ID: 1071461073

View in Genome Browser
Species Human (GRCh38)
Location 10:85896344-85896366
Sequence CCAGCCCAGCTCTAACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071461073_1071461078 11 Left 1071461073 10:85896344-85896366 CCATTAAGTTAGAGCTGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1071461078 10:85896378-85896400 TACTGCATGAAGGTAACACAGGG No data
1071461073_1071461076 1 Left 1071461073 10:85896344-85896366 CCATTAAGTTAGAGCTGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1071461076 10:85896368-85896390 TCAAAGGCAGTACTGCATGAAGG No data
1071461073_1071461079 16 Left 1071461073 10:85896344-85896366 CCATTAAGTTAGAGCTGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1071461079 10:85896383-85896405 CATGAAGGTAACACAGGGTTTGG No data
1071461073_1071461077 10 Left 1071461073 10:85896344-85896366 CCATTAAGTTAGAGCTGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1071461077 10:85896377-85896399 GTACTGCATGAAGGTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071461073 Original CRISPR CCAGCCCAGCTCTAACTTAA TGG (reversed) Intronic
901662861 1:10809610-10809632 CCAGCTCAGATCAAATTTAAAGG - Intergenic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
908069546 1:60443095-60443117 CCACTACAGCTCTAACTCAAAGG + Intergenic
914462608 1:147898770-147898792 CAAGCCCAGCTCTGACTTAGTGG - Intergenic
918201460 1:182271137-182271159 CCTGCACAGCTCACACTTAAAGG - Intergenic
922699411 1:227750131-227750153 CCAGCAAAGCTCTGACTGAAAGG - Intronic
924494657 1:244575436-244575458 CCTGCTCAGCTCTAACTTGCAGG + Intronic
924933829 1:248751441-248751463 CCAGCCCAGCTCTTTCTTCTTGG - Intronic
1062797053 10:352526-352548 CCAGCACAGCACTATCTCAAGGG - Intronic
1064622356 10:17229071-17229093 CCAGCCCAGCGCTGAAGTAACGG + Intronic
1067780385 10:49198596-49198618 CCAGCCAAACTCTTATTTAAAGG + Intergenic
1068941699 10:62687099-62687121 CCAGCCAGGCTCTATTTTAATGG + Intergenic
1070601019 10:77866276-77866298 CCAGCCCATCTCAAACTGGAGGG + Intronic
1071333577 10:84584351-84584373 CCAGCCCATCTGGAACTTCAGGG + Intergenic
1071461073 10:85896344-85896366 CCAGCCCAGCTCTAACTTAATGG - Intronic
1072188700 10:93063957-93063979 CCAGCAAAGCTCTGACTTAGAGG - Intronic
1073202091 10:101743927-101743949 CCAGCTCAACTCTAACTTGTGGG - Intergenic
1073562778 10:104511093-104511115 CCAGACCAGCTCAGATTTAAGGG + Intergenic
1073939807 10:108683399-108683421 CCAGCACAGATACAACTTAATGG - Intergenic
1076359128 10:129874611-129874633 TCAGCCCAGCTCTGACCTGAAGG + Intronic
1078147107 11:8729668-8729690 ACAGCCCAGCTCTACCCCAAAGG + Intronic
1083868323 11:65470901-65470923 CCAGCTCGGCCCTAACTCAAAGG - Intergenic
1083896979 11:65624883-65624905 ACAGCCCAGCTCTCACTTGCAGG - Intronic
1085509851 11:77082688-77082710 CCAGCCGAGCTCTCCCTTTATGG + Intronic
1085597335 11:77821381-77821403 CCAGCCCAGCCCCTAATTAAGGG - Intronic
1088640933 11:111872190-111872212 CCAGCCCAGGACTATCTTACCGG + Intergenic
1088860074 11:113790846-113790868 ACTGCCCAGCTCTAAACTAAAGG - Intergenic
1089024179 11:115251177-115251199 GCAGCTCAACTCCAACTTAACGG + Intronic
1089751070 11:120651589-120651611 CCAGCCCGGGTCCAACTTGAGGG - Intronic
1100558380 12:95721208-95721230 CCTGGACAGCTCTTACTTAAAGG - Intronic
1100677757 12:96886740-96886762 CAAGCTCAGCTATAAGTTAAAGG + Intergenic
1100787649 12:98095901-98095923 CCACCCCAGCTATTACTAAAAGG + Intergenic
1102570775 12:113825741-113825763 CAAGTCCAGCTCTATCTTACAGG - Intronic
1102632429 12:114292990-114293012 ACAGGCCAGCTCTAATTCAAGGG - Intergenic
1102749830 12:115282806-115282828 CCACCCCAGCTGGAACTTAAAGG + Intergenic
1105620023 13:22057686-22057708 TCTGCCCAGCTCACACTTAAGGG + Intergenic
1107769466 13:43774760-43774782 CCAGCCCTGCTCTCACTGCAAGG + Intronic
1110527567 13:76556616-76556638 TCAGCCCTGTTTTAACTTAAGGG - Intergenic
1117561978 14:56949806-56949828 CCATCCCAGCTCAAACTTTCAGG - Intergenic
1117594766 14:57315030-57315052 CAAGCACAGCTCAAACTCAAGGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123159574 14:106264853-106264875 CCAGCTCAGCCCTAACTCTATGG + Intergenic
1123190694 14:106566535-106566557 CCAGCTCAGCCCTAACTCTATGG + Intergenic
1127707466 15:61561489-61561511 CCAGTGCAGCTGGAACTTAAAGG - Intergenic
1131348005 15:91669151-91669173 TGAGCCCAACTCTAACTTCATGG + Intergenic
1131758001 15:95586807-95586829 CCAGCCCAGCTCTCGCTCAAGGG - Intergenic
1133684065 16:8149234-8149256 CCACCCCATCTCTAAATTCAGGG - Intergenic
1136340781 16:29641749-29641771 CTGTCCCAGCTCTAAATTAAAGG - Intergenic
1136746645 16:32597036-32597058 CCAGCCCAGCACAGACTGAAGGG - Intergenic
1139460153 16:67115636-67115658 CTATCCCAGCTCTAACAGAATGG - Intronic
1203048774 16_KI270728v1_random:856240-856262 CCAGCCCAGCACAGACTGAAGGG - Intergenic
1148519145 17:48253119-48253141 CCATCCTAGCTCTTACTAAAGGG + Intronic
1151778518 17:76226255-76226277 ACTGCCCAGCTCTAAACTAAAGG + Intronic
1154374958 18:13801293-13801315 CCAGCCCACGTCTAACGTACTGG - Intergenic
1160964517 19:1740797-1740819 CAAGCCCAGGCCTCACTTAAGGG + Intergenic
1161194089 19:2976720-2976742 CCAGCCCAGCTCTGCCTGAGAGG + Intergenic
1162462594 19:10821994-10822016 CAAACCCAACTCTCACTTAAAGG + Intronic
1166840334 19:45693210-45693232 CCAGCCTACCTCAAACTTGATGG - Intronic
1167600045 19:50449524-50449546 CCAGGCCAGCTCTGAGTCAAGGG + Intronic
925896994 2:8479990-8480012 ACAGCCCACCCCTAACTTCAGGG - Intergenic
929006726 2:37401889-37401911 CCAGCCCTGCTTTAATTAAAGGG - Intergenic
933735641 2:85491807-85491829 CCAGCCCTGTCATAACTTAAAGG - Intergenic
934029008 2:88024816-88024838 CCAGCCCAGCTCTAAGAGCAGGG + Intergenic
937291875 2:120786818-120786840 CCAACCCAGCCCTCCCTTAAAGG + Intronic
938742796 2:134248660-134248682 ACAGCGCTGCTCTAACTTAGTGG - Intronic
948309537 2:236974747-236974769 CCAGCCCAGCTCTAAGACCAGGG - Intergenic
948709604 2:239817647-239817669 CCAGCCCAGGTCCCTCTTAAGGG + Intergenic
1170555335 20:17510358-17510380 CAAACCCAACTCTAACTCAAAGG - Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1174550642 20:51359111-51359133 GCAGCCCAGCTCAAACCCAAAGG - Intergenic
1174868050 20:54157052-54157074 CCAGCTCACCTCTAACTTGCTGG - Intronic
1178336731 21:31750086-31750108 CTAGCCCAGCTCCAACTTGGCGG - Intergenic
1180140292 21:45889404-45889426 CCAGCCCAGCTCTGAATGCAGGG + Intronic
1180649535 22:17367168-17367190 CCACCCCAGCCCCAATTTAAAGG - Intronic
1182621696 22:31621955-31621977 TTAGCCCAGCTCTCACTTCAGGG + Intronic
1183713849 22:39522076-39522098 ACTGCCCAGCTCTAAACTAAAGG - Exonic
1184227375 22:43136834-43136856 CCAGCCCATGTCTAAAGTAAAGG - Intronic
951262470 3:20526729-20526751 CCAGCCAGGCTCTACCATAAAGG + Intergenic
951601245 3:24378152-24378174 TCAGCCCAGCTGTCTCTTAAAGG + Intronic
951695992 3:25446292-25446314 TCAGCCCAGCTTTAAGATAAAGG - Intronic
953912306 3:46899238-46899260 CCAGCCCAGCCCTGACTTCCCGG + Intronic
955027810 3:55187487-55187509 CCAGCTCTCCTTTAACTTAAAGG - Intergenic
955503143 3:59604935-59604957 CCCTCCCAGCTCTCACTTATGGG - Intergenic
961865487 3:129950731-129950753 CCACCCCAGCTCTGAGATAAGGG + Intergenic
963290668 3:143483880-143483902 CAAGCCCAGCTTTCTCTTAAGGG + Intronic
966209727 3:177440634-177440656 CCAGCGCAGCTGTCAATTAAAGG - Intergenic
968403008 4:315004-315026 CCACTCCAGCTGTGACTTAAAGG - Intergenic
968918977 4:3512751-3512773 TCGGCCCAGCTCTGACTGAAGGG - Exonic
971672547 4:29581634-29581656 CCAGCCCAGGTCTATCTTGTTGG - Intergenic
972506818 4:39727593-39727615 CCAGCCCATCTCTATCCTTATGG - Intronic
975760488 4:77614901-77614923 CCAGCCAACCACAAACTTAAGGG - Intergenic
976354223 4:84097204-84097226 CCAGCTCAGCTCTCCCTTCAGGG + Intergenic
976568745 4:86584200-86584222 CCAGCCCAGCTCTAGCTCTTTGG + Intronic
981566879 4:146111208-146111230 CCACCCCAGCTCTGACTTAGCGG - Intergenic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
987131434 5:14863848-14863870 CAAGCCCAGTTGTAAATTAATGG - Intronic
988735386 5:34015361-34015383 CCAGGCCAGCCCAAACTCAAAGG - Intronic
993752265 5:91684858-91684880 TCAGCCAACCTCTAACATAAAGG + Intergenic
994813192 5:104549121-104549143 AAATCCCAGCTATAACTTAATGG - Intergenic
996089307 5:119335488-119335510 CCAGCCCAGGTGAAACATAAAGG - Intronic
998016412 5:138735635-138735657 CCAGCCCAGCTCCAACTCTGTGG - Intronic
1002288875 5:178185657-178185679 TCAGGCCAGCTTTAATTTAATGG - Intergenic
1003728819 6:8797383-8797405 GCAGCACAAATCTAACTTAATGG + Intergenic
1008681479 6:53877205-53877227 CCACTCCAGCTCTGACTAAAAGG - Intronic
1010286769 6:74087164-74087186 ACAGCCCAGTTCTAGCTTAGAGG - Intergenic
1012161353 6:95888888-95888910 CCAGTCCAGCTGTTACTAAAAGG - Intergenic
1018667995 6:166157039-166157061 CTAACCCAGCTCTAACCTACTGG + Intergenic
1022483916 7:30763180-30763202 CCAGCTCAACTCTAGCTGAAGGG - Intronic
1025606151 7:63041378-63041400 ACAGCCCAGCTCTCCCTTAGGGG + Intergenic
1028114211 7:86979506-86979528 CCAGTCCAGCCCTAACTTATGGG + Intronic
1028138642 7:87247818-87247840 CCAGGCCAGATCTAACTTACTGG + Intergenic
1028880775 7:95877249-95877271 TCAGCCCAACACTAACTTGAGGG + Intronic
1036915694 8:12801448-12801470 CCACCCTAACTCTACCTTAATGG + Intergenic
1038439929 8:27564663-27564685 TCATCTCAGCCCTAACTTAAAGG - Intergenic
1040644308 8:49380368-49380390 CAAGCTCAGCTCTTACTGAAAGG - Intergenic
1043263384 8:78230000-78230022 CCAGACCATTTCTAACTTTAAGG + Intergenic
1043399584 8:79871012-79871034 TCAGCCCAGCTACAACCTAATGG + Intergenic
1050583600 9:7086565-7086587 CCAGCACAGCACTTACCTAAGGG - Intergenic
1051091190 9:13410724-13410746 CCAGTGAAGCTCTAACTCAAAGG - Intergenic
1055064992 9:72109971-72109993 CCAGCTCATCTCTAATTTCATGG + Intergenic
1062195261 9:135269451-135269473 CAAGCCCATCTGTAACTGAAGGG + Intergenic
1193432442 X:81425116-81425138 ACAGCCCATTTCTACCTTAAAGG + Intergenic
1195751997 X:108169150-108169172 CCAGCCAACCTCTCACTAAATGG + Intronic
1196698387 X:118638795-118638817 CCATACCAGCTCCAACTTATGGG - Intronic
1197590797 X:128407715-128407737 ATAGCACAGCTCTAATTTAATGG + Intergenic