAGAAAGTAAGGGAGGAAGG - Intergenic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100102828 12:91130246-91130268 AGGAAGAAAGAAAGGGAGGAAGG - Intergenic
1100203801 12:92326934-92326956 AGGGAGGAAAAAAGGAAGGAAGG - Intergenic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1100307450 12:93364021-93364043 AGGGGAAAAAAAAATGAGGCAGG - Intergenic
1100316596 12:93450347-93450369 AGAGAGAAAAAATGGGAGGAGGG + Intergenic
1100370867 12:93967230-93967252 AGGGAGAAAAGGATGGAGGGAGG - Intergenic
1100658259 12:96669890-96669912 ATGGAGCATAAACTTGAGGATGG + Intronic
1100908588 12:99332056-99332078 AGGGAGGAACAAACTGTGGAAGG - Intronic
1101438863 12:104687779-104687801 AGGGAAAAAAAAATTTTGGGGGG - Intronic
1101607170 12:106256356-106256378 AGAGAGAGAAGGATTGAGGAAGG - Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101774261 12:107779369-107779391 ACTGAAAAAAAAATTGAGGGAGG + Intergenic
1102094657 12:110227755-110227777 AGAGAGAAAAAAAGGAAGGAGGG + Intergenic
1102135430 12:110570315-110570337 AGGGACACAAAAACTGCGGAAGG + Intronic
1102194905 12:111018188-111018210 AGGGAGAGAGAAAGAGAGGAAGG + Intergenic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1102764792 12:115423205-115423227 AGGGAGGAAAAAGAGGAGGAGGG + Intergenic
1102772343 12:115489219-115489241 CGAGAGGAAGAAATTGAGGAAGG + Intergenic
1102840964 12:116121377-116121399 AGGGAGAAAAAAAGTCAATATGG + Intronic
1103198075 12:119063405-119063427 AGAGAGGAAAACATGGAGGAGGG - Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103353814 12:120304650-120304672 AGAAAAAAAAAAGTTGAGGATGG + Intronic
1103366864 12:120389896-120389918 AGGGAGGAAGAAAAAGAGGAAGG + Intergenic
1103688567 12:122752357-122752379 AGAGAGAAAAGAAGAGAGGAAGG + Intergenic
1103854504 12:123956876-123956898 AGAGTGAAATAAATTGGGGAAGG + Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104276403 12:127332465-127332487 AGAAAGAAAAAAATAGAGGAAGG + Intergenic
1104463354 12:128971792-128971814 AGGGAGCAAAGAAGGGAGGAAGG - Intronic
1104463361 12:128971816-128971838 AGGGAGCAAAGAAGGGAGGAAGG - Intronic
1104540122 12:129656241-129656263 AGGAAGAAAAGAATGAAGGAAGG + Intronic
1104668880 12:130667070-130667092 AGGGAGGAAAAAATGAGGGAGGG + Intronic
1104970315 12:132528005-132528027 AGGGGGACAAAGATGGAGGAGGG - Intronic
1105019592 12:132807323-132807345 AGTGTGAAAGAAAATGAGGATGG - Intronic
1105238295 13:18582964-18582986 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1105349109 13:19600495-19600517 AGGGACACAAAAACTGCGGAAGG + Intergenic
1105544612 13:21342412-21342434 AGGGAGCAAGAAAATGAGAAGGG - Intergenic
1105640379 13:22256655-22256677 ACGAAGAAAAAAATTGAAAAAGG - Intergenic
1106186596 13:27415236-27415258 AGGGAGAAAAGAATTGAAAAAGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106594329 13:31123732-31123754 AGGAAGAAAAGAAGGGAGGAGGG - Intergenic
1106732929 13:32560683-32560705 AGAGAGACAAGAATTGAGCATGG - Intergenic
1106875688 13:34070006-34070028 AGGGTGTAAAATATTGAGGCAGG + Intergenic
1107562817 13:41572640-41572662 AGGGACACAAACACTGAGGAAGG + Intronic
1107832769 13:44389134-44389156 GGGGACACAAAATTTGAGGAAGG + Intronic
1107921215 13:45210239-45210261 AGGGAAGAAAAAGATGAGGATGG - Intronic
1107998738 13:45887578-45887600 AGAGAGAAATAAAATGATGATGG + Intergenic
1108072579 13:46643425-46643447 AGGGAGAGAAAAAGAGAGAAAGG - Intronic
1108220693 13:48231006-48231028 AGGGAGGAAAAAATGGAAGTGGG - Intergenic
1108351695 13:49594070-49594092 AGGGACACAAACATTGCGGAAGG + Intergenic
1108421065 13:50250130-50250152 AGGGAGGAAGAAAGAGAGGAAGG - Intronic
1108459143 13:50647564-50647586 ATGGAGAAAAAAATTACTGATGG - Intronic
1108786385 13:53907623-53907645 ATGGAGCAAAAAATGGATGAAGG - Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1108890663 13:55254199-55254221 GGTGAGAAAAAAATTGATAAAGG - Intergenic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1109652509 13:65348067-65348089 AGGCAGAAAAAAATCGATAAAGG - Intergenic
1109855566 13:68122761-68122783 AGGGAGAAATAAATGGCAGAAGG + Intergenic
1110198909 13:72825178-72825200 AGGGAAAAAAAAATTCACAAAGG + Intronic
1110347648 13:74466518-74466540 AAGGAAAAAAAAATTGGAGATGG - Intergenic
1110504668 13:76271798-76271820 GGATAGAAAAAAATGGAGGAAGG + Intergenic
1110506960 13:76298227-76298249 AGGGAGAAAGAAATGCAGAAAGG + Intergenic
1110541764 13:76713913-76713935 TGGAACAAAAAAATGGAGGAGGG + Intergenic
1110793022 13:79606304-79606326 ATGGAGATAAAAACAGAGGAAGG - Intergenic
1111064758 13:83075218-83075240 AGGGAAAACAAAATGGAGCAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111108316 13:83674482-83674504 CGGAAGAAAAGAATTGAGGAAGG - Intergenic
1111317201 13:86578169-86578191 AAGGAAGAAAAAATGGAGGAAGG - Intergenic
1111355454 13:87095318-87095340 AGAGAGAGAAAAAATGAGGTTGG - Intergenic
1111481773 13:88837823-88837845 AGAGAGAGAATAATTGAGGCAGG + Intergenic
1111695437 13:91617639-91617661 AGGGAGAAAAGAAAGGAGGGAGG - Intronic
1111836757 13:93397755-93397777 AGAGAAAAAAAAAAAGAGGAGGG - Intronic
1111908809 13:94287175-94287197 TGGGAGAGAAAGATTGATGAAGG - Intronic
1112227065 13:97550231-97550253 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1112682977 13:101788178-101788200 AGGAAAAAAAAAGTGGAGGAGGG - Intronic
1112809716 13:103203676-103203698 AGGGAAAAAAAAAATGATGACGG - Intergenic
1112911077 13:104484404-104484426 AGGGATAAAATAATTGAGCTGGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113217428 13:108058719-108058741 AGGGAGAAAGAAAGGGAGGCAGG + Intergenic
1113293500 13:108931904-108931926 AGGAAGAAAAAAATGAAGAAGGG - Intronic
1113450138 13:110403279-110403301 AGAGAGAAACAAATTAAAGATGG - Intronic
1113478814 13:110605806-110605828 AGGGACACAAACACTGAGGAAGG - Intergenic
1114524160 14:23357711-23357733 AAGGAGAAAAGAAGTGAGGGAGG - Intronic
1114594172 14:23897843-23897865 AGGGACACAAACACTGAGGAAGG - Intergenic
1114747029 14:25160211-25160233 AGGAAGGAAAAATTAGAGGAAGG + Intergenic
1115084268 14:29494490-29494512 AGGGAGAAAAGAAGGAAGGAAGG + Intergenic
1115450198 14:33539106-33539128 AGGGAGAAGAAGATTGTGTAGGG + Intronic
1115624278 14:35174362-35174384 ATGGAGAAAAAAATAGGGGAGGG - Intronic
1115654493 14:35430491-35430513 TGGCAGAAAAACTTTGAGGAAGG + Intergenic
1115669682 14:35596092-35596114 AGGGAGAAAAAGATCAAGTATGG + Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116029652 14:39555375-39555397 CTGGAGAAAAAAATTGTGGCAGG - Intergenic
1116041963 14:39696948-39696970 AGGGAGAAAAAAATTCTTGTAGG - Intergenic
1116154038 14:41180691-41180713 AGAGAGAAAACAATTGAGGCAGG + Intergenic
1116207105 14:41882524-41882546 GACGAGAAAAAAATTGAGGAAGG - Intronic
1116266658 14:42700175-42700197 AGGAAGAAGAAAATAGAGTAAGG + Intergenic
1116374437 14:44180703-44180725 AGGAAGAGAATAATTGATGATGG + Intergenic
1116616746 14:47149835-47149857 AGATTGAATAAAATTGAGGATGG - Intronic
1116755579 14:48943963-48943985 AGGGAGAAAAACATGGAGGATGG - Intergenic
1117365612 14:55024827-55024849 AGGGACACAAAAACTGCGGAAGG + Intronic
1117391835 14:55270055-55270077 AGGAAAAAAAAAATTAAGGAAGG - Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1117816239 14:59600970-59600992 AGTGAGAAAAGAATTGGAGAGGG - Intronic
1118017187 14:61672271-61672293 AAGGAGAAAAAAAGTGGGGGGGG + Intergenic
1118122517 14:62860933-62860955 AGGAAGAAAGAAAGTGAGGGAGG + Intronic
1118253134 14:64182537-64182559 AGGGACACAAACACTGAGGAAGG - Intronic
1118329764 14:64806140-64806162 AGAGAGAAAAGGATAGAGGAGGG + Intronic
1118418759 14:65575618-65575640 GGGGAAAAAAAAAAAGAGGAAGG - Intronic
1118545404 14:66881708-66881730 AGGGAGAAAAAAATTAATTCAGG - Intronic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1118621350 14:67617331-67617353 GGGGAGAAAAAAATAGAACAAGG + Intergenic
1118631213 14:67705054-67705076 AGGCAGAAATAAATTGATAAAGG + Intronic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119116029 14:72022435-72022457 AGGGAGAAAAAAGTAGAGCAAGG + Intronic
1119841341 14:77795342-77795364 AGGGACACAAAAACTGCGGAAGG - Intergenic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1119938096 14:78611418-78611440 AGGAAAAAAAAAAAAGAGGAGGG - Intronic
1120474159 14:84966580-84966602 AGAGAGATAAAAATTCAGTAGGG + Intergenic
1120590318 14:86366318-86366340 AGGGAGAAAGAAAGGGAGGAAGG + Intergenic
1120640204 14:87001163-87001185 AGGCAGAAAGAAACTAAGGAGGG - Intergenic
1120671006 14:87362715-87362737 AGTGAGAAAAAACTTGATAAAGG + Intergenic
1120714695 14:87828382-87828404 AAGGAGAAAAAAAGAGAGCAGGG - Intergenic
1120822199 14:88922398-88922420 AGGGTGAGAGGAATTGAGGATGG - Intergenic
1120844984 14:89117614-89117636 AGAGAGCCAAAAATTGAGGGTGG + Intergenic
1121451762 14:94012448-94012470 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1121625787 14:95384606-95384628 AAGGAAAAAGACATTGAGGATGG - Intergenic
1121677883 14:95769219-95769241 AGGGAGAAAGAAATAGGGAATGG + Intergenic
1121773579 14:96574742-96574764 AGGGAGAAAAAAGTGGAGTCAGG + Intergenic
1121915982 14:97837318-97837340 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1122757541 14:103994306-103994328 GGGAAGAAAAAAGTGGAGGAGGG - Intronic
1122957643 14:105078749-105078771 AGGGAGACAAACACTGCGGAAGG - Intergenic
1123917701 15:25049003-25049025 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
1124153115 15:27200016-27200038 AGGGAGAAAGTAAGGGAGGAAGG - Intronic
1124226590 15:27900431-27900453 AGAGAGAGAGAAATTCAGGACGG - Intronic
1124227904 15:27911583-27911605 AGGGAGAAAACAAGAGAGAAGGG + Intronic
1124281282 15:28364482-28364504 AGGAATAAAAAAAGTGAGCATGG + Intergenic
1124301420 15:28547139-28547161 AGGAATAAAAAAAGTGAGCATGG - Intergenic
1124529694 15:30494644-30494666 GGAGAGAAGAAAATTAAGGAAGG - Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124768965 15:32513043-32513065 GGAGAGAAGAAAATTAAGGAAGG + Intergenic
1124803682 15:32860133-32860155 AGAGAGAAAGAAAAAGAGGAAGG + Intronic
1124812373 15:32953700-32953722 ACGGAGGAAAAAATGGTGGAGGG + Intronic
1125193771 15:37022953-37022975 AGTAAGAAAAAAATTGAAGCAGG - Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125701490 15:41689351-41689373 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1125791072 15:42366184-42366206 AGGGAGAAAAGCATTCAGAATGG + Intronic
1125877851 15:43166703-43166725 AGGGACACAAAAACTGCGGAAGG - Intronic
1126320674 15:47419451-47419473 AGGGAGAATGAACTGGAGGATGG + Intronic
1126526167 15:49656902-49656924 AGGGAGTGAGAAATGGAGGAAGG + Intergenic
1126642432 15:50841537-50841559 AGGAAGAAATAAATTGAAAATGG - Intergenic
1126767310 15:52022005-52022027 AGGGGGAAAAAGATTGAGAATGG + Intronic
1126799582 15:52286787-52286809 AGGGACACAAACACTGAGGAAGG + Intronic
1126851445 15:52799332-52799354 AGGAAGAAAAGAATGGAGGGAGG - Intergenic
1127154696 15:56111494-56111516 AGGGACACAAACACTGAGGAAGG + Intronic
1127192112 15:56541270-56541292 AGGGACACAAAAATTGCGGAAGG + Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127417636 15:58772204-58772226 CAGGAGCAAAACATTGAGGATGG - Exonic
1127660794 15:61098244-61098266 AGGGAGAAAAAAAGGGGGGAGGG - Intronic
1127735214 15:61833053-61833075 AGGAAGAAAAAATTTAAAGATGG + Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127788619 15:62378635-62378657 AGGGAGGAAGAAATCGGGGAAGG + Intergenic
1127946802 15:63763524-63763546 AGGAAAAGAAAAATGGAGGAGGG + Intronic
1128131033 15:65227210-65227232 AGGGACACAAAAACTGCGGAAGG - Intergenic
1128500364 15:68222972-68222994 AGGGACATAAACACTGAGGAAGG + Intronic
1128666387 15:69541058-69541080 AGGTAGAAAAGACTTGAAGACGG + Intergenic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1130140944 15:81225832-81225854 AGCAAGAAAAAAGTTGAGGCAGG + Intronic
1130170492 15:81507228-81507250 AGTGAAAGAAAAAATGAGGATGG - Intergenic
1130384043 15:83395805-83395827 AGGAAGAAAAGAATGAAGGAAGG + Intergenic
1130407703 15:83616803-83616825 AGGAAGAAAAGAATGAAGGAAGG + Intronic
1130806094 15:87324767-87324789 ATGGACTAAAAAATTGAGTAAGG - Intergenic
1130944488 15:88540829-88540851 AGGGACACAAAAACTGTGGAAGG + Intronic
1131779404 15:95840491-95840513 ACAGATAAAAAAACTGAGGAGGG + Intergenic
1131796978 15:96029136-96029158 AGGGAGAGAAGAATAGAGGGAGG + Intergenic
1131925902 15:97383457-97383479 AGGGAGAAAGGAATGGAGGGAGG + Intergenic
1131966891 15:97853764-97853786 GGGGAGAGAGAAATTGAAGATGG - Intergenic
1132020406 15:98356518-98356540 AGGGAGAAAGAAAGGGAGGGAGG + Intergenic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132356661 15:101176068-101176090 AGGAATATAAAAATTAAGGAGGG + Exonic
1132440614 15:101860645-101860667 AGGGACACAAAAACTGCGGAAGG - Intergenic
1133087454 16:3375924-3375946 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1133433025 16:5755056-5755078 AGGGACACAAAAACTGCGGAAGG - Intergenic
1133517243 16:6521401-6521423 AGAGAAAAAAGAAATGAGGAAGG - Intronic
1133687446 16:8179429-8179451 AGGGACACAAAAACTGCGGAAGG - Intergenic
1133698279 16:8285837-8285859 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1134442250 16:14305833-14305855 AGGAAAAAAAAAATTCAGCATGG + Intergenic
1134453243 16:14376210-14376232 GGGGAGAAAAAAAGTGGGAAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134911030 16:18026590-18026612 AGGGAGAAAGAAAGGAAGGAAGG - Intergenic
1135181767 16:20281083-20281105 AGGGAGAGAAGAATGAAGGAAGG - Intergenic
1135186054 16:20316890-20316912 AGGGAGAAAGGAATACAGGAGGG - Intronic
1135502491 16:23008743-23008765 ATGGAGGAAATAATTGGGGAGGG + Intergenic
1135549685 16:23388459-23388481 AGGGGGAAAAAAAAAGAAGAAGG + Intergenic
1135577836 16:23599753-23599775 AGGGACACAAAAACTGCGGAAGG + Intergenic
1135654132 16:24233008-24233030 ATGGTGAAAAAAATAGATGAAGG - Intergenic
1135741479 16:24979101-24979123 AGGCAGAAATAAATTTAGAAGGG + Intronic
1136019211 16:27429353-27429375 AGGGAGGGAAAAAGAGAGGAAGG - Intronic
1136795884 16:33019142-33019164 AGGAAGGAAAAAAATAAGGAAGG + Intergenic
1136909603 16:34135055-34135077 AGGGAAAGAAAAAGAGAGGAAGG - Intergenic
1136930390 16:34412725-34412747 AGGGACACAAAAACTGCGGAAGG - Intergenic
1136974184 16:34999083-34999105 AGGGACACAAAAACTGCGGAAGG + Intergenic
1137366569 16:47864736-47864758 AGGGACACAAAAACTGCGGAAGG + Intergenic
1137408885 16:48211206-48211228 AGACAGAAAAAAATAGAGGGAGG + Intronic
1137474240 16:48793040-48793062 AGGGAGAAAGAAAGGAAGGAAGG - Intergenic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137919676 16:52474723-52474745 AGGAAGAAAAGAACTAAGGAAGG + Intronic
1138043734 16:53699236-53699258 AGGGACACAAACACTGAGGAAGG + Intronic
1138120775 16:54399407-54399429 AGGGGGAAAAAATTAGAGTAGGG + Intergenic
1138127617 16:54451958-54451980 AGTGACACAAAATTTGAGGAGGG + Intergenic
1138206295 16:55127627-55127649 AGTGAGAAAAAGAGTGCGGAGGG - Intergenic
1138912503 16:61418753-61418775 AGGAAGGAAAAAAGTAAGGAAGG - Intergenic
1138937607 16:61748711-61748733 TGGGAGAAGAAAATAGAGAAAGG - Intronic
1139052047 16:63136238-63136260 AATGAGAAAAAAAGTGAGCATGG + Intergenic
1139144777 16:64310087-64310109 GGGGTGAAGAAAAGTGAGGAGGG + Intergenic
1139197094 16:64932233-64932255 AGGGATGAATAAAGTGAGGAGGG - Intergenic
1139209983 16:65067861-65067883 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1139287311 16:65827141-65827163 AGGAAGATAAAAATTATGGATGG - Intergenic
1139439528 16:66958948-66958970 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1139913111 16:70410555-70410577 AGGGGGAAAAAAAGTGGTGAGGG - Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140418910 16:74800061-74800083 AGGGACACAAAAACTGCGGAAGG - Intergenic
1140684733 16:77422535-77422557 AGAGTGAAAAAAAAAGAGGAAGG + Intronic
1140740335 16:77936042-77936064 GGGGAGAAAAAAAAGGAGGTGGG + Intronic
1140994558 16:80244655-80244677 AGGGACACAAACACTGAGGAAGG + Intergenic
1141300690 16:82812834-82812856 AGGGAGGAAAGAAGGGAGGAAGG - Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1141671642 16:85495150-85495172 AGGGAGAGAAAAGCTCAGGATGG + Intergenic
1142251482 16:88993875-88993897 AAGGAGAAAAAAAGGGAGGGAGG - Intergenic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1203098141 16_KI270728v1_random:1280796-1280818 AGGAAGGAAAAAAATAAGGAAGG + Intergenic
1142738811 17:1918352-1918374 AGTGAGAAAAAAAAAGAGAAGGG - Intergenic
1142838622 17:2609165-2609187 GGGGAAAAAAAAATTCAAGAAGG - Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143041462 17:4040666-4040688 AAGGAGAAAATAACTTAGGAAGG + Intronic
1143125847 17:4640537-4640559 AGGGAGGAAAAAAGGGAGGAGGG + Intronic
1143195791 17:5075347-5075369 AGGGACACAAAAACTGCGGAAGG - Intergenic
1143276953 17:5718807-5718829 AGTGAGAAAGAGATTGAGGATGG + Intergenic
1143287828 17:5804098-5804120 GGGGAGAAGAGAATTGGGGAGGG - Intronic
1143373169 17:6453025-6453047 AGGGAGAAAGAAAGACAGGAAGG - Exonic
1143402631 17:6656285-6656307 AGGGAGGAAAAAAGGGAGGAGGG - Intergenic
1143591309 17:7887001-7887023 AGGGAGATAAAAATTGCCCAGGG - Intronic
1143703134 17:8676268-8676290 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1143737372 17:8922182-8922204 AGGGAGGAAGAAAAGGAGGAAGG + Intronic
1143794791 17:9327861-9327883 AGGAAGGAAAAAAGAGAGGAAGG - Intronic
1144157655 17:12522573-12522595 AGGGAAAAAAAAATTGCTCAGGG - Intergenic
1144241069 17:13312248-13312270 GGGGAGAAAAAAACTAAGAAGGG + Intergenic
1144512993 17:15893505-15893527 AGGGAGGAAGAAAGGGAGGAGGG - Intergenic
1144518522 17:15938175-15938197 AGAGAGAAAAAAAAGAAGGAAGG + Intergenic
1144745523 17:17611592-17611614 AGGGACACAAAAACTGCGGAAGG - Intergenic
1145107026 17:20126264-20126286 AGGGAGAGAAGAAGAGAGGAAGG - Intronic
1145295686 17:21591006-21591028 AGGGACACAAACACTGAGGAAGG + Intergenic
1145692395 17:26755988-26756010 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1145845282 17:28033161-28033183 AAAGAAAAAAAAAGTGAGGAAGG + Intergenic
1146093078 17:29901751-29901773 AGGGAGAAAGAAAGGGAGGAAGG - Intronic
1146119472 17:30178592-30178614 AGTGAGAAAAAAATTTGGGAGGG + Intronic
1146181448 17:30700709-30700731 AGGGACACAAAAACTGCGGAAGG - Intergenic
1146189236 17:30750234-30750256 AGGGTGAACAAAATGGATGAAGG + Intergenic
1146299336 17:31676140-31676162 AGGGAGAAAAAGAGAGAGGGAGG + Intergenic
1146334125 17:31954537-31954559 AGGGTGAACAAAATGGATGAAGG + Intronic
1146478794 17:33185602-33185624 ACAGAGTAAAAAATTCAGGAAGG + Intronic
1146623693 17:34419854-34419876 AGGGATGAAAAAATAGATGATGG - Intergenic
1146735020 17:35231561-35231583 AGTGAGAAAGAAAGTGAGAATGG - Intergenic
1146787976 17:35734861-35734883 ATGCAGGAAAAAATGGAGGAGGG + Intronic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147419485 17:40315058-40315080 GGGGAGGAAAGAGTTGAGGAGGG + Intronic
1147528231 17:41247651-41247673 AGGGAGGAAAAAAGGAAGGAAGG + Intronic
1148014215 17:44509681-44509703 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1148922434 17:51050931-51050953 AGAGAGAGAAAAAGAGAGGAAGG + Intronic
1148968275 17:51456311-51456333 AGGGAGAAAAGAGTTGATGGTGG + Intergenic
1149128303 17:53262878-53262900 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1149150136 17:53551956-53551978 AGGGAGATAAAATCTGAGTATGG + Intergenic
1149287341 17:55179312-55179334 ATGGAAAAAAAAATAAAGGAGGG + Intergenic
1149485883 17:57042459-57042481 AGGGAGAAAGAAAGGGAGGAAGG - Intergenic
1150056340 17:62020836-62020858 AGGGACACAAACACTGAGGAAGG - Intronic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1150465187 17:65386637-65386659 AGGGAGAGAGAAAAAGAGGAAGG - Intergenic
1150519165 17:65848468-65848490 AGGGAGGAAACAGTTGAAGAAGG - Intronic
1150839567 17:68595362-68595384 AGGGAGAAAAAACCTGATAATGG + Intronic
1150840940 17:68604660-68604682 AGGGACACAAAAACTGCGGAAGG - Intergenic
1150880587 17:69021692-69021714 AGGGAGAAAGAAAGAAAGGAAGG - Intronic
1150931949 17:69594610-69594632 AGGGAGAAAAAAGATAATGACGG - Intergenic
1151018191 17:70581496-70581518 AGGGAGGAAAAGATTTAGAAAGG - Intergenic
1151078494 17:71301515-71301537 AGGGAGAAAAGAAAGGGGGAAGG - Intergenic
1151118838 17:71769491-71769513 AGGACGAAAAAAACTGAGTAGGG + Intergenic
1151248479 17:72815000-72815022 AGGGGGTAAAAAACTAAGGAAGG + Intronic
1151300824 17:73224031-73224053 AGGGAGAAAGGAAGAGAGGAAGG + Intronic
1151635349 17:75343824-75343846 AGGGAGAAGAAAGGAGAGGAAGG + Intronic
1151859434 17:76748820-76748842 AGGGAGGAAAGAAGAGAGGAAGG - Intronic
1151938217 17:77276905-77276927 AGAGAGAAAAAAAGAAAGGAAGG - Intergenic
1152328732 17:79658248-79658270 AGGGAGGGAGAAATGGAGGAGGG - Intergenic
1152873805 17:82774198-82774220 AGGGACAAAAACACTGCGGAAGG - Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153143484 18:2001482-2001504 AGGGACACAAAAACTGCGGAAGG - Intergenic
1153351492 18:4085256-4085278 AGGCAGAAAAAAAATGTGGGTGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154063580 18:11085878-11085900 TGGGAGAAAAAAAGGGAGGTAGG + Intronic
1154510672 18:15098240-15098262 TGGGAGGAAAAAACAGAGGATGG - Intergenic
1154515866 18:15164755-15164777 AGAGAGAAAGAAAGTGAGAAAGG - Intergenic
1154531607 18:15351342-15351364 AGGAAGAAATAAATTAGGGATGG + Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1155096499 18:22560501-22560523 AGTGAGAATAAAATAGAGGCTGG + Intergenic
1155184180 18:23372904-23372926 AGGGAGAAAAAAAGAAAGAAAGG + Intronic
1155254401 18:23982171-23982193 AGGGAAAAAGAAAGGGAGGAAGG + Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155472141 18:26202502-26202524 AGGGACACAAAAACTGTGGAAGG - Intergenic
1155481409 18:26291996-26292018 AGGGAGATTTAAATTGAGTATGG + Intronic
1155646759 18:28087937-28087959 GGGGAGGAAAAAAATGAGGCGGG - Intronic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1155829249 18:30492246-30492268 AGGGAGGAAGAAAGGGAGGAAGG + Intergenic
1156150821 18:34240986-34241008 TGGGAGAAAATATTTGAGAAAGG - Intergenic
1156179257 18:34583828-34583850 AGGCTGCAAAAAGTTGAGGAGGG - Intronic
1156356100 18:36341582-36341604 GGGGAGAAAAAAATGGAGATGGG + Intronic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156504568 18:37581159-37581181 AGGGTGAGAAATATTGTGGATGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157049902 18:44151415-44151437 AAGGTGACAAAAATTGAAGATGG + Intergenic
1157150417 18:45211616-45211638 AAGGAGAAAAAAGCAGAGGAGGG - Intergenic
1157379426 18:47198594-47198616 AGAGAGAGAAAAACTGAAGAAGG + Intergenic
1157612737 18:48968509-48968531 AGGGAGGAAAAAAGGAAGGAAGG + Intergenic
1158273128 18:55738096-55738118 AGGGAGAAAATAAAGGAGAAAGG - Intergenic
1158314361 18:56194457-56194479 AGGGAGAAAGAAAGAAAGGAAGG - Intergenic
1158370635 18:56798952-56798974 AGGGAAAGAAAAAGGGAGGAAGG - Intronic
1158487357 18:57879409-57879431 TGTGAGAAAAAAATTAGGGACGG - Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158602891 18:58870281-58870303 AGGGAGAAAAATCTAGTGGAAGG + Intronic
1158719631 18:59913240-59913262 AGGTGGCAAAAAATAGAGGATGG - Intergenic
1158730202 18:60014269-60014291 ACAGAGAAAATAATTGAGAAGGG - Intergenic
1158885229 18:61820573-61820595 AGGAACAATAAAATTGAGGCAGG + Intronic
1159283935 18:66324729-66324751 AGTGAGAAATAAATTGAGACTGG + Intergenic
1159484949 18:69043520-69043542 AGGGACACAAACACTGAGGAAGG - Intronic
1159914403 18:74175827-74175849 TGGGAGAACTAAATGGAGGAGGG + Intergenic
1159949701 18:74473984-74474006 AGAGAGAAAAAAATTAAACAGGG - Intergenic
1159981264 18:74783637-74783659 AGGGAGATTAAAACTGAGGCAGG + Intronic
1160791864 19:926962-926984 AGTGAGAAAAAAACTCAAGAAGG - Intronic
1161758656 19:6153957-6153979 AGAGAGAAAAAAATTGAGGGTGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162220183 19:9169764-9169786 AGGAAGAGTAAAGTTGAGGAGGG + Intergenic
1162670519 19:12253672-12253694 AGGCAGAAAAAAAAACAGGAAGG + Intronic
1163146370 19:15381611-15381633 AGGAAAAAAAAAAATGAAGATGG - Intronic
1164049007 19:21568221-21568243 AGGGACACAAAAACTGCGGAAGG + Intergenic
1164207780 19:23072192-23072214 AGGAGGAAAAAAAGGGAGGAAGG + Intergenic
1164273271 19:23692966-23692988 AGGGACACAAAAACTGCGGAAGG + Intergenic
1164370376 19:27638258-27638280 AGGGACACAAAAACTGGGGAAGG - Intergenic
1164447250 19:28328484-28328506 AGGGAGAAAAACACAGAGTAAGG - Intergenic
1164706544 19:30324275-30324297 AAGGATAAAAAAATTGATGATGG - Intronic
1164731002 19:30504439-30504461 AGGGAGAAAGGAAGGGAGGAAGG - Intronic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1164882477 19:31745052-31745074 AGGAAGAAAAAAAGAAAGGAAGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165024281 19:32948388-32948410 AAGGAGCAAAAAAGTGAGAAAGG + Intronic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1165337028 19:35178110-35178132 AGGGGAAAAAAAAGTGAGAAAGG + Intergenic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165508106 19:36247633-36247655 AGGGACACAAAAACTGTGGAAGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165691386 19:37866454-37866476 AGGGACACAAAAACTGCGGAAGG + Intergenic
1165796631 19:38523662-38523684 AGGAAGAAAGAAATGGAAGAGGG - Intronic
1165824073 19:38695639-38695661 AGGGAGTAAAGAAGTGAGGCTGG - Intronic
1166038117 19:40184327-40184349 AAGGAGAAAAAAAGAGAGTATGG + Intergenic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166653624 19:44594373-44594395 AGGGACACAAAAACTGCGGAAGG + Intergenic
1167138770 19:47634722-47634744 AGAGAGAAGAGAGTTGAGGATGG - Intronic
1167195099 19:48023116-48023138 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1167319214 19:48785560-48785582 AGGGAGAAAGAGCTAGAGGAGGG + Intergenic
1167567566 19:50266572-50266594 AGGGAGGAAAAAAGGAAGGAAGG + Intronic
1167650573 19:50726397-50726419 AGGAAAAAAAAAGGTGAGGACGG - Intergenic
1167726378 19:51215868-51215890 AGGGAGGCAAAAGGTGAGGATGG - Intergenic
1167753833 19:51397927-51397949 AGTGAGAAAAAAGCTGAGGCAGG - Intergenic
1167913051 19:52719916-52719938 AGGGAGACAAACACTGCGGAAGG - Intronic
1168075522 19:53979048-53979070 AGGCAGAAAAAAAAAGAGGGGGG + Intronic
1168263030 19:55207520-55207542 AGGGAGAAAAAAACCAAGGTTGG + Intronic
1168366553 19:55793011-55793033 ATGGAAAAAAAAATAGAGGCTGG - Intronic
1168414663 19:56160522-56160544 AGGGAGAGAGGAATGGAGGAGGG - Exonic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
925059843 2:882435-882457 AGGGAAAAAAGAATGCAGGATGG + Intergenic
925281011 2:2684696-2684718 TGGGAGAAAAAACATGAGAATGG - Intergenic
925749481 2:7074766-7074788 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
926211078 2:10869838-10869860 AGGTAGAACAAAATTGAGATGGG + Intergenic
926332333 2:11835829-11835851 AGGGAGAAAGAAAGAAAGGAAGG - Intergenic
926520066 2:13898938-13898960 AGGAATAAAAAAATTAAAGAAGG - Intergenic
926853458 2:17226635-17226657 AGGAAGAAAGAAAAAGAGGAGGG + Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926941186 2:18138664-18138686 AGGGAGGAAGAAATTGAGGATGG - Intronic
927000084 2:18785867-18785889 AGGAAGAAAAAAAGTGTGTAGGG - Intergenic
927329990 2:21851372-21851394 AGAGAGTGGAAAATTGAGGAAGG + Intergenic
927359905 2:22221075-22221097 AGGAAGAGATAAATTGAGGAAGG + Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927492538 2:23530087-23530109 AGGGATAAATAAATTGAGGCTGG + Intronic
927529376 2:23780403-23780425 AGGCAGAATAAAATTTTGGATGG - Intronic
927530389 2:23792664-23792686 AGGGAAAAAAAACTTGTGGCCGG + Intronic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927920619 2:26969821-26969843 AGGTAGAAAAAAATTGGGCCGGG + Intergenic
927932572 2:27054603-27054625 AGGGAAAAAAAAATTAAGCCAGG - Intronic
927992818 2:27460256-27460278 AGGGACACAAAAACTGCGGAAGG + Intronic
928139414 2:28715497-28715519 GAGGATAAAAAAACTGAGGAAGG + Intergenic
928275320 2:29895440-29895462 AGAGAGACAAGAATTGAGGCTGG + Intronic
928292429 2:30051184-30051206 AGAAAGAAAAAAACTGAGGGGGG + Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
928355888 2:30614140-30614162 AGGGACACAAAAACTGCGGAAGG - Intronic
928541227 2:32285425-32285447 AGGGATAAAAAGACTGAAGAAGG - Intronic
928786685 2:34895566-34895588 AGGGAGAAAAGAAAGGAGGGAGG - Intergenic
928990217 2:37225595-37225617 AGGGACACAAAAACTGCGGAAGG + Intronic
928993750 2:37264105-37264127 AGCAGGAAAAAAATTGGGGAGGG - Intronic
929089009 2:38196396-38196418 AGGGAAAAAAAAAGCGAGGATGG - Intergenic
929319897 2:40530221-40530243 AGGAAGTAAAAAATGAAGGAAGG + Intronic
929401868 2:41592216-41592238 AGGGAGGAAAAAAGAGAGGGAGG + Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929594725 2:43168983-43169005 AGAGAAAAAAAAAATGAGCAGGG - Intergenic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930021702 2:47005582-47005604 AGAGAGAGGAACATTGAGGAAGG + Intronic
930378908 2:50602594-50602616 AGGGAGAGAAAAAGGAAGGAAGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930833470 2:55770259-55770281 AGAGAGAAAAAAAGGAAGGAAGG - Intergenic
931002272 2:57799696-57799718 AGGCAGAAAAAAATAGATGGAGG + Intergenic
931020496 2:58039473-58039495 AGGGAGAAAAATAATTAAGAAGG - Intronic
931105667 2:59052555-59052577 AGACAGAAATAAATTGAAGAAGG - Intergenic
931150784 2:59570927-59570949 AGGAAGAAATGAATGGAGGAAGG + Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931670501 2:64643013-64643035 AGAGAGGAAATAATTGGGGAAGG + Intronic
931730327 2:65147501-65147523 AGGGAGGAAAAAAATAAGGAAGG + Intergenic
931816725 2:65910919-65910941 AGGGAAAAAGAAATTAAGCAGGG - Intergenic
931920031 2:67005339-67005361 AAAGAGAAAGAAATTAAGGAAGG + Intergenic
933031679 2:77336154-77336176 AGGGAGAAAGAAAGGAAGGAAGG + Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933234542 2:79850374-79850396 AGGGAGAAACAAACAGAGGGAGG - Intronic
933234561 2:79850438-79850460 AGGGAGAAAGAAAGGAAGGAAGG - Intronic
933242655 2:79940475-79940497 AGGGATAGAAGAAGTGAGGATGG - Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933472563 2:82744727-82744749 AGGGAGAGAGAAAGGGAGGAAGG - Intergenic
933743909 2:85556269-85556291 AGGGAGGTAAACATTGAGGGGGG + Intronic
933881402 2:86673585-86673607 ATGATTAAAAAAATTGAGGAGGG - Intronic
934249397 2:90336257-90336279 AGGGAGAAAGGAAGTGAGGGAGG - Intergenic
934725148 2:96611984-96612006 GGGGAGAAAGAAAATGAGCAGGG + Intronic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935098924 2:99973680-99973702 AAGGAAAAAAAAACTGAAGATGG - Intronic
935195509 2:100812638-100812660 ACGGGGAGAAGAATTGAGGAAGG + Intergenic
935258202 2:101331223-101331245 AGAAAGAGAAAATTTGAGGAGGG - Intergenic
935438955 2:103069215-103069237 AGGAAGGAAAAAAGAGAGGAAGG - Intergenic
936179175 2:110250286-110250308 AGGGTGAAAAGAATGCAGGAAGG - Intergenic
936679770 2:114757053-114757075 AGGGAGAAAGAAATGAAGAAAGG + Intronic
936884996 2:117299794-117299816 GGAGACAAAAAAAGTGAGGAGGG + Intergenic
936909737 2:117577767-117577789 AGGGAGAAACAAATGAAGCAGGG + Intergenic
936997742 2:118433107-118433129 TGGGAGGAAAAAATAAAGGAAGG + Intergenic
937089322 2:119195520-119195542 AGAGAGAAAGAAATAGAGGGGGG + Intergenic
937570897 2:123359823-123359845 AGAGGTCAAAAAATTGAGGAGGG - Intergenic
937643938 2:124244624-124244646 AGGGAGAAGTGATTTGAGGAGGG + Intronic
938225475 2:129612241-129612263 AGAGAGAGAGAAATTGGGGATGG + Intergenic
938249737 2:129805371-129805393 AGGCAGAAATAAATTCATGAAGG + Intergenic
938505892 2:131882700-131882722 TGGGAGGAAAAAACAGAGGATGG - Intergenic
938516117 2:132009442-132009464 AGAAAGAGAAAAAGTGAGGAAGG - Intergenic
938519123 2:132048670-132048692 AGGGAGAAAGGAAGGGAGGATGG - Intergenic
938534355 2:132222682-132222704 AGGGACACAAACATTGCGGAAGG + Intronic
938649847 2:133371743-133371765 GGAAGGAAAAAAATTGAGGAGGG - Intronic
938732765 2:134159296-134159318 GGGAAGAAAAAAAAAGAGGAAGG - Intronic
938971255 2:136435029-136435051 AAGGAGAGACAAATTAAGGATGG - Intergenic
939031563 2:137081949-137081971 AGGGAGAAGAAATTAGAGGAGGG - Intronic
939411627 2:141834088-141834110 AGGGAGTTCAAAACTGAGGATGG + Intronic
939491447 2:142882073-142882095 GGGAAGAAAAATTTTGAGGAGGG - Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
939733829 2:145819236-145819258 AGGGAGAAAAGAAGGAAGGAAGG - Intergenic
939833593 2:147101626-147101648 AGGGAGTAAGAAAGAGAGGAAGG + Intergenic
939988848 2:148858692-148858714 AGGGAGCAAAAAAGGAAGGAAGG - Intergenic
939998549 2:148943490-148943512 AGGGAAAAAAATCTGGAGGAGGG + Intronic
940373030 2:152923223-152923245 AGGGAGAGAGAAAGTGAGGCAGG - Intergenic
940492401 2:154380529-154380551 ATGAAGAAAAAAATTCTGGAAGG - Intronic
941017509 2:160373910-160373932 GGGGACAAAAAGGTTGAGGAAGG + Intronic
941268881 2:163400376-163400398 AGGAAGAAAAACACTGAGGGTGG + Intergenic
941680224 2:168390161-168390183 AGGGTTAAAAAAATGGAAGAGGG + Intergenic
941891094 2:170582635-170582657 AGGAAGAAAGAAGTAGAGGAAGG - Intronic
941891384 2:170585507-170585529 AAGGTGTAAAAAATTGAGGATGG - Intronic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942223269 2:173791845-173791867 AGAGAGAAAGAAACAGAGGAAGG - Intergenic
942475646 2:176317218-176317240 AGGGAGAGAAAAAGAAAGGAGGG - Intronic
942832304 2:180251456-180251478 AAGAAAAAAAAAATTGAAGAAGG + Intergenic
943334728 2:186599968-186599990 AGGGAGAAAAAAATGGAACAAGG - Intronic
943378875 2:187118201-187118223 AGGGAAGAAAAAATTGAAAAAGG - Intergenic
943510519 2:188820557-188820579 AGGGGGGAAAAAACTCAGGAAGG + Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
943892197 2:193302985-193303007 AGGGAGGAAGAAAAGGAGGAAGG - Intergenic
944013749 2:195006558-195006580 GTTGAGAAAAAAATTGAGTAGGG - Intergenic
944128959 2:196325200-196325222 AGGGAGGAAAGAAAGGAGGAAGG + Intronic
944153354 2:196585700-196585722 AGAGAGGAAAAAATGGAGGGAGG + Intronic
944209953 2:197196955-197196977 AGGAAAAAAAAAATTGACAATGG - Intronic
944636903 2:201683446-201683468 AGTGAAAATAAAACTGAGGAGGG + Intronic
945175191 2:207037102-207037124 AGGGACACAAAAACTGCGGAAGG + Intergenic
945274970 2:207979096-207979118 AGGGAGAAAAGAAGATAGGAGGG - Intronic
945322783 2:208444996-208445018 AGGGAGATAAAAAATAAGAATGG - Intronic
945458735 2:210079905-210079927 AGGAATTAAATAATTGAGGATGG + Intronic
945479323 2:210325826-210325848 AGGGAGAAACAACTTGTGGTTGG + Intergenic
945649314 2:212538840-212538862 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
945676984 2:212867103-212867125 AGTGAAAATAAAATTGAGAAAGG - Intergenic
945962729 2:216152448-216152470 AGAGAGAAAAAAATTTGGGTGGG + Intronic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946497749 2:220213046-220213068 AGGGAGAGAGGCATTGAGGAAGG + Intergenic
946625629 2:221609707-221609729 AGGGAAGAAAAAATTGCCGATGG + Intergenic
946980727 2:225212532-225212554 AGGGAGAAAGAGATGGAGGTGGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947030094 2:225783152-225783174 AGGAAGTAAGAAATGGAGGAAGG - Intergenic
947037755 2:225878844-225878866 AGGAAGAAAGGAAGTGAGGAAGG - Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947273433 2:228364310-228364332 AGGGACACAAAAACTGCGGAAGG - Intergenic
947520766 2:230844305-230844327 AGGGACACAAAAACTGCGGAAGG - Intergenic
947619063 2:231577053-231577075 AGGGACACAAAAACTGCGGAAGG + Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948731166 2:239964571-239964593 AGGAAGAAAAAAACTGTGCAGGG + Intronic
1168840453 20:906775-906797 AGAGAGGAAAACAATGAGGAAGG - Intronic
1168918799 20:1513862-1513884 AGGAAGCAATAGATTGAGGATGG + Intergenic
1168974211 20:1952084-1952106 AGAGAGAAAGAAATTAAGTAAGG + Intergenic
1169566943 20:6865032-6865054 ATGGAGAAAATCATAGAGGACGG + Intergenic
1169709728 20:8548081-8548103 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1169780815 20:9307742-9307764 AATGAAAAAACAATTGAGGATGG - Intronic
1169902201 20:10565034-10565056 AAGGAAAAAAAAAATTAGGAGGG - Intronic
1169990549 20:11498291-11498313 AGGGAGGAAAAGAGAGAGGAAGG + Intergenic
1170663775 20:18367251-18367273 AGGGAAAGAACATTTGAGGATGG + Intergenic
1171087636 20:22252619-22252641 AGGGAGAAAAGAAGTGAGATAGG + Intergenic
1171096385 20:22336151-22336173 AGGAAGAAAAAAATACAGGGAGG - Intergenic
1171263876 20:23754758-23754780 AGGGAGAAAAGAAGGAAGGATGG - Intergenic
1171276603 20:23861266-23861288 AGGGACACAAAAACTGCGGAAGG - Intergenic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1171370939 20:24661546-24661568 AGGGAGGAAAAAAGAGAGGAAGG + Intronic
1171771436 20:29325702-29325724 AGGGAAAGAAAAAGAGAGGAAGG + Intergenic
1171774567 20:29353189-29353211 AGGGAGGAAGAAAGTAAGGAAGG - Intergenic
1171823930 20:29877958-29877980 AGGGAGAAAAAAACCGGGGGAGG - Intergenic
1172479524 20:35262792-35262814 AGGGACACAAAAACTGCGGAAGG - Intronic
1172486438 20:35300748-35300770 AGGGATAATAAAAATGATGAGGG + Intergenic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172687759 20:36769957-36769979 AGAGAGAAAGAAAGTGAGGCGGG + Intronic
1173026549 20:39312663-39312685 AGGGTGTAACAAAGTGAGGAAGG - Intergenic
1173058443 20:39638649-39638671 AGTAAGAAAAAAATACAGGAAGG + Intergenic
1173158566 20:40635672-40635694 AGGGAATGAAAAAATGAGGAAGG + Intergenic
1173319045 20:41971173-41971195 AGGGACACAAAAACTGCGGAAGG + Intergenic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1173881629 20:46417728-46417750 GGAGAGAAGAAAATTAAGGAAGG + Intronic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1173982422 20:47235006-47235028 TGGATGAAAATAATTGAGGATGG - Intronic
1174062768 20:47844150-47844172 AGGGAGAAAGGAAGGGAGGAAGG + Intergenic
1174301341 20:49584775-49584797 GGGGAGAAAGCAATGGAGGAGGG + Intergenic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175297029 20:57915496-57915518 AGGGTTAAATAAATTGAGGCTGG + Intergenic
1175323822 20:58108809-58108831 AGGAAGAAATAATTTGAAGATGG + Intergenic
1175392487 20:58636035-58636057 AGGGAAAAAGAAATGAAGGAAGG + Intergenic
1175695162 20:61097753-61097775 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1176424457 21:6539483-6539505 AGGGACACAAAAACTGCGGAAGG - Intergenic
1176664494 21:9672501-9672523 AGGGAGGCAAAAAAAGAGGAAGG - Intergenic
1176765753 21:13016826-13016848 AGGAAGAAATAAATTAGGGATGG - Intergenic
1176782283 21:13211228-13211250 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1176787179 21:13271037-13271059 TGGGAGAAAAAAACAGAGGATGG + Intergenic
1177235862 21:18389244-18389266 AGGAAGAAGTAAATTAAGGAAGG + Intronic
1177537860 21:22451843-22451865 AGGGAGGAAAAAAAGAAGGAAGG - Intergenic
1178164759 21:29961243-29961265 AGGGAGAAAAGTATAGAGAAAGG + Intergenic
1178296922 21:31417925-31417947 AGAGAGAGAGAAATTGAAGATGG + Intronic
1178735607 21:35147199-35147221 AGGGAGAAAGATATTAAGGATGG - Intronic
1179069227 21:38056015-38056037 ACAGAGAAAGAAATGGAGGAAGG - Intronic
1179373115 21:40825305-40825327 AGGAAGAAAAAAAGGAAGGAAGG - Intronic
1179406833 21:41133066-41133088 AGGGAACAAACACTTGAGGAAGG - Intergenic
1179699950 21:43147798-43147820 AGGGACACAAAAACTGCGGAAGG - Intergenic
1180332997 22:11549941-11549963 AGGGACACAAAAACTGTGGAAGG + Intergenic
1180338501 22:11599957-11599979 AGGGAAAGAAAAAGAGAGGAAGG - Intergenic
1180607153 22:17067352-17067374 AGGGAAAAAAAAAAAAAGGAAGG + Intergenic
1180837712 22:18938951-18938973 AGGGACACAAAAACTGCGGAAGG + Intergenic
1180838621 22:18947162-18947184 AGGGACACAAAAACTGCGGAAGG + Intergenic
1181051579 22:20240584-20240606 AGGGAGAAAAACAGTGACGTGGG - Intergenic
1181389811 22:22572023-22572045 AGGGAGAAAGAAAGGAAGGAAGG + Intergenic
1181436847 22:22916108-22916130 GGAGATAAAAAAATTTAGGATGG - Intergenic
1181642632 22:24211557-24211579 AGGGACACAAAAACTGCGGAAGG - Intergenic
1181664631 22:24384383-24384405 AGGGAAACAAAATTTCAGGAAGG + Intronic
1181925985 22:26359032-26359054 GGGCAGAAAAAAATGGAGTATGG + Intronic
1181963272 22:26638362-26638384 AGGGAGGGAAAAAGGGAGGAAGG + Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182399052 22:30060299-30060321 AGGGACACAAACACTGAGGAAGG + Intergenic
1182399935 22:30067355-30067377 AGGGACACAAACACTGAGGAAGG + Intergenic
1182860671 22:33556625-33556647 AGGGAGAAAGGAACTCAGGAAGG + Intronic
1182927520 22:34139538-34139560 AGGGAGAAAACTATTCAGGGAGG - Intergenic
1182980215 22:34662799-34662821 AGGCTGAGAAAAATTCAGGAGGG - Intergenic
1183000007 22:34849005-34849027 AGAAAGAAAAAAAAAGAGGAAGG + Intergenic
1183090068 22:35516123-35516145 AGGGAGAAAGAAAGAGAAGAAGG - Intergenic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1183979242 22:41530096-41530118 AGGGAGAAAGAAATCAAGGAAGG - Intronic
1184201502 22:42972352-42972374 AGGGACATAAACATTGCGGAAGG + Intronic
1184318619 22:43720634-43720656 AGGGAGGAAAAGAGAGAGGAAGG + Intronic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1184781703 22:46652839-46652861 AGAGAAAGAAAAATTGATGATGG + Intronic
1185007251 22:48288200-48288222 AGGGAGAGAAAGGTGGAGGACGG + Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1185152616 22:49173519-49173541 AGGAAGCACAAAGTTGAGGATGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949168432 3:968924-968946 AGGGATAAAAGAAGAGAGGATGG - Intergenic
949192519 3:1267230-1267252 AGAGGGAAAAAAAGTGAGGAAGG - Intronic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949275467 3:2274695-2274717 AGGGAAGAGAAATTTGAGGAGGG + Intronic
949331947 3:2932750-2932772 AGAGAGAAAAAAAAGGAGGGAGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949540831 3:5030965-5030987 AGGGAGGAAAGAAGGGAGGAAGG + Intergenic
949625977 3:5867163-5867185 GGGGAGCAGAAAGTTGAGGATGG + Intergenic
949646814 3:6105310-6105332 AGGGAGAAAAGAAGAAAGGAAGG - Intergenic
949677023 3:6467284-6467306 AGGGAGAAAAAATTTAGGAAAGG + Intergenic
949710246 3:6862885-6862907 ACGGAGAAAAAATGGGAGGAAGG + Intronic
949723394 3:7016432-7016454 GGGGAAACAGAAATTGAGGAGGG + Intronic
949733397 3:7142173-7142195 AGAGAGAAAAGAAGGGAGGATGG + Intronic
949862380 3:8517897-8517919 ATGGAGAACAAAATTCATGAAGG + Intronic
949916108 3:8965850-8965872 AGGAAGAAAAAAAATAAGGAAGG - Intergenic
949989977 3:9570581-9570603 AGGGACACAAACACTGAGGAAGG + Intergenic
950063279 3:10090341-10090363 ACGGTGAAAAAAATTGAGCCTGG + Exonic
950189836 3:10969017-10969039 AGGGAGAGAAAAATGAAGGAAGG + Intergenic
950635543 3:14311770-14311792 AGGGAGGAAAGAATGAAGGAAGG - Intergenic
950733651 3:14986477-14986499 AAGAAGGAGAAAATTGAGGAAGG + Intronic
951696889 3:25454311-25454333 AGGGAGAAAAAAATCCAGATAGG + Intronic
952022978 3:29045045-29045067 AGGGAGGAAAAAGTGGAGGGAGG + Intergenic
952499230 3:33944288-33944310 AGTAAGAAACTAATTGAGGAGGG - Intergenic
952614155 3:35249298-35249320 AGGAAGAAAAACATAGAAGAAGG + Intergenic
952771098 3:37001458-37001480 AGGGAAAAAAGAATAGAGAAAGG + Intronic
953496825 3:43394472-43394494 AGGATGGAAAAAATTCAGGAAGG - Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
953793187 3:45964103-45964125 AGAGAGAAGAAAATTGAGTTAGG + Intronic
953903678 3:46857625-46857647 AGGGAGAAAAGGAGGGAGGAAGG + Intergenic
953960065 3:47259811-47259833 AGGGACACAAAAACTGCGGAAGG + Intronic
954440648 3:50520159-50520181 AGGGACACAAAAACTGCGGAAGG + Intergenic
954585158 3:51728267-51728289 AGGGAGCAGAAAAGAGAGGAGGG + Intergenic
954896316 3:53978182-53978204 AGGGACACAAAAACTGCGGAAGG - Intergenic
955005374 3:54963833-54963855 TGGGAGAAAGGAATGGAGGAAGG + Intronic
955014591 3:55057752-55057774 GGGAAGAAAAAAATGGAGGTGGG - Intronic
955058122 3:55474116-55474138 AGGGAGAAAGAAAGTGAGACGGG + Intronic
955353357 3:58210128-58210150 AGGAAGGAAAAAAGTAAGGAAGG + Intronic
955365138 3:58304392-58304414 TTTGAGAAAATAATTGAGGAAGG + Intergenic
955449816 3:59053582-59053604 AGGAAGAAAAAAATAAAGTAGGG - Intergenic
955595682 3:60587949-60587971 AGGGAAAAAAAAAAGGAGAAGGG - Intronic
955774909 3:62422522-62422544 AAAGAGAAAAAAAGTAAGGAAGG - Intronic
956016083 3:64884497-64884519 TGGGAGAAAGACCTTGAGGAGGG - Intergenic
956265614 3:67393015-67393037 AAGAAAAAAAAAATTGGGGAAGG + Intronic
956295711 3:67711365-67711387 AGGGAGAAATTATTTTAGGAAGG + Intergenic
956459705 3:69459354-69459376 AGAAAGGAAAAAAATGAGGATGG + Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956732053 3:72205236-72205258 AGGGAGGAAAAAGGGGAGGAAGG + Intergenic
956903412 3:73740815-73740837 TGGGAGAAAGAAAGGGAGGAGGG - Intergenic
956948951 3:74257842-74257864 AGGGAGAAAACAATGGATGTGGG - Intergenic
957133823 3:76258810-76258832 AGGGAGAAATAAATTAAAGCAGG - Intronic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
957628675 3:82689011-82689033 AGTGAAAAAAAAATTGGGAAAGG + Intergenic
957649744 3:82984345-82984367 AAGTAAAAAAAAATTGAGGAAGG - Intergenic
957738975 3:84238107-84238129 AGGAAGGAAAAAATTTAGCAAGG + Intergenic
957824142 3:85418966-85418988 AGGGGAAAAAAAAATGAGAAGGG + Intronic
957887563 3:86308221-86308243 AAGTAAAAAAAAATTCAGGATGG - Intergenic
958122047 3:89303462-89303484 AGGAAGAAAATAAAGGAGGAAGG + Intronic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958144990 3:89612538-89612560 AAGGAGAAAAAAAGGAAGGAAGG - Intergenic
958194403 3:90224367-90224389 TGGGAGAAATAAAGTGTGGAAGG + Intergenic
958470841 3:94516809-94516831 AAGGAGAAAAAATTTTGGGAAGG + Intergenic
958726662 3:97913931-97913953 AGGTGGAAAAAAATTGGGAATGG - Intronic
958906606 3:99948640-99948662 AGGGAGAAAGAAAGAGGGGAAGG + Intronic
959070758 3:101700325-101700347 AGGGACACAAAAACTGCGGAAGG + Intergenic
959071322 3:101704501-101704523 AGGGACACAAAAACTGCGGAAGG - Intergenic
959221825 3:103531059-103531081 AGGGACACAAAAACTGCGGAAGG - Intergenic
959329520 3:104985599-104985621 AGGGAAAAGAAAATTCTGGAGGG - Intergenic
959344803 3:105180202-105180224 AGGGAGCAAATAAGTAAGGAAGG + Intergenic
959418858 3:106109672-106109694 AGAGAGAAAGAAAAAGAGGAAGG - Intergenic
959484756 3:106913822-106913844 AGAGAGAAATAAATTAAAGATGG - Intergenic
960027454 3:113024945-113024967 AGGGACACAAAAACTGCGGAAGG - Intergenic
960028367 3:113033144-113033166 AGGGACACAAAAACTGCGGAAGG - Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
960430551 3:117563395-117563417 AAGGACAAAAATATTGATGATGG - Intergenic
960767502 3:121151709-121151731 AGGGAAAAAAAATAAGAGGAAGG - Intronic
961122954 3:124389146-124389168 AGGAAGGAAGAAATGGAGGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961862369 3:129927092-129927114 AGGGAGAACAGAAGTAAGGAGGG + Intergenic
961925196 3:130472072-130472094 AGGGAGATAAAACTTCAGAAAGG + Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962572478 3:136724450-136724472 AGGGACACAAACACTGAGGAAGG + Intronic
963389224 3:144636389-144636411 AGGGAGAAGAAAATGTAGAATGG + Intergenic
963473698 3:145776564-145776586 AGGGAGAGAAACAGGGAGGAAGG - Intergenic
964040191 3:152252219-152252241 AGGGAGAAAAGAAGGAAGGAAGG - Intronic
964246864 3:154663849-154663871 AGAGAGAAAAAAAGAAAGGAAGG - Intergenic
964556623 3:157946439-157946461 AGGGACAGAAATCTTGAGGAAGG - Intergenic
964576325 3:158173473-158173495 AGAAAGCAAAAAATTGGGGAAGG - Intronic
964580760 3:158234665-158234687 AGGGAGAAGAGGATTGGGGAGGG - Intronic
964681552 3:159345682-159345704 AGGGAGAATAAAATAGGTGAGGG - Intronic
964880143 3:161414173-161414195 AGAGAGAAAAAAAGAAAGGAAGG - Intergenic
965046773 3:163588217-163588239 AGGGTGAAAGAAAATGAAGATGG - Intergenic
965407775 3:168292066-168292088 AGGAAGGAAAAAAGAGAGGAAGG - Intergenic
965491997 3:169349083-169349105 AGGGAGAAAAACACTGGGGGAGG - Intronic
965910079 3:173763728-173763750 AGGAAGAAAAATATTGAAAAGGG + Intronic
966257639 3:177935589-177935611 AGGGAAAAAAGAATAGACGAAGG - Intergenic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966632793 3:182096994-182097016 AGGGAGAAAAAAAGTAAGCATGG - Intergenic
966763803 3:183440754-183440776 AGGGAGCAAGAAAAAGAGGAAGG + Intergenic
967025886 3:185563216-185563238 AGGGACACAAAAACTGCGGAAGG - Intergenic
967026795 3:185571428-185571450 AGGGACACAAAAACTGCGGAAGG - Intergenic
967086038 3:186096157-186096179 GGGAAGAAAAAAAATGAAGAGGG + Intronic
967117836 3:186357693-186357715 AGGGAGAGAAAGATAAAGGAGGG - Intronic
967147036 3:186615138-186615160 AGGGAAAAGAAAACGGAGGAAGG + Intronic
967175344 3:186857957-186857979 AGAGAGAAAGAAAAGGAGGAAGG - Exonic
967179123 3:186887542-186887564 AGGGACACAAAAACTGCGGAAGG - Intergenic
967257762 3:187610712-187610734 AGGGAGAAAAATGGTGAAGATGG - Intergenic
967299509 3:187998856-187998878 AGGAAGAAAAAAATTTACAATGG + Intergenic
967447779 3:189586774-189586796 AGGGGGAGAAAATTTCAGGAAGG - Intergenic
967653285 3:192013353-192013375 AGGGAGAAAGAAAGGGAGAAAGG - Intergenic
967741979 3:193013738-193013760 AGGCAGGAAAAAAATGGGGATGG - Intergenic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
968042296 3:195598880-195598902 TGGGTGAAAATAATGGAGGAGGG + Intergenic
968066019 3:195760202-195760224 AAGGAGAAAAAAATAAAGCAGGG + Intronic
968095633 3:195928193-195928215 AGGGACACAAAAACTGCGGAAGG - Intergenic
968387263 4:152410-152432 AGGGACACAAAAACTGCGGAAGG - Intronic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
968717890 4:2175358-2175380 AGAGTGAAGAAAATTGAGGATGG - Intronic
968914501 4:3491453-3491475 AGTGAGAGAGAAATTGAGTAGGG - Intronic
969436108 4:7190535-7190557 AGGGAGAAAGAAAGGAAGGAAGG - Intergenic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970363624 4:15336115-15336137 AGGGAGAAAAAAATTTTGGGGGG + Intergenic
970377360 4:15472794-15472816 AGGGTACAAAAAATAGAGGAAGG - Intronic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
970440417 4:16076934-16076956 AGGGACACAAACATTGCGGAAGG + Intronic
970689942 4:18611506-18611528 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
971060379 4:22962008-22962030 AGGAAGAAAAATACTTAGGAAGG + Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971537477 4:27771780-27771802 AGGAAAAAAAAAAGTGATGATGG - Intergenic
971561279 4:28082460-28082482 TGGGATAAATAAGTTGAGGATGG - Intergenic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
971689698 4:29816926-29816948 AGGAAGAACAAAATTCAGAAAGG + Intergenic
971854362 4:32024735-32024757 AGGGAGAATAAATGTGAGGTAGG - Intergenic
972037227 4:34540761-34540783 ACAGAGAAAAAATTTCAGGAGGG + Intergenic
972397128 4:38666970-38666992 AGGGACAAAAGAAATCAGGAGGG + Intronic
972466838 4:39365948-39365970 AGGGAGAAAGGAAGAGAGGAAGG - Intronic
972541238 4:40041295-40041317 CAGAAGAAAAAAATTGAGGCTGG + Intergenic
972635573 4:40881242-40881264 AGGGAGAAAAGTCTTCAGGAAGG - Intronic
973263534 4:48187277-48187299 AGGGACACAAACATTGCGGAAGG + Intronic
973645640 4:52948859-52948881 AGGGAGAAGAAAATAGAAGGCGG - Intronic
973757155 4:54086599-54086621 TGGGAGAAAAAAATAGAGCATGG + Intronic
974225409 4:59036606-59036628 AGGGATATAAAAATTAAAGATGG - Intergenic
974291364 4:59935729-59935751 AGAGAGAGTAAAAATGAGGATGG + Intergenic
974501138 4:62704299-62704321 TGGGAGAAGAAACTTGAGGTTGG + Intergenic
974517938 4:62941155-62941177 AGGGACACAAAAACTGCGGAAGG + Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
974669392 4:65009373-65009395 AAGGAGAGAAAAATTGACGAGGG + Intergenic
974925792 4:68296227-68296249 AGGGAGAAAAACATTGGCTATGG + Intergenic
975246857 4:72129892-72129914 AGGGACACAAAAACTGCGGAAGG - Intronic
975495405 4:75030852-75030874 AGGGACAGAAAAAATGAGGAAGG - Intronic
975951933 4:79784280-79784302 AGGGAGGCAAAAAAGGAGGAAGG - Intergenic
975983976 4:80186379-80186401 AGGGAGGAAATAAGGGAGGAAGG + Intronic
976066865 4:81197775-81197797 AGTGAAAAAAAAATGAAGGAGGG + Intronic
976307841 4:83579118-83579140 AGGGAGAAAGAAAGGAAGGAAGG - Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976397002 4:84566759-84566781 AGAGAGAAAAGAAATGAGAAAGG + Intergenic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
976459455 4:85292149-85292171 AAAGAGAAAAAAATTAAAGAGGG + Intergenic
976626119 4:87184609-87184631 AGAAAGGAAAAAATGGAGGAAGG + Intronic
976662249 4:87551768-87551790 AAGGAGAAAAAATTTGGGCAGGG - Intergenic
976748784 4:88432840-88432862 AGTAACAAAAAAATTGAGGCAGG + Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
977136530 4:93311525-93311547 AGCAAGAAAAAAAATGAGGCAGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977441268 4:97070742-97070764 AGAGAGAAAGAAATTGAGAGAGG - Intergenic
977687566 4:99865851-99865873 AGGGAAAAAAGAATTGATAAAGG - Intronic
977794236 4:101143282-101143304 AGGGAGTAAATAATTGATGATGG - Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
977902634 4:102439610-102439632 AGGAAGAAAACAAATAAGGAAGG + Intergenic
978029615 4:103924299-103924321 AGAGAAAAAAAAATGTAGGAAGG - Intergenic
978255424 4:106686687-106686709 AGAAAGAAAAGAATTAAGGATGG - Intergenic
978286710 4:107086402-107086424 AGGAAGAAAAGAATGGAGGGAGG + Intronic
978511511 4:109524394-109524416 AGAGAGTAAAAGATTAAGGAAGG - Intronic
978558445 4:110006042-110006064 TGGGGGAAAAAAATAGAGGCTGG + Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
979192155 4:117875006-117875028 AGAGAGAAAAGAATTCAAGAAGG + Intergenic
979322753 4:119343200-119343222 AGGGACACAAAAACTGCGGAAGG - Intergenic
979365497 4:119817684-119817706 AGAAAGAAAAAAATTGAGCCTGG - Intergenic
979691990 4:123569243-123569265 AGTGAGAAAAGAATGGAGGCAGG - Intergenic
979955769 4:126952097-126952119 AGGAAGGAAAAAAGTAAGGAAGG + Intergenic
980013028 4:127617605-127617627 AGGGAGGGAAGAATAGAGGAAGG + Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980299910 4:130976062-130976084 AAGGAGGAAAAAATGGAGGGAGG - Intergenic
980344618 4:131596529-131596551 AGGAAGAAAGAAAGGGAGGAAGG - Intergenic
980394094 4:132186162-132186184 AGGGAAAAAAAGAGGGAGGAAGG + Intergenic
980402241 4:132306299-132306321 AGGGAGAGAAAGAGTGAGAAAGG + Intergenic
980476893 4:133329692-133329714 AGGGTGAAAAAAATTAACCATGG + Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
980520444 4:133925984-133926006 AGTGAGAAATAAATTGGGGCTGG + Intergenic
980632727 4:135457009-135457031 AGGGAGAAGAAAATTCAGTTGGG - Intergenic
980670933 4:136006443-136006465 ACAGAGAAAAAATTTGAGTAGGG + Intergenic
980803411 4:137782500-137782522 AGAGAGAAAGAAATTGTGCAAGG - Intergenic
980870561 4:138606914-138606936 AGGGAATAAAGAATTGAGGTTGG - Intergenic
980883784 4:138739977-138739999 AGGGACACAAACACTGAGGAAGG + Intergenic
980968738 4:139549523-139549545 AGGGAGGCAAAAAGGGAGGAAGG - Intronic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
981360782 4:143843336-143843358 AGGGAGGAAAAGGTAGAGGAAGG + Intergenic
981360790 4:143843368-143843390 AGGGAGGAAAAGGTAGAGGAAGG + Intergenic
981360798 4:143843400-143843422 AGGGAGGAAAAGGTAGAGGAAGG + Intergenic
981380623 4:144067600-144067622 AGGGAGGAAAAGGTAGAGGAAGG + Intergenic
981533059 4:145771601-145771623 TGGGAGAAAGAAGGTGAGGAGGG + Intronic
981681039 4:147398315-147398337 AGGGAGGAAAGAAGGGAGGAAGG + Intergenic
981701259 4:147609627-147609649 AGGGAGAGAAATAGTGAGGGGGG - Intergenic
981756508 4:148145979-148146001 AGTGAGAAGAAAAGGGAGGAGGG + Intronic
982183916 4:152777539-152777561 AGGAAGAAAAAAAGGAAGGAAGG + Intronic
982270906 4:153587018-153587040 AGTGAGAAAAAAAATAAAGATGG - Intronic
982395338 4:154909843-154909865 AGTGAGGAAAAAAATGAGGCAGG - Intergenic
982512871 4:156305430-156305452 AGGGACACAAAAACTGCGGAAGG - Intergenic
982558650 4:156900962-156900984 AGGAAGAAAAAAAGAGAAGAGGG + Intronic
982573954 4:157085200-157085222 AGTGAAAAAAAAATTGAACATGG - Intronic
982793911 4:159623274-159623296 AGGGAGATTGAAATTGATGAAGG + Intergenic
982874755 4:160632989-160633011 AGAGAGCAAAAACTGGAGGATGG - Intergenic
982876573 4:160659063-160659085 AGGGACACAAAAACTGCGGAAGG + Intergenic
982979366 4:162112566-162112588 TGGAAGAAAATAATTGAGAAAGG - Intronic
983010244 4:162537791-162537813 AGGGTGAAAAATATAGAGGAGGG + Intergenic
983166366 4:164482010-164482032 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
983350542 4:166582309-166582331 AGGGAGAAAGAAGTTCAGTAAGG + Intergenic
983515530 4:168652264-168652286 AAGGATATAAAAATGGAGGAAGG + Intronic
983575426 4:169256280-169256302 AGGGAGGAAGAAAGGGAGGAAGG + Intronic
983886084 4:172982158-172982180 ATGCAGAAAGAAATTGAAGAAGG - Intronic
983988062 4:174084186-174084208 AGGGAGCAAACATTTGAGGGAGG - Intergenic
984036367 4:174673100-174673122 AGGATGAAAAAAAATGATGAGGG + Intronic
984149365 4:176107841-176107863 AGGAAGAAAAAAAGGAAGGAAGG - Intronic
984173712 4:176390469-176390491 AGGGAAAAAGAAAATGATGAGGG + Intergenic
984182541 4:176501750-176501772 AGGGGCAAAAATATTGAGAAGGG + Intergenic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984622032 4:181964527-181964549 AGGAAGAACAGAATTGAGGAGGG - Intergenic
984681175 4:182610675-182610697 TGGGAGAAAAAAATAGAGAGAGG - Intronic
984813598 4:183818244-183818266 AGGGACACAAACACTGAGGAAGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985113472 4:186569340-186569362 AGGCAGAAAAAAATGGATGTGGG + Intergenic
985311784 4:188609496-188609518 AGCGAGAAAAAAAGGAAGGAGGG + Intergenic
985409964 4:189673158-189673180 AGGGAGGCAAAAAAAGAGGAAGG - Intergenic
985738102 5:1596645-1596667 AGGGACACAAAAACTGCGGAAGG - Intergenic
985819918 5:2152827-2152849 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
985976848 5:3426021-3426043 GGGGAGAACAACATTGGGGATGG - Intergenic
986128693 5:4907474-4907496 AGGGAAAAAAGCACTGAGGAGGG + Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
986287100 5:6367405-6367427 AGGGGGAAAAAAATGGAAGTTGG + Intergenic
986314975 5:6581088-6581110 AGGCAGAAATAATTTGAGAAAGG + Intergenic
986549602 5:8938018-8938040 AGGGACACAAAAACTGCGGAAGG + Intergenic
986669687 5:10131855-10131877 AGGGAAAAAAGAAATGAGCAGGG + Intergenic
986816144 5:11414084-11414106 AGAGAGACAAAAATGGAGAAGGG + Intronic
987147370 5:15005450-15005472 AAGGAGAAAGAAATGAAGGAAGG - Intergenic
987182189 5:15379699-15379721 AGGGAGGAAGAAATGAAGGAAGG + Intergenic
987182218 5:15379791-15379813 AGGGAGGAAGAAATGAAGGAAGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987517997 5:18939685-18939707 AAAGAGAACAAAATTGTGGATGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
987560058 5:19508316-19508338 AGGGATAGAAAATTTGATGATGG - Intronic
987612853 5:20230000-20230022 AAGGAGAAAAAAATAGATGCTGG - Intronic
987785213 5:22490644-22490666 AGTTAAAAAAAAACTGAGGATGG + Intronic
987865602 5:23532161-23532183 AGGGAGAAGAAAATAGAGAGAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988380008 5:30487321-30487343 AGGGACACAAAAACTGCGGAAGG - Intergenic
988380927 5:30495807-30495829 AGGGACACAAAAACTGCGGAAGG - Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988799986 5:34687558-34687580 AGGGAGAAAAACATAGCAGAGGG + Intronic
988850581 5:35176663-35176685 AGGGACACAAAAACTGCGGAAGG + Intronic
988948670 5:36234880-36234902 AGGGAGAGAACAATTTGGGAAGG - Intronic
989003962 5:36789236-36789258 AGAGAGAAAAAAAAGGAGGGAGG - Intergenic
989007086 5:36826918-36826940 AGGAAGAAAGAAAGGGAGGAAGG + Intergenic
989024972 5:37056990-37057012 AGGGAGAGAAATATAGAGGGGGG - Intronic
989375090 5:40752925-40752947 GGTGAGAAAAAAAGTGAGGGTGG + Intronic
989564993 5:42893217-42893239 ACTGATCAAAAAATTGAGGAGGG - Intergenic
989633855 5:43513837-43513859 ATGAAGAAAAAACTTGAAGAGGG - Intronic
989635022 5:43522915-43522937 AGGGACACAAACATTGCGGAAGG + Intergenic
989719202 5:44504494-44504516 AGGGAGAAATAAATTAAAGATGG + Intergenic
989737940 5:44731155-44731177 AGGGACACAAAAACTGTGGAAGG - Intergenic
989960547 5:50409570-50409592 AGGGAGGAAAAAAGGAAGGAAGG + Intronic
990115660 5:52387355-52387377 AGGGAGAAAACAAGTGTGTAAGG - Intergenic
990789728 5:59464064-59464086 AGGGACACAAAAACTGCGGAAGG + Intronic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
990910755 5:60850125-60850147 AGGAAGAAAGAAAGGGAGGAAGG - Intergenic
991092890 5:62710057-62710079 AGGGAGAAAGGAAGGGAGGAAGG - Intergenic
991460887 5:66857055-66857077 AGGGAACAAAAGACTGAGGAGGG - Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
991716059 5:69452000-69452022 AGAGAGAAAAAAAGAAAGGAAGG + Intergenic
991978546 5:72207935-72207957 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
992037055 5:72790185-72790207 ATGGAGATAAAAATTGTGAAAGG - Intergenic
992041392 5:72836706-72836728 AGAGAGAAACAAATTAAAGATGG - Intronic
992183995 5:74225916-74225938 AGGGAGGAAAAAAGGGAGGGAGG - Intergenic
992320229 5:75606501-75606523 AGGGACACAAAAACTGCGGAAGG - Intergenic
992873214 5:81026249-81026271 AGGAAGAAAAAAAAAGAGAAGGG - Intronic
993045239 5:82858843-82858865 AGGGAGAAAAGAAAAAAGGAGGG - Intergenic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993395890 5:87388017-87388039 AAGGAGATAATAATTGAGGTGGG - Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993880961 5:93360314-93360336 GGGTTAAAAAAAATTGAGGAGGG + Intergenic
994265520 5:97711445-97711467 AGGGAGAGAGAAATGGAGGAAGG - Intergenic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
994865302 5:105261122-105261144 AGAGAGAAGAAAATTGCAGAAGG + Intergenic
995129589 5:108615920-108615942 AGGAAGAAAAGAAAGGAGGAAGG + Intergenic
995437802 5:112157687-112157709 AGGGGGATAAAAATGGAAGAAGG - Intronic
995456211 5:112354998-112355020 AGGGGGAAAAAAATTGAAATAGG + Intronic
995542963 5:113202209-113202231 AGGGGGAAAAAAAAAAAGGAAGG + Intronic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
995878832 5:116821408-116821430 AGGGACACAAAAACTGCGGAAGG + Intergenic
995976101 5:118036551-118036573 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
996054254 5:118965783-118965805 AGGGATACAAACATTGCGGAAGG + Intronic
996057758 5:118999542-118999564 AGGGACACAAACACTGAGGAAGG + Intergenic
996139117 5:119883671-119883693 AGGAAAAAAAAAATTGAGGATGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996163436 5:120195352-120195374 AGGGACACAAAAACTGCGGAAGG - Intergenic
996485328 5:124026904-124026926 AGGGGGAGAAGAATAGAGGAAGG + Intergenic
996893592 5:128453806-128453828 AGGGAAAAAAAAGTTGGGGGAGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997076053 5:130678926-130678948 AGGGAGAGAAAAAGGGAGGGAGG + Intergenic
997095662 5:130907997-130908019 AGGGAGCTAAAAATGGGGGAGGG + Intergenic
997167701 5:131678708-131678730 AGGTAGAAAACATTTAAGGATGG - Intronic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997329166 5:133046729-133046751 GGGGAAAAAAAAAAAGAGGAAGG - Intergenic
997691740 5:135831999-135832021 TGGGAGAGAGAAATGGAGGATGG + Intergenic
997835257 5:137186960-137186982 AGGGAGTAACACATTCAGGAGGG - Intronic
998079384 5:139261959-139261981 AGGGAGGGAAGAAATGAGGAAGG + Intronic
998303907 5:141053823-141053845 GGGGAGATAAAAATGGAGGCTGG + Exonic
998444416 5:142187603-142187625 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
998648115 5:144086636-144086658 AGGGAAAGAATAATGGAGGAGGG + Intergenic
998754318 5:145359355-145359377 AGGGAGAGATTAATGGAGGATGG - Intergenic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
998919207 5:147049271-147049293 AGAAAGAAGGAAATTGAGGATGG + Intronic
998982786 5:147722858-147722880 AGGGATAAAAAAAAAGAGGATGG - Intronic
999059590 5:148619056-148619078 AGTAAGAAAAGAATTGAGGGAGG + Intronic
999145905 5:149393677-149393699 AGGAAGAAAAAAAAGAAGGAAGG - Intronic
999361933 5:150992736-150992758 AGGGTGAGAAATATAGAGGAGGG + Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999951729 5:156658374-156658396 AGGGACACAAAAACTGCGGAAGG - Intronic
999952632 5:156666586-156666608 AGGGACACAAAAACTGCGGAAGG - Intronic
1000054274 5:157590899-157590921 AGGGAGAATGAAATTGATAAAGG - Intergenic
1000148524 5:158476806-158476828 AGTCAGAAAAGAATTGAGCAAGG + Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1001108411 5:168875326-168875348 AGGGAGAAATGAAAGGAGGAAGG + Intronic
1001114521 5:168928248-168928270 AAGAAGAAAATAATTTAGGAAGG + Intronic
1001232129 5:169997543-169997565 AGGGACACAAAAACTGCGGAAGG - Intronic
1001593406 5:172881884-172881906 AGGGTGAAGAGAATGGAGGAGGG - Intronic
1001619587 5:173072261-173072283 AGGGATAAAAAAATTAGGCATGG - Intronic
1001621819 5:173093133-173093155 AGGGTGAAACAAAGAGAGGATGG + Intronic
1001899598 5:175415081-175415103 AGGGAGAAAAGAAGGGAGAATGG - Intergenic
1001968120 5:175928849-175928871 AGGAAGAAAGAAAGTAAGGAAGG + Intronic
1002585802 5:180246657-180246679 AGGGTAAAAAATACTGAGGATGG + Intronic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002883789 6:1275809-1275831 GGGGAGAAAACATTTGAAGAAGG + Intergenic
1003098883 6:3162518-3162540 AGGGAGAAAAAAAGGGAGGGAGG - Intergenic
1003407007 6:5834144-5834166 AGGGAGCAAGAAAATGAGAAGGG + Intergenic
1003788439 6:9514579-9514601 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1003841173 6:10121368-10121390 AATGACAAAAAAATTTAGGAAGG + Intronic
1004177740 6:13354777-13354799 GGAGAGAAAAAAAGAGAGGAAGG - Intergenic
1004751465 6:18566148-18566170 AGGGAGGAAGAAAGGGAGGAAGG - Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1004948073 6:20637260-20637282 GGGGAGTAAACAAATGAGGAAGG + Intronic
1004960428 6:20782482-20782504 GGGGAAAAAAGAACTGAGGAAGG - Intronic
1005024407 6:21448806-21448828 AAGGAGAAAAAAAGCAAGGAGGG - Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005054976 6:21720790-21720812 AGGGAGAAGAAAAGTGGGTAGGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1005224358 6:23623594-23623616 AGGGAGGAAAGAAGGGAGGAAGG + Intergenic
1005743386 6:28813927-28813949 AGGGAAAAGAAATTTGAGAAGGG - Intergenic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006399802 6:33810628-33810650 AGGGACACAAAAACTGCGGAAGG - Intergenic
1006538481 6:34720128-34720150 AGGGACACAAAAACTGCGGAAGG - Intergenic
1006589601 6:35144544-35144566 AAAAAAAAAAAAATTGAGGAAGG - Intronic
1006673827 6:35747647-35747669 GGTGAGAAAGAAATTGAAGAGGG + Exonic
1006782279 6:36640087-36640109 AGAAAAAAAAAAAATGAGGAGGG - Intergenic
1007053441 6:38857003-38857025 AGGGAGACAGAAAATGAGAAGGG - Intronic
1007333770 6:41136345-41136367 AGGGAAAAAAAAGTTGGGGGTGG + Intergenic
1007462313 6:42027517-42027539 AGGGAGGAATAAATTGGGTATGG - Intronic
1007793552 6:44328710-44328732 AGGGACACAAAAACTGCGGAAGG - Intronic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1007874420 6:45079487-45079509 AGGAAGAAAAAAAGGAAGGAAGG + Intronic
1008288421 6:49682839-49682861 AGGAAGAAAAGAAGGGAGGAAGG - Intergenic
1008331839 6:50254828-50254850 AGAGAGGTAAAAATTAAGGAAGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008582963 6:52922949-52922971 AGGGACACAAAAACTGCGGAAGG + Intergenic
1008656808 6:53623369-53623391 GGGGAGCAAAAAATTCAAGAAGG + Intergenic
1008664838 6:53705980-53706002 AGGAAGAAAAAAATGAAGGAAGG + Intergenic
1009042133 6:58191279-58191301 AGGGACACAAACATTGCGGAAGG + Intergenic
1009217969 6:60945511-60945533 AGGGACACAAACATTGCGGAAGG + Intergenic
1009395126 6:63190806-63190828 AGAGAGAAAGAAAGTGAAGAAGG - Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009534792 6:64867028-64867050 AGGGAGAAAATATTTTAGAAAGG + Intronic
1009738077 6:67705045-67705067 AGGAAAAAAAAAAATGAGGGGGG + Intergenic
1009848977 6:69171833-69171855 AGGAAGAAAAAAATTGATATTGG - Intronic
1010003618 6:70972346-70972368 AGGGAAAATAAAATTGGGGTAGG - Intergenic
1010191272 6:73199514-73199536 AGGGAAAAGAAAATTGTGTATGG + Intergenic
1010217583 6:73418381-73418403 AGTCAGAGAAAAATTGAGGCAGG + Intronic
1010355726 6:74930721-74930743 AGTCAGAAAAAAATTGTTGAAGG - Intergenic
1010554204 6:77258814-77258836 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1010591482 6:77717613-77717635 AGGGACACAAAAACTGCGGAAGG - Intronic
1010592419 6:77726075-77726097 AGGGACACAAAAACTGCGGAAGG - Intronic
1010686392 6:78859065-78859087 AGGGACACAAAAACTGCGGAAGG + Intergenic
1010917634 6:81640787-81640809 AGGGAGATAAGGATGGAGGAAGG - Intronic
1011002660 6:82608284-82608306 AAGGACAACAAAGTTGAGGAGGG + Intergenic
1011118468 6:83923000-83923022 AGAGAGAAAAAAAATAAGGGGGG - Intronic
1011396829 6:86919142-86919164 GAGGAGAAAACACTTGAGGAGGG - Intergenic
1011536531 6:88381865-88381887 AGGGACACAAAAACTGCGGAAGG + Intergenic
1011557027 6:88581379-88581401 AGGAGGAAAAAAAGTGGGGAGGG - Intergenic
1011858115 6:91720501-91720523 AGAGAGAAAAGAATTGCGTATGG + Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1011967149 6:93173642-93173664 AGGGACACAAAAACTGCGGAAGG + Intergenic
1012270233 6:97200336-97200358 AGGGAGGAAAAGATAGAGGAGGG + Intronic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012350223 6:98240940-98240962 AGGGAGAAAGAAAGAGAGAAAGG + Intergenic
1012415623 6:99009967-99009989 AGAAAGAAAAGAATTGAGAAGGG - Intergenic
1012458118 6:99429648-99429670 AGGGACACAAAAACTGCGGAAGG + Intergenic
1013116665 6:107108782-107108804 AGGTAGAAAAAAAATTAAGAGGG + Intronic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1013298011 6:108776954-108776976 AGGAAGGAAAAAAGAGAGGAAGG + Intergenic
1013360895 6:109393186-109393208 AGGGAGAAAAACAGAGGGGAGGG - Intronic
1013555807 6:111255756-111255778 AGGGACACAAAAACTGCGGAAGG - Intergenic
1013673753 6:112434348-112434370 CGGGGGAAACATATTGAGGAAGG - Intergenic
1013733983 6:113204708-113204730 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014290319 6:119550832-119550854 GTGGAGAAAAAAATTTGGGATGG + Intergenic
1014491352 6:122065563-122065585 AGGAAGGAAGAAATGGAGGAAGG + Intergenic
1014585679 6:123194905-123194927 ATGAAGAAAATAATTGTGGAGGG + Intergenic
1014588595 6:123232612-123232634 AGGGAGAAAGCAAGAGAGGATGG + Intronic
1014624755 6:123711911-123711933 AGGGAAAACAAGATTGAGTAAGG + Intergenic
1014677048 6:124379372-124379394 AGGGAGGAAAGAAGGGAGGAAGG + Intronic
1014772703 6:125474984-125475006 AGTGAGGAAAAGATTGAGGCAGG + Intergenic
1014971016 6:127815297-127815319 AGGAAGAAAAAAATGACGGAAGG - Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015418058 6:132972583-132972605 AGAGAGAAAAAAGTTCATGATGG + Intergenic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1015574805 6:134659778-134659800 AGGGACACAAAAACTGCGGAAGG - Intergenic
1015653849 6:135495109-135495131 AGGGACAAAAACACTGTGGAAGG + Intronic
1015885129 6:137910081-137910103 AAGAAGAAAAGAATTGAGGAAGG - Intergenic
1015890735 6:137967600-137967622 TTGGAGAACAAAATTGTGGATGG - Intergenic
1016118231 6:140314591-140314613 AGAGAGAAAGAAATTGAGAGAGG + Intergenic
1016301509 6:142636739-142636761 AGAGAGAGATAAATTGAAGAAGG - Intergenic
1016429560 6:143968453-143968475 AGGAAAAAAAAAACTGAGGTAGG - Intronic
1016696750 6:147005034-147005056 AAGAAAAAAAAAATAGAGGATGG + Intergenic
1016704340 6:147089264-147089286 AGGGAGAAAGACATTTAGCATGG + Intergenic
1016710142 6:147161693-147161715 AGGAAGAAAGAAAAGGAGGAGGG - Intergenic
1016710742 6:147168856-147168878 AGGGAGGAAAGACTTGGGGATGG - Intergenic
1016754926 6:147674454-147674476 AGTGAGAAAAAAACTGAGTTGGG - Intronic
1017051008 6:150393317-150393339 AGGGAGAAAAGAAATGATAATGG + Intronic
1017138835 6:151171968-151171990 AGAGAGAAAAAGAGAGAGGAAGG - Intergenic
1017221861 6:151974823-151974845 AGGGAGCAAAATAGTGAAGACGG - Intronic
1017268427 6:152478408-152478430 AAAGAGAAAAAAATAGAGAAGGG + Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017624932 6:156338623-156338645 AGGAAGAAAAAAAGAGAGGAAGG - Intergenic
1017988167 6:159462836-159462858 TGGGAGAAAATAATTTGGGAAGG + Intergenic
1018217596 6:161545213-161545235 AGGGAAAAAAAAATTAAGCACGG + Intronic
1018341097 6:162851939-162851961 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1018480760 6:164187551-164187573 ATAGAGAAAAAAATCAAGGAAGG - Intergenic
1019041164 6:169107378-169107400 GGGGAGAAAAAAAGGAAGGAAGG + Intergenic
1019071265 6:169346953-169346975 AGGGACACAAAAACTGCGGAAGG - Intergenic
1019362024 7:609637-609659 AGGGAGAATAGAATTGTGAAAGG - Intronic
1019730600 7:2627454-2627476 AGGGAGGAAAAGATGGAGGGAGG + Intergenic
1019764701 7:2842010-2842032 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1019937707 7:4267229-4267251 AGGGAGGAAAGAAGAGAGGAAGG - Exonic
1019976156 7:4583094-4583116 AGGGACACAAAAAGTGCGGAAGG - Intergenic
1019977090 7:4591598-4591620 AGGGACACAAAAAGTGCGGAAGG - Intergenic
1019978026 7:4600101-4600123 AGGGACACAAAAACTGCGGAAGG - Intergenic
1020064624 7:5177823-5177845 AGGAAGAAAAAATCTGAGCAGGG + Intergenic
1020094318 7:5359986-5360008 AGGGAAAAAAAAAACGAAGAAGG + Intronic
1020531239 7:9338539-9338561 AGGAAGACAAAGAGTGAGGAAGG + Intergenic
1021067760 7:16197999-16198021 AGGGACACAAAAACTGCGGAAGG + Intronic
1021225402 7:18020591-18020613 AGGGAGAAAGTCATTGATGATGG - Intergenic
1021234754 7:18128843-18128865 AGGGAGAAAAAAAGAGAGACAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021324987 7:19255633-19255655 AGGAAGAAAAAGAGGGAGGAAGG - Intergenic
1021664271 7:22959422-22959444 AGGAAGAAGAAAATAGAGAATGG + Intronic
1021671568 7:23040133-23040155 AGGGACACAAAAACTGCGGAAGG + Intergenic
1021885733 7:25136812-25136834 AAGGAGAAAAAAATTGATCAGGG + Intronic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022131431 7:27408366-27408388 AGGGACAAAAACATAGAGCATGG - Intergenic
1022776861 7:33535810-33535832 AGAGAAAAAAAATTTGAAGAGGG + Intronic
1022903271 7:34831453-34831475 AGGGAGAAAAGAAAGGAGGGGGG + Intronic
1022935732 7:35174387-35174409 AGAGAAAAAAAAGTGGAGGAAGG - Intergenic
1022991609 7:35714132-35714154 AATGAGAATAAAATTAAGGAAGG - Intergenic
1022993659 7:35732301-35732323 AGGGGGAAGAATATTAAGGATGG - Intergenic
1023277252 7:38533308-38533330 ACGGAGAGAAAAATTGATCATGG - Intronic
1023338291 7:39192909-39192931 AAGGAGAAAAGGATGGAGGAAGG + Intronic
1023777033 7:43617580-43617602 AGGGAGAATATGATTTAGGAAGG + Intronic
1023991681 7:45132528-45132550 AGGGAGGGAAAAAAGGAGGAAGG + Intergenic
1024263665 7:47590264-47590286 AGGGAGAGAAGGATTGAGAAAGG - Intergenic
1024358928 7:48447368-48447390 AGGGAGAAAGAAATGGATTATGG - Intronic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024638857 7:51313638-51313660 AGGAAAAAAAAAATTAAGCATGG + Intronic
1024771184 7:52725082-52725104 AGCGAGAGAAGAAATGAGGAAGG + Intergenic
1024876517 7:54030354-54030376 AGGAAGAAAAAAAGAAAGGAAGG + Intergenic
1024959242 7:54957593-54957615 AGCATGAAAAAAATTGAGCAGGG + Intergenic
1024975170 7:55107226-55107248 AGGAAGAAAAAAACTGGGGAGGG - Intronic
1025203794 7:56979780-56979802 AGGGTGAGAAAAAATGTGGAGGG - Intergenic
1025231631 7:57206758-57206780 AGGGAGAAAGAAAGAGAGGAAGG - Intergenic
1025668147 7:63597150-63597172 AGGGTGAGAAAAAATGTGGAGGG + Intergenic
1025850997 7:65243701-65243723 AGGGACACAAAAACTGCGGAAGG - Intergenic
1026133116 7:67636715-67636737 AGGGAGGGAAAAAAGGAGGAAGG - Intergenic
1026250792 7:68668692-68668714 AGAGAGAAAAGAATTAGGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026638774 7:72106558-72106580 AGGGAGAGAGAAAAAGAGGAAGG + Intronic
1026654575 7:72246014-72246036 AGGGAGAAAAGAAAGGAGGCTGG - Intronic
1026666564 7:72345510-72345532 AGGGAGGAAGGAAATGAGGAAGG + Intronic
1027402828 7:77826142-77826164 AAAGAGAAAAAAATTCAAGATGG + Intronic
1027402833 7:77826213-77826235 AAAGAGAAAAAAATTCAAGATGG + Intronic
1027465134 7:78505884-78505906 AGGGAGAAATAAATAAATGAGGG + Intronic
1027465141 7:78505933-78505955 AGGGAGAAATAAATAAATGAGGG + Intronic
1027499124 7:78926097-78926119 AGGGAGAGAAACATTGGGGTAGG - Intronic
1027644076 7:80774681-80774703 AGAGGGAAAAAGATTGAAGAAGG + Intronic
1027821654 7:83053468-83053490 TGGAAGAAAAGAATGGAGGAAGG + Intronic
1027869346 7:83686991-83687013 AAGGAGAAAAAAATTCATGTGGG - Intergenic
1027994707 7:85410911-85410933 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1027997929 7:85449909-85449931 AGGAAGAAAGAAAATGAAGAAGG + Intergenic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028219137 7:88174794-88174816 AGAGAGAAAAGAAATGGGGAAGG - Intronic
1028385633 7:90249910-90249932 AGGGAGAGCAAATTTGAGCAAGG - Intronic
1028467534 7:91169796-91169818 AGGTAGAAAAGAATGGAGGGAGG + Intronic
1029412815 7:100426772-100426794 AGGGAGAGAGAAAGGGAGGAGGG - Intronic
1029478452 7:100799185-100799207 AGGGAGGAAAGGATGGAGGAAGG - Intergenic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1029831688 7:103267125-103267147 AGAGAAAAAAAAGTGGAGGAAGG - Intergenic
1029886672 7:103879908-103879930 AGGGAAAAAAAAATTAATGATGG - Intronic
1029951070 7:104586364-104586386 AGGGAGAAGAAACTTGTGGGTGG - Intronic
1029966698 7:104748199-104748221 AGGGACACAAAAACTGCGGAAGG + Intronic
1030034465 7:105396831-105396853 AGAGAGAAAGAAATAGAGGGAGG + Intronic
1030046096 7:105497778-105497800 AGCAAGAAAAAAAAGGAGGAAGG + Intronic
1030377376 7:108769529-108769551 ATGGAGAAAAAAATGGATCAGGG + Intergenic
1030555453 7:111019208-111019230 AGAGGGAAAAAAACTGACGAGGG + Intronic
1030649720 7:112104082-112104104 AGGGAGAATATAATTGAGAATGG - Intronic
1030687972 7:112505991-112506013 AGGGAGAAACCTATTGAGAAGGG + Intergenic
1030740184 7:113100287-113100309 AAGGAGAAAAAAATGAAGGAAGG - Intergenic
1030760325 7:113342185-113342207 AGGGACACAAAAACTGCGGAAGG - Intergenic
1031002643 7:116435039-116435061 AGGGAGAAAGAAGTTCAGTATGG + Intronic
1031315523 7:120253727-120253749 AGGTAGCAAAAAATTAAGAATGG - Intergenic
1031388448 7:121182517-121182539 AGGGAGAGAAAAAGGGAGGGAGG - Intronic
1031480481 7:122272562-122272584 AGGAAGAAAGAAAATGAGAAAGG - Intergenic
1031606963 7:123780914-123780936 AGGGACACAAAAACTGCGGAAGG + Intergenic
1031716421 7:125114143-125114165 AGGCAGAAAAGAAGAGAGGAGGG + Intergenic
1031724619 7:125221838-125221860 AGGGACACAAAAACTGCGGAAGG - Intergenic
1031781247 7:125968595-125968617 AGATAGAAAAAAATTGATAACGG - Intergenic
1031795403 7:126168437-126168459 AGGGACACAAAAACTGCGGAAGG + Intergenic
1031801733 7:126255228-126255250 ATGATGAAAAAAATTGAAGAAGG + Intergenic
1031865785 7:127037440-127037462 AGGGAGGAAAGAAGTGAGGTTGG - Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032223810 7:130014330-130014352 AGGAAAAAAAAAATTCAGGCTGG + Intergenic
1032231649 7:130079857-130079879 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231659 7:130079885-130079907 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032231678 7:130079945-130079967 AGGGAGGAAGAAAGGGAGGAAGG - Intronic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1032789694 7:135233280-135233302 AGGCAGGAAGAAATAGAGGATGG - Intronic
1032876361 7:136042565-136042587 AGAGAGAGATAAATTAAGGATGG + Intergenic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1033713189 7:143971113-143971135 AGGAAGAAAAATAATAAGGAAGG + Intergenic
1033994538 7:147329603-147329625 AGGGAGGAAAGTATGGAGGAGGG + Intronic
1033997397 7:147368054-147368076 AGGGAGAGAAAGAGAGAGGAAGG - Intronic
1034329990 7:150274114-150274136 ATGGAGAAAAAAATAAAGCAAGG + Intronic
1034483741 7:151343275-151343297 AGGGAGGAGAAAAGAGAGGAAGG - Intronic
1034668066 7:152835746-152835768 ATGGAGAAAAAAATAAAGCAAGG - Intronic
1035165865 7:156989442-156989464 AAGAAGAAAAACATTGAGAATGG + Intergenic
1035321341 7:158031289-158031311 ATGCAGGAAAAAATTCAGGAAGG - Intronic
1035349637 7:158237068-158237090 AGGGACACAAAAACTGCGGAAGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1035911866 8:3576067-3576089 AGGAATGAAAAAATAGAGGATGG - Intronic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036051590 8:5205451-5205473 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1036200670 8:6768667-6768689 AGAGAGAAAAAAAGAAAGGAAGG + Intergenic
1036291704 8:7498543-7498565 AGGGACACAAAAACTGCGGAAGG - Intronic
1036292635 8:7507046-7507068 AGGGACACAAAAACTGCGGAAGG - Intronic
1036571142 8:9980577-9980599 AGGGAGAAAACAAGGGAGGGAGG - Intergenic
1036717081 8:11135718-11135740 AAGGAGAAAAAAATTAAAGAAGG + Intronic
1036913231 8:12777375-12777397 AGGGAAATAAAAATCGAAGAAGG + Intergenic
1036998248 8:13685687-13685709 AGAGAGAGAGAAATTGAGCAAGG - Intergenic
1037085477 8:14843927-14843949 AATAAGAAAAAAATTTAGGAAGG + Intronic
1037293647 8:17378225-17378247 AGGGAAAAAAGAAATAAGGAGGG + Intronic
1037325276 8:17682680-17682702 GGAGAGAAAACAGTTGAGGATGG + Intronic
1037419248 8:18684454-18684476 AGGAAGAAAAAAAATATGGATGG + Intronic
1037429426 8:18794226-18794248 AGGGACACAAAAACTGCGGAAGG + Intronic
1037680424 8:21092759-21092781 AGGAAGAAAAAAAGGGAGGAAGG - Intergenic
1037703382 8:21295516-21295538 GGAGAGAGAAAAAGTGAGGAAGG - Intergenic
1037733589 8:21549498-21549520 AGAGAGAAAGAAAGAGAGGAGGG + Intergenic
1037747931 8:21661597-21661619 AGGGAGGAAAAAAGGGAGGGAGG + Intergenic
1037857348 8:22381270-22381292 GGGGAGAAAAAAAAAGAGTAGGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038001594 8:23396388-23396410 AGGGAGGAAGGAAATGAGGAGGG + Intronic
1038131033 8:24731903-24731925 AGGGAGAAAAAAAATAGGGTAGG + Intergenic
1038265018 8:26032400-26032422 AAAGAGAAAAAAATTAGGGATGG + Intronic
1038321545 8:26531789-26531811 AGGCAGAAAAAAAATGAAGTAGG + Intronic
1038695372 8:29801665-29801687 AGGGAGGGAAAAATTGGGGTAGG + Intergenic
1038759564 8:30374069-30374091 AGTGATAAATAAATTGAAGAAGG - Intergenic
1038980280 8:32752056-32752078 AAGAAGAAAACAATAGAGGACGG + Intronic
1039020939 8:33205694-33205716 AGAGAGAAGAAAATTTAGCAAGG - Intergenic
1039182069 8:34878088-34878110 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1039260520 8:35766326-35766348 AGGGAGAGAAAGAGGGAGGAAGG - Intronic
1039392668 8:37194036-37194058 AGGGACACAAAAACTGCGGAAGG - Intergenic
1039682082 8:39751394-39751416 AGAGAAACAAAAGTTGAGGAAGG + Intronic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1039977616 8:42380713-42380735 AGGGAGGAAAAAAGGAAGGAAGG + Intergenic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040279303 8:46030212-46030234 AGGGAGGAAAAAACAGAGCAAGG + Intergenic
1040462200 8:47659711-47659733 AGAGAGAAAAAAAGGGAGCATGG - Intronic
1040822682 8:51581920-51581942 AGGTAAAAAAAGATTGATGAGGG - Intronic
1041060768 8:54032349-54032371 AGGGACACAAAAACTGCGGAAGG - Intergenic
1041060974 8:54034188-54034210 ATGGAGAAAAAAATTAAAGCAGG - Intergenic
1041444155 8:57931816-57931838 AGGGAGGAAAAAAGGAAGGAAGG + Intergenic
1041573936 8:59371100-59371122 AGGGAGGAAAAAAGAAAGGACGG - Intergenic
1041576983 8:59409095-59409117 AGGGAGTAAAACATGGAAGAAGG - Intergenic
1042653169 8:71065853-71065875 AGGGAGAGAAAAAATGATTATGG - Intergenic
1042912981 8:73845553-73845575 AGGGACACAAACATTGCGGAAGG + Intronic
1043457522 8:80427281-80427303 AAGGATAAAAATATTGAAGATGG - Intergenic
1044143231 8:88680520-88680542 AGGAACCAAAAAAATGAGGAAGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044285543 8:90408492-90408514 AGAGAGAAAAGAAGGGAGGAAGG + Intergenic
1044310151 8:90684309-90684331 AGGGACACAAAAACTGTGGAAGG + Intronic
1044310283 8:90685156-90685178 AGGGACACAAAAACTGCGGAAGG + Intronic
1044484753 8:92738771-92738793 AGGGAAGAGAAAATTGAGGTTGG + Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044637530 8:94341465-94341487 AGGGACAAAAACACTGCGGAAGG + Intergenic
1044763904 8:95551219-95551241 AGAGAAAAAAAGATTGAGTATGG - Intergenic
1045204194 8:100020178-100020200 AAGGAGAAGAAAATTGCGGCCGG - Intronic
1045857421 8:106780531-106780553 TGGGAGAAAAAAACTGAAGTGGG - Intergenic
1046205616 8:110992280-110992302 AGTGAGAAAAATATTGTGTAAGG + Intergenic
1046230151 8:111345387-111345409 AGGGAGACAAAGAGTGGGGAGGG + Intergenic
1046272036 8:111909458-111909480 GAGTAGAAAAAAATTGAGTAAGG - Intergenic
1046662264 8:116961031-116961053 AGGGAGAAAAGAAGGGAAGAAGG + Intronic
1046723658 8:117651410-117651432 AGAGAGAAAAAAAGAGAGAAGGG + Intergenic
1047210850 8:122839121-122839143 AGGGAAAAAAAAAGTAATGAGGG - Intronic
1047221432 8:122921657-122921679 AGAGAGAGAGAAAGTGAGGAAGG + Intronic
1047488584 8:125355328-125355350 AGGGAGAAAAGAGTAGAGAAGGG + Intronic
1047605217 8:126467690-126467712 AGGGAGAAACTAATTTTGGAAGG + Intergenic
1048200427 8:132369510-132369532 AGGGAGTATAAAAATGAGGCTGG + Intronic
1048363111 8:133715144-133715166 AGGGAGAAAGAAAGGGAGGGAGG - Intergenic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048384674 8:133901086-133901108 AGGGAATGAAAATTTGAGGATGG - Intergenic
1048408106 8:134143213-134143235 AGGAAGAAAGAAAGAGAGGAAGG - Intergenic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048475323 8:134737514-134737536 AGGGATACAAAAAGTGGGGAAGG + Intergenic
1048519691 8:135142079-135142101 AGGGAGAAAAGAAGCGGGGAAGG + Intergenic
1048530074 8:135239969-135239991 AGGGACAAAGAAATCAAGGAAGG - Intergenic
1048767415 8:137860003-137860025 AGGAGGAGAAAAATGGAGGAAGG + Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1048947232 8:139460574-139460596 AGGGACACAAAAACTGCGGAAGG - Intergenic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1049663610 8:143832266-143832288 AGGGACACAAAAACTGCGGAAGG + Intergenic
1049691526 8:143962843-143962865 AGAAAGAGATAAATTGAGGAAGG + Intronic
1049898099 9:129661-129683 AGGGAGACGAAAATTGGGGGGGG + Intronic
1050135269 9:2456738-2456760 AGGGGGACAAATCTTGAGGAAGG - Intergenic
1050426827 9:5519764-5519786 GGGGAGAAGCAAATTAAGGAAGG - Intronic
1050454309 9:5818328-5818350 AGAGAGAGAAAAATTAATGATGG + Intronic
1050580096 9:7044935-7044957 AGGGAGAAAATCTTTCAGGAAGG + Intronic
1050705575 9:8392870-8392892 AAGGAGAAAAAATTTTAGAAAGG + Intronic
1051049613 9:12915555-12915577 AGGGTGGAAAAAATTTTGGAGGG - Intergenic
1051200173 9:14609069-14609091 GGGGAGGAAACAATTGGGGAAGG - Intergenic
1051354717 9:16231154-16231176 AGGGAGTCTTAAATTGAGGATGG - Intronic
1051388678 9:16539689-16539711 AGGGAGAAAGGAAGGGAGGAAGG + Intronic
1051406035 9:16738734-16738756 AGGGAGTAAGAAATTGAGCTAGG - Intronic
1051471260 9:17445638-17445660 AGGGACACAAAAACTGCGGAAGG + Intronic
1051525233 9:18035642-18035664 TGGGAGGAAAAACTTGAGCAGGG - Intergenic
1051635131 9:19174654-19174676 AGGGAGGAAAAAATAGAGGAAGG - Intergenic
1051685227 9:19651559-19651581 AGAGAGAAAGAAATTGATGATGG - Intronic
1051779081 9:20669167-20669189 AGGGTGAAAAAAATTTAAGGGGG + Intronic
1052474479 9:28941055-28941077 AGGAAGAAAGAAATGAAGGAAGG + Intergenic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1052676603 9:31633547-31633569 AGGGACACAAAAACTGCGGAAGG - Intergenic
1052806226 9:33015847-33015869 TGTCAGAAAAAAATTGATGAAGG - Intronic
1053073303 9:35113758-35113780 GGGGAGAAAGAAATTGTGGAGGG - Intronic
1053237410 9:36468439-36468461 AGGTAGAAAAGAGTAGAGGATGG + Intronic
1053329808 9:37193815-37193837 AGGGAGAAAGAAATTCCTGAAGG - Intronic
1053786392 9:41655547-41655569 GGAGAGAAAAAAATTGGGGAGGG + Intergenic
1053946378 9:43312976-43312998 AGGAAGGAAAAAAGGGAGGAAGG + Intergenic
1054158671 9:61658673-61658695 GGAGAGAAAAAAATTGGGGAGGG - Intergenic
1054175111 9:61869504-61869526 GGAGAGAAAAACATTGGGGAGGG + Intergenic
1054322260 9:63682277-63682299 AGGGACACAAAAACTGCGGAAGG - Intergenic
1054478445 9:65589678-65589700 GGAGAGAAAAAAATTGGGGAGGG - Intergenic
1054662426 9:67711292-67711314 GGAGAGAAAAACATTGGGGAGGG - Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054972646 9:71106440-71106462 AGGGAGCAAGAAAGTGAGGGAGG - Intronic
1054989005 9:71299522-71299544 AGGGAGAAAAAAGAAAAGGAAGG + Intronic
1055087083 9:72325347-72325369 GGGGGGAAAAAAAATGATGAAGG - Intergenic
1055518769 9:77060301-77060323 AGGGACACAAACATTGCGGAAGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055876108 9:80943438-80943460 AGGTAGAAAAACAGTAAGGATGG + Intergenic
1055941282 9:81652447-81652469 AGGGAAAGAAAAACTGAGAATGG + Intronic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1056524782 9:87433062-87433084 AGGAAGAAAGAAATGAAGGAAGG + Intergenic
1056578459 9:87873090-87873112 AGGGAGAAAGACAGAGAGGAGGG + Intergenic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1056697579 9:88872854-88872876 AGGGAGAAATAAAGGGAGGGAGG + Intergenic
1056855595 9:90126687-90126709 AGGGAGAGAAAAAGCAAGGAGGG - Intergenic
1056939264 9:90941304-90941326 AGGAAGAGAGGAATTGAGGATGG - Intergenic
1057108188 9:92441416-92441438 AGGAAGAAAAAAAGGGATGAAGG + Intronic
1057777942 9:98026056-98026078 AGAAAGAAAGAAATTGGGGAAGG + Intergenic
1058006199 9:99917992-99918014 AGGTAGAACCAAGTTGAGGATGG - Intronic
1058256643 9:102774764-102774786 AAGGACAAAAAAAGTGTGGAAGG - Intergenic
1058605325 9:106715443-106715465 AGGGAGAAAAATCTTGAGAAAGG + Intergenic
1058806232 9:108594882-108594904 AGGGACACAAAAACTGCGGAAGG + Intergenic
1058854793 9:109050573-109050595 AGAGAGTACAAAATTGAGAAGGG + Exonic
1058955265 9:109941049-109941071 AGGGAGGAAAAGATGGGGGAAGG - Intronic
1058955273 9:109941086-109941108 AGGAAGAAAAAAGAAGAGGAAGG - Intronic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059099604 9:111457365-111457387 AGAGAGAAAGAAACTGAAGAGGG + Intronic
1059369906 9:113820851-113820873 AGAGAGAAATAGATTGACGATGG + Intergenic
1059589040 9:115637659-115637681 AGGGAGAGAAAAAGGGAGGGAGG + Intergenic
1059713379 9:116889963-116889985 AGGAAGAAAGAAAGAGAGGAGGG + Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1059948498 9:119437768-119437790 AGGCAGAAGAAAACTAAGGATGG - Intergenic
1059980774 9:119769551-119769573 AGGGATAAGAAAATTGCGGCCGG + Intergenic
1060167340 9:121429383-121429405 AGGGACACAAAAACTGCGGAAGG + Intergenic
1060644213 9:125264158-125264180 AGGGAGATAAAAAATTTGGATGG + Intronic
1060657678 9:125383576-125383598 AAGAAGAAAAAAATAGGGGAGGG - Intergenic
1060761802 9:126258619-126258641 AGTGAGAAAAGAATGCAGGAGGG - Intergenic
1060987854 9:127830043-127830065 AGAGAGAAAAAAAATTAGGCTGG + Intronic
1061554229 9:131356988-131357010 AGGGACACAAAAACTGCGGAAGG + Intergenic
1061724972 9:132577296-132577318 AGGGAGAAAAAAAGGAAGGGAGG + Intergenic
1061979532 9:134093104-134093126 AGGGACACAAAAACTGCGGAAGG - Intergenic
1203456752 Un_GL000219v1:175488-175510 AGGGACACAAAAACTGCGGAAGG + Intergenic
1203365126 Un_KI270442v1:249492-249514 AGGGAAAGAAAAAGAGAGGAAGG + Intergenic
1203377016 Un_KI270442v1:384500-384522 AGGGAGAGAAAGATGGAGGGAGG - Intergenic
1203562793 Un_KI270744v1:72240-72262 AGGGACACAAACATTGCGGAAGG + Intergenic
1203589508 Un_KI270747v1:41534-41556 AGGAAGGAAAAAAGGGAGGAAGG + Intergenic
1203661607 Un_KI270753v1:49246-49268 AGGGAGGCAAAAAAAGAGGAAGG + Intergenic
1203672792 Un_KI270755v1:32322-32344 AGGGAGGCAAAAAAAGAGGAAGG + Intergenic
1185683786 X:1910431-1910453 AGGGAGGGAGAAAGTGAGGAAGG - Intergenic
1185843682 X:3417145-3417167 AGGAAGAAAGAAAGGGAGGAAGG - Intergenic
1186049826 X:5579454-5579476 AGGGAGAATAAAATGGAGGGTGG + Intergenic
1186058854 X:5681672-5681694 AGGAAGAAAGAAAGGGAGGAGGG + Intergenic
1186311707 X:8326794-8326816 ATGGAGAAAAGAGTAGAGGATGG - Intergenic
1186614098 X:11168696-11168718 TGGGAGAAAAAACATGAAGAAGG + Intronic
1186622021 X:11251425-11251447 AGAGAGGAAAGAATTGAGGATGG - Intronic
1186625552 X:11289520-11289542 AGGGAGAAAAAAATTAGAGAAGG + Intronic
1186713452 X:12225561-12225583 AGGGAAATAAAAAAGGAGGAGGG - Intronic
1186721464 X:12308789-12308811 AAGGAAAAAAAAATGGGGGATGG + Intronic
1186896167 X:14006453-14006475 AGGGAGAAAAAAAATCCTGAGGG + Intergenic
1186949550 X:14608223-14608245 AAGGAGAAAAAAAGTGGGAAGGG + Intronic
1186956871 X:14692266-14692288 AGTGAGGAGAAAATTGAGAAAGG - Intronic
1187011304 X:15283063-15283085 AGAAAGAAAAAAAGTGGGGAAGG + Exonic
1187177435 X:16909240-16909262 AGGAAAATAAAAATTGAGGTAGG - Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187319577 X:18227696-18227718 AGAGAGAAAAAGAGAGAGGAGGG + Intergenic
1187359309 X:18610033-18610055 AGGGGGGAAAAAATAGAGCAAGG + Intronic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188455440 X:30359260-30359282 AGAGAGAGAGAAATTGAGGGAGG + Intergenic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188630640 X:32355093-32355115 AGGGAGGAAGAAATGGAAGAAGG - Intronic
1188801085 X:34530762-34530784 AGAGAGAAAAAAAGAGAGGAGGG + Intergenic
1188942771 X:36261474-36261496 AGGGACACAAACACTGAGGAAGG - Intronic
1189000304 X:36937146-36937168 AGAGAGAAAAGAAAAGAGGAAGG + Intergenic
1189876034 X:45436833-45436855 AGGGAGAAAGGAATAGAGGTAGG + Intergenic
1190025092 X:46914812-46914834 AGGTAGAAAAAAGTAGAGAAAGG + Intronic
1190406251 X:50090634-50090656 AGGAAAAAACAAATTGAAGATGG - Intronic
1190702956 X:53001678-53001700 AGGGAGAAAAAGATGGGGAAGGG - Intergenic
1190739461 X:53279849-53279871 AGGGAGAAAGGAAAAGAGGAAGG + Intronic
1190795369 X:53736199-53736221 AGGGAGAAAACATTTCAAGAAGG - Intergenic
1190827116 X:54027917-54027939 AGGTAGAAAAAAAAACAGGAAGG + Intronic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1191033351 X:55998438-55998460 AGGGACACAAAAACTGCGGAAGG - Intergenic
1191999485 X:67133397-67133419 AGGGAAAAAAAACTTGATGTAGG - Intergenic
1192252322 X:69422827-69422849 AGGGACACAAAAACTGCGGAAGG + Intergenic
1192354251 X:70385154-70385176 AGGTAGAAAAATAATTAGGATGG + Intronic
1192409636 X:70921826-70921848 AGGTAGAGAAAAATTCATGAAGG + Intergenic
1192502398 X:71662676-71662698 AGGGAGAAAAGCACTGAAGAAGG + Intergenic
1192826998 X:74707686-74707708 TGGGAGAAAAAAATTTATTAGGG + Intergenic
1192829361 X:74734928-74734950 AGGGAGAAAAAAATTTTAGTTGG - Exonic
1193132116 X:77931161-77931183 AGGGACACAAACACTGAGGAAGG - Intronic
1193158568 X:78202131-78202153 AGGCAGAAAGAAATTCTGGAAGG + Intergenic
1193407869 X:81124433-81124455 AGGGCTAAAATAATTGAAGAAGG - Intronic
1194070957 X:89325481-89325503 AGAGAGAAAAAAAAACAGGATGG - Intergenic
1194142568 X:90223044-90223066 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194754840 X:97726604-97726626 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1194812724 X:98405753-98405775 AAGGAGAAAAAAATTTAGCCTGG + Intergenic
1194906972 X:99589774-99589796 AGGGAAAAAAAAATAGAAAAAGG + Intergenic
1195042366 X:101026080-101026102 AGAAAGAAAAAAAGAGAGGAAGG + Intronic
1195309405 X:103616246-103616268 GGGAAGAAAAAAAAGGAGGATGG - Intronic
1195366875 X:104135069-104135091 AGGGAGGAAAGAGTTCAGGAGGG - Intronic
1195438039 X:104867760-104867782 AGGGAGTAGAAACTGGAGGAAGG + Intronic
1195661646 X:107384822-107384844 AAAGAGAAATAAATGGAGGAAGG - Intergenic
1196355251 X:114784631-114784653 AGCGAGAAAAAAAAAAAGGAAGG - Intronic
1196522020 X:116685419-116685441 GAAGAGAAAACAATTGAGGAAGG + Intergenic
1196729099 X:118923033-118923055 AGGGAGAAAGAAAGAAAGGAAGG + Intergenic
1196733517 X:118964193-118964215 AGGGAAAAAATGACTGAGGAAGG - Intergenic
1196776810 X:119345603-119345625 AGAGAGAGAAAAATTAATGAAGG - Intergenic
1196943664 X:120802514-120802536 AAGGAGAAAAGAAGAGAGGAAGG + Intergenic
1197007874 X:121524863-121524885 ATGGAAAAAAAAACAGAGGATGG + Intergenic
1197383829 X:125779788-125779810 AGGGACACAAAAACTGCGGAAGG + Intergenic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1197467182 X:126819634-126819656 AGGGAGAAAAGGAGTGGGGAGGG - Intergenic
1198069968 X:133138561-133138583 AGGGAGAAAAGAAAGGAGGGAGG + Intergenic
1198070947 X:133148062-133148084 GGGGAAAAAAAAAGTGATGATGG - Intergenic
1198112062 X:133510366-133510388 AGGGAGAAAAGGAGGGAGGAAGG - Intergenic
1198158860 X:133987314-133987336 AGGGAGACAAAGAGAGAGGAAGG + Intergenic
1198174749 X:134144229-134144251 AGGGAGAAAATAAAAAAGGAGGG + Intergenic
1198343272 X:135735190-135735212 TGGGAAAAAAAAACTGAGGCAGG - Intergenic
1198520801 X:137450453-137450475 ATGGAGAAAAAAAGAGAAGAGGG - Intergenic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1198973377 X:142306231-142306253 AAGCACACAAAAATTGAGGAAGG - Intergenic
1198992002 X:142525245-142525267 AGGGAGAGAAACATACAGGAGGG + Intergenic
1200051157 X:153432562-153432584 AGGGAGAGAAAAAGAGAGGAAGG + Intergenic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200432307 Y:3099770-3099792 AAGGAGAAAAAAACAAAGGATGG + Intergenic
1200488322 Y:3792145-3792167 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1200832611 Y:7702150-7702172 GAGGAGAAAAAAATGGAGCAAGG + Intergenic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201356729 Y:13104490-13104512 AGGGACACAAAAACTGCGGAAGG - Intergenic
1201458923 Y:14201313-14201335 AGGGAGGAAGAAAATAAGGAAGG + Intergenic
1201550124 Y:15210478-15210500 AGGAAGAAAAGAAGGGAGGAAGG + Intergenic
1201550221 Y:15210990-15211012 AGGGAGAGAGAAATGAAGGAAGG + Intergenic
1201625764 Y:16012537-16012559 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1201625767 Y:16012557-16012579 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1201733709 Y:17234454-17234476 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1201798669 Y:17928738-17928760 AGGGAGGAAGGAATGGAGGAAGG + Intergenic
1201802884 Y:17977219-17977241 AGGGAGGAAGGAATGGAGGAAGG - Intergenic
1202253176 Y:22893707-22893729 AGGGACACAAAAACTGCGGAAGG - Intergenic
1202359986 Y:24097385-24097407 AGGGAGGAAGGAATGGAGGAAGG + Intergenic
1202406166 Y:24527456-24527478 AGGGACACAAAAACTGCGGAAGG - Intergenic
1202464616 Y:25142625-25142647 AGGGACACAAAAACTGCGGAAGG + Intergenic
1202510791 Y:25572729-25572751 AGGGAGGAAGGAATGGAGGAAGG - Intergenic