ID: 1071463510

View in Genome Browser
Species Human (GRCh38)
Location 10:85920059-85920081
Sequence CTCTGGAGAAGTCCCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071463510_1071463513 -3 Left 1071463510 10:85920059-85920081 CCCTACTGGGGACTTCTCCAGAG 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1071463513 10:85920079-85920101 GAGTGTGATCTCAGCTTTTCAGG No data
1071463510_1071463515 22 Left 1071463510 10:85920059-85920081 CCCTACTGGGGACTTCTCCAGAG 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1071463515 10:85920104-85920126 GGAGCCAAAATCACCTTGTTTGG No data
1071463510_1071463514 1 Left 1071463510 10:85920059-85920081 CCCTACTGGGGACTTCTCCAGAG 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1071463514 10:85920083-85920105 GTGATCTCAGCTTTTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071463510 Original CRISPR CTCTGGAGAAGTCCCCAGTA GGG (reversed) Intronic
900537821 1:3187483-3187505 CTCTGGAGAAGTCCCCAGCCAGG + Intronic
901635762 1:10669492-10669514 CTCGGGAGAAGGCCCCGTTATGG + Intronic
904050032 1:27633446-27633468 CTCTGCTGACCTCCCCAGTATGG + Intronic
904920426 1:34003670-34003692 CTCTGGACATGTCCCCACCAAGG - Intronic
905092275 1:35439083-35439105 CTCAAGAGAAGTCCTCAGCAGGG + Intronic
913090634 1:115474460-115474482 CTCTGCAGAAATTCCAAGTAAGG + Intergenic
914816777 1:151069311-151069333 ATCTAGAGAAGTCCCCAGGTGGG + Intronic
914907305 1:151757064-151757086 CTCTGCAGGATGCCCCAGTAGGG - Intergenic
915284555 1:154844505-154844527 CCATGGAGTAGTCCCCAGTGGGG + Intronic
917830274 1:178875784-178875806 CTCTGGGGAAGGAGCCAGTAGGG + Intronic
920031051 1:203037711-203037733 CACTGCAGAAGTCACCAGTGAGG - Intronic
922454306 1:225762544-225762566 CTCTGGATAAGACACCAGTGAGG + Intergenic
923962042 1:239096723-239096745 GTCTGGAAAGTTCCCCAGTATGG + Intergenic
924723111 1:246641948-246641970 CTGTGGAGAAGTCCCAGGAAAGG + Exonic
1068473845 10:57500216-57500238 CTCTTGAGAAATCCAGAGTATGG + Intergenic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1073040657 10:100602397-100602419 ACCTGCAGAAGTCCCCTGTACGG - Intergenic
1074624502 10:115165595-115165617 CTCTGGAGAGGTCCCCTTGATGG - Exonic
1074864693 10:117537813-117537835 CTCTGGGGAAGACGCCAGAAAGG + Intergenic
1076197594 10:128531048-128531070 CTCTGGAGAACTCCCCACTCTGG - Intergenic
1076857780 10:133126082-133126104 TTCTGGTGAAGTCCGCAGCACGG + Intronic
1078666717 11:13331890-13331912 CTCTGGAGAAGTCACCTGTTGGG + Intronic
1078836037 11:15030852-15030874 ATCAAGACAAGTCCCCAGTAGGG - Intronic
1079327115 11:19503505-19503527 CTCTGGAGAAGGCCAAACTATGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1085305343 11:75482568-75482590 ATCTGGAGGAGTCCCCAGCCAGG - Intronic
1087245671 11:95833494-95833516 TTCTGCAGAAGTCTCCAATATGG - Exonic
1090069607 11:123532195-123532217 CTCTGGAAAACTCTCCAGGAAGG + Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1096204015 12:49706814-49706836 CTTAGGAGAAGTCCCCAGTTCGG - Intronic
1097312439 12:58134997-58135019 CTTTGGAGAAATTCCAAGTATGG - Intergenic
1098972408 12:76870195-76870217 CTTTGGAGCAATCACCAGTAAGG + Intronic
1100173213 12:92000962-92000984 CTTTGGATAATTGCCCAGTAGGG - Intronic
1101719691 12:107340750-107340772 CTCTGGTGAATTTCCCAGGAGGG - Intronic
1102349711 12:112183545-112183567 CTCTGAGGAAGTCCCCATGAAGG + Intronic
1110713420 13:78674727-78674749 CTGTGGAGAAGTCTCCTTTAAGG + Intergenic
1111250612 13:85596421-85596443 CACTAGAGGAGTCCCAAGTAGGG + Intergenic
1113030026 13:105982887-105982909 CTCTGCAGCAGTCCTCAGTTCGG - Intergenic
1113579252 13:111417182-111417204 TTCTGGAGAAGTGCCCAATCCGG - Intergenic
1114233185 14:20802042-20802064 CTCTGGAGAAGTCTCTTGTCCGG - Exonic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1119378256 14:74212238-74212260 CTCTTGAGGAGCCCCCAGTCTGG - Intergenic
1125523277 15:40359707-40359729 CTCTGGAGAAGTCCAGAGAGGGG - Intronic
1127612574 15:60651347-60651369 CTCTGGAGAAGGTCTCAGTAAGG + Intronic
1130754144 15:86744955-86744977 CTCTCGAGAAGTACCTATTAGGG + Intronic
1131377249 15:91935689-91935711 CTCTTGAGGATTCCCCAGGAAGG - Intronic
1131384818 15:91995587-91995609 GTCTGCAGAAGTCCCTAGTGGGG + Intronic
1132196256 15:99916704-99916726 GCCTGGAGCAGTCCCCAGTCAGG + Intergenic
1134846517 16:17445461-17445483 CTCTCAAGAAGTCACCAGAAAGG + Intronic
1137667880 16:50262233-50262255 CTGAGGAGAAGTACCCAGCAGGG - Intronic
1141094471 16:81153318-81153340 CTCTGGAGCTGTCCCAAGTTGGG - Intergenic
1142608498 17:1095455-1095477 CTCTGGTGAAGTCCTGCGTATGG + Intronic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG + Intergenic
1145869999 17:28266206-28266228 CTCTGGTGAAGGCCCCAAGATGG + Intergenic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1151206321 17:72510377-72510399 CGCTGAAGAATTCCCCAGCATGG - Intergenic
1151579875 17:74971948-74971970 CCCTGGAGAGGTCCCCAGCTGGG + Intronic
1151822308 17:76502939-76502961 CTCTGCAGGAGTCCCCAGGAGGG + Intergenic
1152564967 17:81096289-81096311 CGCTGGAAAAGTCCCCAGGGAGG + Intronic
1152661498 17:81544409-81544431 TTCTGGAGCAGGCCCCAGTCTGG - Intronic
1156444475 18:37225015-37225037 CTCTAGAAAAGTCCCCATCATGG - Exonic
1160350603 18:78174976-78174998 CTCCTGAGAGGTGCCCAGTACGG - Intergenic
1163330504 19:16634253-16634275 CTCATGTGAAGTCCCCAGCATGG - Intronic
1163426412 19:17243279-17243301 CTCCTGAGAAGCCCCCAGTCTGG - Intronic
1163716760 19:18877448-18877470 CTCTGGAGAATTCCCGACTCAGG + Intronic
1163774867 19:19212149-19212171 CCAGGGAGAAGTCCCCAGAATGG + Intronic
1165350490 19:35272580-35272602 CTTGGAAGAAGTCCCCAGTGTGG + Intronic
1165595879 19:37011005-37011027 CTCTGGACAAGTCACCTGTTTGG + Intronic
1166031838 19:40137110-40137132 CTCCGGGGAAAGCCCCAGTAAGG + Intergenic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
929286557 2:40141517-40141539 CTTTGGAGAACTCCCCAGTGAGG + Intronic
937266858 2:120622030-120622052 CTCTGGAAAGGACCCCAATATGG + Intergenic
937593963 2:123650591-123650613 GTTTGCAGAAGTCCACAGTAAGG + Intergenic
941444783 2:165587400-165587422 CTCTGGAGTAGTACCCAGCCAGG + Intronic
943386733 2:187210766-187210788 GTGGTGAGAAGTCCCCAGTAGGG - Intergenic
943699555 2:190974829-190974851 CTCTGTAGAATTCGACAGTATGG - Exonic
1169041242 20:2497348-2497370 CTCTGGAGGACTCCACAGTTAGG + Intronic
1171051274 20:21861529-21861551 CTCTGGGTAGATCCCCAGTAGGG - Intergenic
1172653392 20:36521632-36521654 CTCAGGACAAGTCCTCAGCAGGG + Intronic
1173158049 20:40631530-40631552 CTCTGGGGAATTTCCCAGCAGGG + Intergenic
1180203948 21:46245375-46245397 CTCTGGAGACATGTCCAGTAGGG + Intronic
1183948371 22:41339294-41339316 CTCAGGAGGAGGCCTCAGTAGGG + Intronic
950663693 3:14482325-14482347 ATCCGGAGAAGACCCCAGCATGG - Intronic
952404317 3:32992081-32992103 CACTGAAGAAGTCCACACTAGGG + Intergenic
954001921 3:47564416-47564438 CTCTGGAGAAGCACCGAGTGAGG - Intronic
956488534 3:69747090-69747112 TCCTTGAGAAGTCCCCAGAAAGG - Intronic
956775379 3:72561042-72561064 CTCTGGAAAGTTCCCCAGGAAGG - Intergenic
961009360 3:123425604-123425626 CTCTAGAGCAGTCCCCAGAAGGG + Intronic
962379223 3:134883773-134883795 CTCTGTAGCAGTTCCCAGTGAGG + Intronic
964647577 3:158974496-158974518 CTCTGGAGTAGGCCCCAGAATGG - Intronic
969173778 4:5384208-5384230 CTACGGAGAAGTCCCGAGAAGGG + Intronic
969690959 4:8703945-8703967 CTGTGGGGAAGTCCCCAGTGAGG + Intergenic
971091208 4:23347700-23347722 CTCTGAAAAAGTCCACGGTACGG + Intergenic
976044586 4:80930229-80930251 ACATGTAGAAGTCCCCAGTAAGG + Intronic
976984435 4:91275136-91275158 CTCTGCCTAAGTGCCCAGTAGGG + Intronic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
979269731 4:118745803-118745825 CTCTGGAGCAGTGTGCAGTATGG - Intronic
981103852 4:140858525-140858547 CTTTTGAGAAGTCTTCAGTAAGG - Intergenic
981492892 4:145359550-145359572 CACTGGACAAGTTCCCATTAAGG + Intergenic
983202075 4:164872277-164872299 CTCTGGAGAAGACACCAAAATGG + Intergenic
983850229 4:172570922-172570944 CTCTTGAGCAGTTCACAGTAGGG + Intronic
985494769 5:198254-198276 CCCTGGACAAGGCTCCAGTAAGG - Exonic
985817290 5:2136216-2136238 CTCTGGAAATGTCACCAGAAGGG + Intergenic
986976401 5:13399452-13399474 CTTTGCAGATGTCCCCAGTTTGG - Intergenic
990206885 5:53439256-53439278 CTCTGCAGAGGTCCACAATAGGG + Intergenic
1001562586 5:172679009-172679031 CACTGCAGCAGTCCCCAGTCAGG - Intronic
1001682922 5:173571798-173571820 GTCTGGAGAAGTTCACAGTTGGG - Intergenic
1002924059 6:1594754-1594776 CTCTGGAGGAGCCCCCAGCCTGG + Intergenic
1003113604 6:3268580-3268602 CTCTGGAGAAGGCCCAAGACTGG - Intronic
1003285252 6:4728561-4728583 CTCTTCAGAGGTCCCCAGAAAGG + Intronic
1004525166 6:16400534-16400556 CACTGGAGAATTCCACAGTTGGG - Intronic
1007700285 6:43762388-43762410 CTCTCCAGGAGACCCCAGTAGGG + Intergenic
1018438771 6:163788878-163788900 CCTTGGAGTAGTCCCGAGTATGG + Intergenic
1019503866 7:1380736-1380758 CTCTTGAGAAGTGGCCAGGATGG + Intergenic
1021089722 7:16469068-16469090 CTATGGAGAAGTACACATTATGG - Intronic
1023905716 7:44520505-44520527 GTGTGGAGAACTCCCAAGTATGG + Intronic
1026734414 7:72940603-72940625 CTCTGGGAAAATCCCAAGTAGGG + Intronic
1026784746 7:73295511-73295533 CTCTGGGAAAATCCCAAGTAGGG + Intergenic
1027349485 7:77296098-77296120 CTCTGGATAAATTTCCAGTAGGG + Intronic
1027411375 7:77922649-77922671 CTCTGATGAAGTCTCCAGTGAGG + Exonic
1034829211 7:154294722-154294744 CTCTGGAGTTGTCCCCTGTCTGG - Intronic
1036796178 8:11758189-11758211 CTATGCAGATGTCCCCAGGATGG - Intronic
1039054616 8:33525691-33525713 GGCTGGAGAATTCCCCAGTGTGG - Intergenic
1041572192 8:59350232-59350254 CTCTCTAGAAGTTCCCAGTGTGG - Intergenic
1041967149 8:63691779-63691801 CCCTGGAGCAGTCCACAGGAAGG - Intergenic
1045418960 8:101995127-101995149 TTCTCAAGAAGTCCCCAGTCTGG - Intronic
1048808610 8:138264147-138264169 CTCTGGAGGAGAGCACAGTAAGG - Intronic
1048887013 8:138916806-138916828 CTCTGCAGAAGTCCCCTCTACGG + Intergenic
1050666780 9:7947005-7947027 CTGTTGAGAATTCTCCAGTATGG - Intergenic
1058683822 9:107463841-107463863 ATCTTGAGAAGTTACCAGTATGG + Intergenic
1060556731 9:124511796-124511818 CTTTGGGAAAGTCCCCAGTTAGG - Intergenic
1190599780 X:52078640-52078662 CCATGGAGAATTCCCCACTATGG + Intergenic
1197854022 X:130895449-130895471 GGATGGAGAAATCCCCAGTAAGG - Intronic