ID: 1071457327

View in Genome Browser
Species Human (GRCh38)
Location 10:85861088-85861110
Sequence CAGGGATGTCCCCAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071457321_1071457327 11 Left 1071457321 10:85861054-85861076 CCAGATTTCAATATGTATGAGCT No data
Right 1071457327 10:85861088-85861110 CAGGGATGTCCCCAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071457327 Original CRISPR CAGGGATGTCCCCAGAAGCT GGG Intronic