ID: 1071463621

View in Genome Browser
Species Human (GRCh38)
Location 10:85920753-85920775
Sequence CTGTGGGCGGGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071463605_1071463621 11 Left 1071463605 10:85920719-85920741 CCCGGTCAGACAAGCAAAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 176
Right 1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG No data
1071463606_1071463621 10 Left 1071463606 10:85920720-85920742 CCGGTCAGACAAGCAAAGGGCAG 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071463621 Original CRISPR CTGTGGGCGGGGAGGGAAGG GGG Intronic
No off target data available for this crispr