ID: 1071461724

View in Genome Browser
Species Human (GRCh38)
Location 10:85903120-85903142
Sequence CTATGAGTCTGGAGTTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 11, 3: 30, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071461724_1071461730 27 Left 1071461724 10:85903120-85903142 CCCTCTGAACTCCAGACTCATAG 0: 1
1: 0
2: 11
3: 30
4: 199
Right 1071461730 10:85903170-85903192 TCTCTGTGTAATGGTCTAATAGG No data
1071461724_1071461728 18 Left 1071461724 10:85903120-85903142 CCCTCTGAACTCCAGACTCATAG 0: 1
1: 0
2: 11
3: 30
4: 199
Right 1071461728 10:85903161-85903183 TACATACCATCTCTGTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071461724 Original CRISPR CTATGAGTCTGGAGTTCAGA GGG (reversed) Intronic
901147210 1:7073352-7073374 ATAGGAGCCTGGAGTTCAGAGGG + Intronic
901752627 1:11420727-11420749 GTGTAAGTCTGGAGTTCAGGAGG - Intergenic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902490753 1:16779036-16779058 CTCTGAGCCTGGAGTTGAGGGGG + Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
905913373 1:41669020-41669042 CTAAGAGTCTGGAGTTCCTGAGG - Intronic
905917973 1:41699053-41699075 CTGTGAGTTTTGGGTTCAGAAGG - Intronic
906842438 1:49153895-49153917 TTATGAATCTGGGGTTTAGAGGG - Intronic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907524147 1:55044257-55044279 CGAGGAGACTGAAGTTCAGAGGG + Intronic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
909835062 1:80243795-80243817 CTATGAGTCAGAAATTCAGCTGG + Intergenic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
911201714 1:95051122-95051144 CTATGAGTCTGAGGTTCAGAAGG - Intronic
912736185 1:112151500-112151522 GTATGGGTCTTGAGTTCAGAAGG + Intergenic
915481700 1:156190830-156190852 AAATAAGTCTGGAGTTTAGAAGG + Intergenic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
918391146 1:184064096-184064118 CTAACAGTCTGGAGCTGAGATGG + Intronic
920147494 1:203874622-203874644 CTATTAGTATGAAGTTTAGAAGG - Intergenic
920512672 1:206562511-206562533 CCACGAGTGTGGAGTTCGGACGG - Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
923026464 1:230208478-230208500 ATATGTGTCTGGTGTTCAGGAGG + Intronic
923529691 1:234803499-234803521 CTCTGAGCCTGGAGTTGAGGGGG - Intergenic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
1062891070 10:1060354-1060376 AAATGAGTCAGGAGTTCAGAAGG + Intronic
1063510187 10:6637210-6637232 CCATGAGTCAGGAGTCAAGAGGG + Intergenic
1065563321 10:26984978-26985000 CTATCACTGTGAAGTTCAGAGGG + Intergenic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071365181 10:84892084-84892106 CTATGATTTTGAAGTTCACAAGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1073038981 10:100586399-100586421 TTAGGAGACTGAAGTTCAGAGGG + Intergenic
1076075088 10:127527292-127527314 ATATGAGTCTGGAATTCAAAGGG + Intergenic
1077660012 11:4059395-4059417 CTGTGAGTCTTGTGTTGAGAAGG + Exonic
1078827437 11:14942605-14942627 TTATAAATCTGGAGCTCAGAGGG - Intronic
1080693995 11:34584911-34584933 ATATGAGTTGGGAGTGCAGAGGG + Intergenic
1081533078 11:43977611-43977633 TTATGATTTTAGAGTTCAGAAGG - Intergenic
1083817758 11:65146445-65146467 CTATGTGTCTGTTTTTCAGATGG - Intergenic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1090481919 11:127076566-127076588 ATAAGAGTCTGGAACTCAGAAGG + Intergenic
1091846493 12:3660028-3660050 CTATGAGCGTGGAGATCAGCGGG - Intronic
1092387212 12:8044957-8044979 CGGTGAGTCTGGAGTTGGGATGG + Exonic
1092404117 12:8204921-8204943 TTATAAGCCTGGAGTTCAAAAGG + Intergenic
1092846320 12:12588527-12588549 TTCTGACTCTGGAGTTTAGAGGG - Intergenic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1094015971 12:25864766-25864788 CTATCAGACTGGAGTTCGGGTGG - Intergenic
1096979985 12:55723049-55723071 CTAGGAGTTTGAAGTTCAGTGGG - Exonic
1097625239 12:61992157-61992179 TTATGTGTCTGGATTTCAGAAGG - Intronic
1098065735 12:66614249-66614271 TCCTGAGTCTGGAGTTCAGTGGG - Intronic
1098382865 12:69887155-69887177 CTATAAGTCTGGCTTTCTGAAGG - Intronic
1098723941 12:73938667-73938689 CCATCAGTGTGGAGTTCTGAGGG - Intergenic
1099289309 12:80755672-80755694 TTATGAGTCTAGAGTTCAGAGGG - Intergenic
1102998529 12:117367612-117367634 CTCTAAGCCTGGAGTTCTGATGG + Intronic
1104596516 12:130124081-130124103 CCATGGGTCTGGAATTCAGCAGG + Intergenic
1105026526 12:132852877-132852899 CTATGAGTCTGGAGTGAGCAGGG + Intronic
1107576051 13:41723794-41723816 ATATGAGTGTGAAGTTCAGGAGG + Intronic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1114032562 14:18589197-18589219 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1114032854 14:18590833-18590855 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1114077344 14:19168222-19168244 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1114077645 14:19169881-19169903 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1114084820 14:19231341-19231363 ACATGAGTCTGGGGTTCAGTTGG + Intergenic
1120004500 14:79341622-79341644 CTCTGAATTTGGAGTTCACATGG - Intronic
1120112752 14:80577325-80577347 ATTTGAGTCTGGAGCTCAGAAGG - Intronic
1121701314 14:95956486-95956508 CCATGAGCCAGGAGTTCAGTAGG + Intergenic
1122853797 14:104550328-104550350 CAAGAAGTCTGGAGTTCAGCAGG - Intronic
1124106320 15:26740953-26740975 CTCTGAGTCAGAATTTCAGATGG + Intronic
1125168163 15:36735986-36736008 CTAAGAGTTTGGTGTTAAGAAGG + Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1133659905 16:7906186-7906208 CTATCAGCCTGGAGACCAGAGGG - Intergenic
1134388215 16:13794045-13794067 CTATGAGGGTGGACTTCAGATGG + Intergenic
1134899849 16:17927596-17927618 CCATCAGTCTGGAGGGCAGAGGG + Intergenic
1136537342 16:30907787-30907809 CAATGAGCCTGGAGTTCAGAGGG - Intergenic
1137379517 16:47984325-47984347 CTATGAGTCAGGAAGTCTGATGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1138744355 16:59346030-59346052 CAAGGAGCCTGCAGTTCAGAAGG - Intergenic
1140105698 16:71958075-71958097 CTATGAGTCAAGAGTAAAGATGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145885921 17:28382422-28382444 TTTTGAGTCTGGAGTCAAGATGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1148988415 17:51644532-51644554 ATATGAGTCTGGATTTCAGGAGG - Intronic
1150211603 17:63445132-63445154 CCAGGAGGCTGGAGTGCAGAGGG - Intronic
1154423747 18:14256444-14256466 CTATGAGTCTGGGGTCTGGAGGG + Intergenic
1155549770 18:26952633-26952655 TAATGAGTCTGTAGTTCTGAGGG - Intronic
1156266411 18:35491957-35491979 CTAATAGACTGGAGTTCACAAGG + Intronic
1156855970 18:41781633-41781655 CCTTCTGTCTGGAGTTCAGAAGG - Intergenic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1161131002 19:2588662-2588684 CCCTGAGTCTGGAGTTCCCACGG - Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162622921 19:11858816-11858838 CTAGGAGTCAGGATTTCTGATGG - Intronic
1167157960 19:47750702-47750724 CGTTGAGTCTGGGGCTCAGAGGG + Intronic
925808859 2:7678695-7678717 ATATGAGCCTGTGGTTCAGAAGG + Intergenic
926901850 2:17760286-17760308 ATGTGAGTCTGGAGCTCAAAGGG - Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
930469385 2:51793611-51793633 CTACCATTCTGGAGTCCAGAGGG + Intergenic
930868805 2:56149452-56149474 TTATGTGTCTGGAGTTGAGTAGG + Intergenic
930880435 2:56264223-56264245 ATAAGAATCTGGAGTTCTGAAGG - Intronic
931387333 2:61809429-61809451 TTATGAGTCTGGAATTCAGAAGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
936613702 2:114027052-114027074 CTACAAGCCTGTAGTTCAGATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937670336 2:124531485-124531507 CTATGAGTCAGAACTACAGAGGG - Intronic
939463066 2:142522548-142522570 TGATGAGTCTGGAATTCAGAAGG - Intergenic
940467922 2:154056452-154056474 CTATGAGTCTGAAGTTATCATGG - Intronic
941889693 2:170566773-170566795 ATATAAATCTGGAGTTCAAACGG + Intronic
942535476 2:176958461-176958483 ACATGAGTCTGGAGTTCATAAGG + Intergenic
942799253 2:179857913-179857935 CTTTGAGGCTGGACTGCAGAGGG + Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947388452 2:229615865-229615887 CTAAGAGTCTGGGTTTCTGAGGG + Intronic
948498442 2:238371186-238371208 CTATGAGTCTGCACTTGAAAAGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948526932 2:238576550-238576572 ATCTGAGTTTGGAGTTCAGGAGG - Intergenic
1168975085 20:1958828-1958850 CAAGGTGTCTGGAGTTCACAGGG + Intergenic
1169647405 20:7827959-7827981 TTATGGGTCAGGAATTCAGAAGG - Intergenic
1169762211 20:9108188-9108210 TTAAGAGTCTGGAATTCAGATGG + Intronic
1171233571 20:23507189-23507211 ATATGATTCTGGAGTTCAGAAGG - Intergenic
1172086464 20:32387785-32387807 ATATGAGTCTGACGTTCAAAAGG - Intronic
1173352766 20:42260360-42260382 CTTTGAGCCTGGAGCTCAGGAGG + Intronic
1173932393 20:46831714-46831736 CTATGAGTTGGGGATTCAGAAGG + Intergenic
1175500580 20:59447467-59447489 CCATGAGTTGGGAGTTCGGATGG + Intergenic
1177961985 21:27678977-27678999 CTTTGATTCTGTAGTTCAGCTGG - Intergenic
1178740204 21:35192909-35192931 CAGTGACTTTGGAGTTCAGATGG + Intronic
1179247858 21:39649191-39649213 CCATGAGTCTAGAGTCCAGCAGG - Intronic
1179343143 21:40531465-40531487 CCATCAGTCTGCAGTGCAGAGGG - Intronic
1180293151 22:10861852-10861874 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1180456675 22:15516254-15516276 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1180456970 22:15517890-15517912 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1180495955 22:15891274-15891296 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1180588612 22:16915970-16915992 CCATGAGTCTGCAGTTGAAAAGG + Intergenic
1180741234 22:18054464-18054486 ATATGAGTCTGAAGCTCAGCTGG - Intergenic
1181548561 22:23620981-23621003 CTGTGAGGATGGAGTTCAGCGGG - Intronic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
953182259 3:40606919-40606941 ACATGAGTGTGGATTTCAGAAGG - Intergenic
953324535 3:42001798-42001820 ACATGAGTCTGGAGTTCAGAGGG + Intergenic
955147955 3:56338828-56338850 AAATGAGTCTGGACTTCAGGAGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
962566561 3:136666339-136666361 CCATAGGTCTGAAGTTCAGAGGG - Intronic
963827189 3:149969368-149969390 CTATGACTCTGCAGTTCTGATGG - Intronic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
965569944 3:170162276-170162298 ATATGAGTTTGGAGTTCATGTGG - Intronic
966641416 3:182194962-182194984 CTATTAGTCTGCATTTCATAAGG - Intergenic
967724939 3:192852907-192852929 TTAAGAATCTGGATTTCAGATGG - Intronic
969087134 4:4664839-4664861 CTTTGAGTCTTGATTTCTGAAGG + Intergenic
969761938 4:9192773-9192795 TTATAAGCCTGGAGTTCAAAAGG - Intergenic
970800885 4:19972331-19972353 GTATAGGTCTGGAGTTTAGAAGG - Intergenic
971642867 4:29157996-29158018 CCATGAGTCAGGAGTCCAGGTGG + Intergenic
973146681 4:46834259-46834281 CATTGATTCTGGAGTTCAGATGG + Intronic
973547148 4:51993320-51993342 ATGTGAGTCTGGAGCTTAGATGG + Intergenic
974201039 4:58640893-58640915 ATATATGTCTGGATTTCAGAAGG - Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
977597698 4:98901692-98901714 GTGTGAGTCTTGAGTTCAAAAGG - Intronic
978025645 4:103870213-103870235 CTATGTGTTTTGAGTTCATATGG + Intergenic
980854172 4:138419400-138419422 CCAGGAGGCTGGAGGTCAGAAGG - Intergenic
983071527 4:163273543-163273565 CTATGTGTTAGGAATTCAGATGG + Intergenic
984984566 4:185315256-185315278 ATCTGAGTCTGGAGTTCTGTGGG - Intronic
987121985 5:14776339-14776361 CTGTGAGTCTGGAGTCTGGAGGG + Intronic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
989415568 5:41171533-41171555 GTAGATGTCTGGAGTTCAGAAGG + Intronic
990118504 5:52419551-52419573 CTATGTGCCTGGAGCTCAGGAGG - Intergenic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
991323498 5:65403401-65403423 TGATGAGCCTGGATTTCAGAAGG - Intronic
993248956 5:85489948-85489970 CTATGACAATGGAGGTCAGAGGG + Intergenic
996315734 5:122158730-122158752 CTATGAGTCTGGAACTCAGAAGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
1000109467 5:158094097-158094119 ATATGAGTCTGAGGTTCAGGAGG - Intergenic
1001845875 5:174920962-174920984 CTATAAGTCCTGTGTTCAGAGGG - Intergenic
1002569275 5:180130809-180130831 ATATGACTCTGGAGATCAGAGGG - Intronic
1002616837 5:180461384-180461406 CTATGAGTCTGGGGAACAGATGG - Intergenic
1002968658 6:1992200-1992222 GTGTGAGTCTGGAGCTCAGCGGG - Intronic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1003992119 6:11496656-11496678 CTATGGGCCAGGAATTCAGAAGG + Intergenic
1005414256 6:25584551-25584573 CTTTGAGTCTGCATTTCTGAAGG - Intronic
1005758042 6:28943304-28943326 TCTTGAGTCTGGAGTTAAGAAGG + Intergenic
1006408940 6:33860914-33860936 CTATGGCTCTGGTCTTCAGAAGG - Intergenic
1008116050 6:47551673-47551695 CTGTGAGTCAAGAATTCAGATGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1012593714 6:101015713-101015735 CTGTGAGTTTGGTGTCCAGATGG - Intergenic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1013793785 6:113861135-113861157 CTACAAGTCTTGAGTTAAGAAGG + Exonic
1018737225 6:166696400-166696422 ATATTAGTCTGAAGCTCAGAAGG - Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021991546 7:26146141-26146163 CCATCAGTCAGAAGTTCAGAAGG + Intergenic
1022416157 7:30178883-30178905 CTCAGATTTTGGAGTTCAGAGGG - Intergenic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024019196 7:45349586-45349608 GTAAGAGCCTGGAGTTCAGCAGG + Intergenic
1025247937 7:57331606-57331628 CTTGGAGTCTGGAGTTAACATGG - Intergenic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1028547391 7:92018826-92018848 ATATGACTCTGCAGCTCAGAAGG - Intronic
1029356064 7:100052640-100052662 GTATGAGTCTGGAGGTCAGCAGG + Intronic
1029407474 7:100384325-100384347 CTCTGAGTCTAGAGTGCAGGGGG + Intronic
1030171409 7:106606638-106606660 ATAGGAGTCTGGAGTTCAGAGGG - Intergenic
1031467266 7:122127875-122127897 ATATGAGTCTGAAGCTCAGGAGG - Intronic
1033969023 7:147014790-147014812 CTATGAGTATGTATTACAGATGG - Intronic
1034055028 7:148025281-148025303 GTATGAGTCTTGGGTTCAGGTGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034866322 7:154645489-154645511 CTAGAAGTCTGGATTTCAGCAGG - Intronic
1035438187 7:158875042-158875064 CTAGGAGTCTGGGTTACAGAGGG - Intronic
1036272040 8:7314637-7314659 TTATAAGCCTGGAGTTCAAAAGG - Intergenic
1036349305 8:7995708-7995730 TTATAAGCCTGGAGTTCAAAAGG + Intergenic
1037123527 8:15317828-15317850 GTATGTGTCAGGATTTCAGAAGG + Intergenic
1037181692 8:16014465-16014487 CTAACAGTCTGAATTTCAGAGGG - Intergenic
1037259445 8:16991343-16991365 CAATGAGTCTGGGGTTCCTAAGG - Intergenic
1037613096 8:20493000-20493022 CTAAGAGATTGGTGTTCAGATGG - Intergenic
1041780107 8:61568578-61568600 ATATGAGTCTGAAGTTCAGGAGG + Intronic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1043987097 8:86706631-86706653 GTTTAAGTCTGGACTTCAGAGGG - Intronic
1046876570 8:119261175-119261197 ATACAAGTCTGGAGTTCAGATGG + Intergenic
1048034192 8:130661678-130661700 CTATGAGACTTGATTTCAGGAGG - Intergenic
1048053354 8:130840224-130840246 AAATGAGGCTGGGGTTCAGAAGG + Intronic
1048475844 8:134741697-134741719 GTATGAGTCTGGAGCTAAGAAGG - Intergenic
1050629608 9:7544754-7544776 CTAGGAGTTTGGTTTTCAGATGG + Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1052116317 9:24652081-24652103 CTATCAGTCTGTAGCTGAGAGGG + Intergenic
1053646027 9:40120108-40120130 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1053759689 9:41343432-41343454 ACATGAGTCTGGGGTTCAGTTGG + Intergenic
1054327039 9:63718005-63718027 ACATGAGTCTGGGGTTCAGTTGG - Intergenic
1054538543 9:66255868-66255890 ACATGAGTCTGGGGTTCAGTTGG + Intergenic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1061076918 9:128347272-128347294 TGATGAGCCTGGAGTTCAGAGGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1186695387 X:12025300-12025322 TCATGAGTCTGGAGCTTAGAGGG - Intergenic
1188543123 X:31271287-31271309 ATCTGAGTCTTGAGCTCAGAGGG + Intronic
1193745277 X:85271091-85271113 ATATGTTTCTTGAGTTCAGAAGG - Exonic
1195991150 X:110683737-110683759 GGATGAGCCTGGGGTTCAGATGG - Intronic
1196277139 X:113779747-113779769 CTATGATGCTGGAATTGAGAAGG + Intergenic
1198009146 X:132532833-132532855 TTAGTAGTCTGGAGTTCAAAGGG + Intergenic
1198874023 X:141203861-141203883 CTATCATTCTAGAGTCCAGAGGG + Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic