ID: 1071469648

View in Genome Browser
Species Human (GRCh38)
Location 10:85974670-85974692
Sequence CTGGTTGCAGAAAGTCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 751}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071469648_1071469651 1 Left 1071469648 10:85974670-85974692 CCCTCTTGACTTTCTGCAACCAG 0: 1
1: 0
2: 0
3: 30
4: 751
Right 1071469651 10:85974694-85974716 CAGTGCTCCACCACTTTTCATGG No data
1071469648_1071469653 8 Left 1071469648 10:85974670-85974692 CCCTCTTGACTTTCTGCAACCAG 0: 1
1: 0
2: 0
3: 30
4: 751
Right 1071469653 10:85974701-85974723 CCACCACTTTTCATGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071469648 Original CRISPR CTGGTTGCAGAAAGTCAAGA GGG (reversed) Intronic
901277218 1:8001647-8001669 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
902319776 1:15652938-15652960 GAGGTTGCAGTGAGTCAAGATGG + Intronic
902666032 1:17939150-17939172 GAGGTTGCAGCAAGCCAAGATGG - Intergenic
902913889 1:19624053-19624075 CCGGTTGCAGTGAGCCAAGATGG - Intronic
903359029 1:22765480-22765502 GAGGTTGCAGTAAGCCAAGATGG + Intronic
903410459 1:23138931-23138953 GAGGTTGCAGTGAGTCAAGATGG + Intronic
903464270 1:23541186-23541208 CTGGTTTAAGAAAGAAAAGAAGG - Intergenic
903529709 1:24020884-24020906 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
903630488 1:24765874-24765896 GAGGTTGCAGTAAGCCAAGATGG - Intronic
903684857 1:25123420-25123442 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
903812363 1:26041802-26041824 CTGGCTGCAGGAAGACAGGAAGG + Exonic
904159403 1:28511723-28511745 GAGGTTGCAGCAAGCCAAGATGG - Intronic
904669590 1:32153504-32153526 TAGGTTGCAGTGAGTCAAGATGG + Intronic
904712497 1:32441038-32441060 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
905575908 1:39044458-39044480 GAGGTTGCAGTCAGTCAAGATGG + Intergenic
905661976 1:39734734-39734756 GAGGTTGCAGTAAGCCAAGATGG - Intronic
906586294 1:46982043-46982065 CTGGGTGCAGCAAATCAACATGG + Intergenic
906973579 1:50545337-50545359 GAGGTTGCAGTAAGCCAAGATGG - Intronic
907057032 1:51379182-51379204 GAGGTTGCAGTAAGCCAAGATGG - Intronic
907337027 1:53706522-53706544 CTGGTTGCAGAAAATGCTGAAGG - Intronic
908063131 1:60372995-60373017 CTCATGGCAGAAAGTGAAGAGGG - Intergenic
908362430 1:63382264-63382286 GAGGTTGCAGTAAGTCGAGATGG - Intronic
908756653 1:67474739-67474761 GAGGTTGCAGAGAGGCAAGATGG + Intergenic
909388882 1:75094612-75094634 CTTGTTGCAGAAAGACTACAAGG - Intergenic
910086476 1:83409287-83409309 CAGTTTGGAGAAATTCAAGAAGG - Intergenic
910267841 1:85358582-85358604 GAGGTTGCAGCAAGCCAAGATGG + Intronic
911261351 1:95690116-95690138 GTGGTGGCAGAAAGAAAAGAAGG - Intergenic
911721572 1:101196768-101196790 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
912241678 1:107917082-107917104 CTGGGTGCAGAAAGTCATCATGG + Intronic
912843574 1:113060266-113060288 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
913035984 1:114966747-114966769 GAGGTTGCAGTGAGTCAAGATGG - Intronic
914365963 1:146978327-146978349 GAGGTTGCACCAAGTCAAGATGG - Intronic
914486480 1:148115098-148115120 GAGGTTGCACCAAGTCAAGATGG + Intronic
914771647 1:150691449-150691471 CAGGTTGCAGTGAGCCAAGATGG + Intronic
914835267 1:151201412-151201434 GAGGTTGCAGTAAGCCAAGATGG - Intronic
914981612 1:152419515-152419537 AGGGTTGCAGGAAGTCAAGAAGG - Intergenic
915129406 1:153686532-153686554 ATGGTTGCAGAAAGTGAATAAGG + Intronic
915280205 1:154817265-154817287 CTGGCAGCAGTAAGACAAGATGG + Intronic
915493488 1:156265157-156265179 TTGGTTGCAGTGAGCCAAGATGG + Intronic
915604690 1:156943123-156943145 CAGGTTGCAGTGAGCCAAGATGG - Intronic
916041349 1:160964199-160964221 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
916055514 1:161066578-161066600 GAGGTTGCAGTAAGCCAAGATGG + Intronic
917122867 1:171659632-171659654 GAGGTTGCAGAGAGCCAAGATGG + Intergenic
917667653 1:177240895-177240917 CAGTCTGCAGACAGTCAAGAAGG + Intronic
917744800 1:177996820-177996842 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
918102545 1:181388824-181388846 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
919231232 1:194777356-194777378 TTGGTTACAGAAAGCCAAGGAGG - Intergenic
919541063 1:198845946-198845968 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
920124022 1:203679387-203679409 CTGCTGGCACAAAGTCAAAAGGG - Intronic
920223235 1:204419814-204419836 GAGGTTGCAGTAAGTTAAGACGG - Intergenic
920735991 1:208533562-208533584 CTGGCTGCAGAAACTCAATGGGG + Intergenic
920775054 1:208927944-208927966 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
920789795 1:209079027-209079049 GTGGTTGGTCAAAGTCAAGAAGG - Intergenic
920921175 1:210298488-210298510 CTGGATGCAGGAAGCCAAAAAGG - Intergenic
921063671 1:211607775-211607797 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
921136567 1:212266068-212266090 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
921508200 1:216000211-216000233 CTGATTGCATAAAGACAAAATGG + Intronic
921622082 1:217336370-217336392 CTGGAAGAAAAAAGTCAAGAAGG + Intergenic
921986824 1:221321562-221321584 AAGGTTGCAGTGAGTCAAGATGG - Intergenic
922997338 1:229974684-229974706 TTGGTTGGATAAAGTCAGGATGG + Intergenic
923611595 1:235500413-235500435 GAGGTTGCAGTTAGTCAAGATGG + Intronic
923619059 1:235562578-235562600 GAGGTTGCAGAGAGCCAAGATGG + Intronic
924053619 1:240102927-240102949 GAGGTTGCAGTAAGCCAAGATGG - Intronic
924513819 1:244750102-244750124 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
924790708 1:247245172-247245194 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1062990090 10:1806966-1806988 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1063599188 10:7464605-7464627 CTGGTTGCATAAAGTTAAACAGG - Intergenic
1063616873 10:7607893-7607915 CTGGCTCCAGAAAGCCAAAAAGG + Intronic
1064239425 10:13612335-13612357 GTGGTTGCAGCAAGCCGAGATGG - Intronic
1064594443 10:16928973-16928995 CTGATTGCTGAAGGTCAAGTAGG + Intronic
1065000582 10:21334318-21334340 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1065523356 10:26593494-26593516 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1065529278 10:26652609-26652631 GAGGTTGCAGAGAGCCAAGATGG + Intergenic
1065586373 10:27221851-27221873 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1065724716 10:28658446-28658468 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1065884732 10:30066930-30066952 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1067719191 10:48714157-48714179 CTGGTAGCAGAATGTCACCAGGG + Intronic
1068608272 10:59030291-59030313 ATTGTTGCACAAAGTCAAGTAGG + Intergenic
1069231381 10:66012963-66012985 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1069465774 10:68637588-68637610 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1069465809 10:68637802-68637824 ATGGTTGCAGTGAGCCAAGATGG + Intronic
1069681809 10:70290946-70290968 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1069932934 10:71895215-71895237 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1070253811 10:74796919-74796941 CAGGTTGCAGTAAGCCGAGATGG - Intergenic
1070281985 10:75056600-75056622 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1070502912 10:77088492-77088514 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1070910226 10:80111492-80111514 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1071224576 10:83513341-83513363 GTGGTTGCAGTAAGCCAAGATGG + Intergenic
1071469648 10:85974670-85974692 CTGGTTGCAGAAAGTCAAGAGGG - Intronic
1071581745 10:86777946-86777968 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1071675793 10:87654905-87654927 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1072064087 10:91848518-91848540 CTGGCTGCAGAAAGGCTTGATGG - Exonic
1072206966 10:93213324-93213346 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1072431130 10:95371428-95371450 CTGGTTCAAGAAAGAAAAGATGG + Intronic
1072868818 10:99094619-99094641 GAGGTTGCAGAGAGCCAAGATGG - Intronic
1073285899 10:102387905-102387927 CAGGTTGCAGTAAGCCGAGATGG + Intergenic
1073735322 10:106338201-106338223 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1073833660 10:107415840-107415862 CTGGTTGAAAAAAGACAATAAGG + Intergenic
1074599292 10:114897394-114897416 CTTTCTGCAGAAAGTCAAAATGG + Intronic
1075244882 10:120812008-120812030 CTGGAGGCAGAAAGGCAAAAAGG - Intergenic
1075329533 10:121563307-121563329 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1075789339 10:125072213-125072235 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1075830337 10:125405176-125405198 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1075922542 10:126225110-126225132 CTGGTGGCAGAAGGGCAAGAAGG + Intronic
1077072354 11:681297-681319 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1077080285 11:721955-721977 CTGCTTCCAGAAAATCAAGCTGG + Exonic
1077398830 11:2342466-2342488 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1077586815 11:3460140-3460162 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1078217254 11:9321919-9321941 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1078299860 11:10117374-10117396 GGGGTTGCAGTGAGTCAAGATGG + Intronic
1078764049 11:14276521-14276543 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1079574064 11:21981132-21981154 CTTGTTTCAGAAATCCAAGATGG - Intergenic
1079758620 11:24299481-24299503 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1080310462 11:30884827-30884849 CTAGTTGCAGAAATTGAATAAGG + Intronic
1080724431 11:34881324-34881346 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1080910091 11:36588062-36588084 GAGGTTGCAGAAAGCCATGATGG + Intronic
1081717398 11:45260116-45260138 CTGGATGCAGAGATTCAAGAGGG - Intronic
1082173261 11:49031757-49031779 CTGAATGCACAAAGTCAACAGGG + Exonic
1082937616 11:58670678-58670700 CTGGTTGCAAAAAGCAGAGAGGG - Intronic
1083034159 11:59621092-59621114 CTGGTTGCAGTGAGCCGAGATGG - Intergenic
1083424900 11:62578478-62578500 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1083511254 11:63211123-63211145 CTGTTTGCAGCAAGTCCAGGGGG - Intronic
1084242814 11:67834171-67834193 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1084298430 11:68228368-68228390 GGGGTTGCAGTGAGTCAAGATGG - Intergenic
1084830185 11:71762808-71762830 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1085128752 11:74019739-74019761 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1085663362 11:78390522-78390544 GAGGTTGCAGCAAGTCAAGATGG + Intronic
1085885182 11:80513384-80513406 GTGGTTGCAGTGAGTCAAGATGG - Intergenic
1085897428 11:80656692-80656714 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1086943479 11:92821853-92821875 CTGGTTGCAGACACTGTAGAAGG - Intronic
1087265862 11:96060036-96060058 TTGGTTGAATAAAGCCAAGAGGG + Intronic
1087790265 11:102399090-102399112 ATGATTGCAGCAAGACAAGATGG - Intronic
1087792475 11:102420980-102421002 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1088314401 11:108492895-108492917 ATGGTTTCAGAAAGGCAACATGG + Intronic
1088457566 11:110048981-110049003 GAGGTTGCAGCAAGTCAAGATGG + Intergenic
1088950489 11:114564687-114564709 TTGGTTGGAGAAAGCCATGAGGG + Intergenic
1089018020 11:115182919-115182941 CTGCTTGCAGAATGTTAAGTTGG + Intronic
1089280017 11:117367313-117367335 GTGGTTGCAGTTAGTCAACATGG + Intronic
1089518038 11:119046024-119046046 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1092000889 12:5031250-5031272 CTGGTTGCAAAATATCAAGATGG + Intergenic
1092097914 12:5859598-5859620 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1092413054 12:8268872-8268894 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1092459380 12:8672944-8672966 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1092694982 12:11161520-11161542 GTGGTTGATGAAAGTCAAAACGG + Intronic
1092799098 12:12145694-12145716 GTGGTTGCAGTGAGTCAAGACGG - Intronic
1092814394 12:12300489-12300511 GAGGTTGCAGTAAGGCAAGATGG - Intergenic
1093139383 12:15489962-15489984 ATGACTGCAGAAAGTTAAGATGG + Intronic
1093390800 12:18618162-18618184 CTAGTTGCAGAGAAGCAAGATGG + Intronic
1093572009 12:20677522-20677544 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1094588805 12:31801743-31801765 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1094684687 12:32699727-32699749 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1095271071 12:40220292-40220314 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1095353006 12:41237032-41237054 CAGATTGCAAAAAGGCAAGAAGG + Intronic
1095485974 12:42685081-42685103 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1096120538 12:49086510-49086532 CTGCTTGAAGAAAGGAAAGAAGG + Intergenic
1096273521 12:50185964-50185986 CTAGTTTCATAAAGACAAGAGGG + Intronic
1096316092 12:50567590-50567612 AAGGTTGCAGTAAGCCAAGATGG - Intronic
1096646312 12:53038750-53038772 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1097151068 12:56980295-56980317 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1097919760 12:65058985-65059007 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1098207301 12:68125281-68125303 CAAGTTGCAGAAGTTCAAGAAGG - Intergenic
1098268446 12:68746724-68746746 CTGGTAGCAGAAGGTCTGGATGG - Exonic
1099298163 12:80857099-80857121 ATGGATGCAGAAAGAGAAGAAGG - Intronic
1099406693 12:82272453-82272475 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1099417159 12:82404877-82404899 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1099600142 12:84725148-84725170 GAGGTTGCAGGGAGTCAAGATGG - Intergenic
1099793471 12:87364708-87364730 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
1100826336 12:98478155-98478177 CTGGTTTAAAAAAGCCAAGAAGG - Intergenic
1100831959 12:98524506-98524528 AAGGTTGCAGCAAGGCAAGATGG + Intronic
1101013783 12:100478149-100478171 CTGGTTGTTGAAAGTAAAGGAGG + Intronic
1101166114 12:102035621-102035643 CAGGTAGCACAAAGTGAAGAAGG + Intronic
1101845647 12:108361128-108361150 GTGATGGCAGAAATTCAAGAGGG + Intergenic
1102007852 12:109599927-109599949 GAGGTTGCAGAGAGCCAAGATGG - Intergenic
1102039460 12:109791545-109791567 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1102857307 12:116305585-116305607 GAGGTTGCAGTAAGCCAAGAGGG - Intergenic
1102860345 12:116330744-116330766 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1102868068 12:116389927-116389949 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1103173232 12:118840294-118840316 CTGGTCTGAGAAAGTCAAGAGGG + Intergenic
1103482156 12:121257675-121257697 CTGGTTGATGAAACTGAAGATGG - Intronic
1103830784 12:123777370-123777392 CTTGCTGCTGGAAGTCAAGAAGG + Intronic
1104414225 12:128584710-128584732 CTGGGTCCAGAAAGTCCACATGG + Intronic
1104439153 12:128781023-128781045 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105676086 13:22673221-22673243 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1105915173 13:24908526-24908548 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1105950748 13:25227747-25227769 AGGGATACAGAAAGTCAAGAGGG - Intergenic
1106120627 13:26857405-26857427 CTGGTTTAAGAATGTCAACATGG - Intergenic
1106129112 13:26924961-26924983 GGGGTTGCAGTTAGTCAAGATGG + Intergenic
1106610235 13:31272278-31272300 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1106757731 13:32839508-32839530 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1106781600 13:33063710-33063732 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1106999610 13:35527525-35527547 CTGGGTGCCCAAAGTCCAGACGG + Intronic
1107526472 13:41237152-41237174 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1108756992 13:53515080-53515102 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1109033542 13:57225082-57225104 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1109331552 13:60937049-60937071 ATGGTTTCAGAAAGTCCAGAGGG - Intergenic
1110246060 13:73325978-73326000 ATGGGTGCAGAAAGTCAGCATGG - Intergenic
1110763723 13:79258632-79258654 CAGGTTGCACAATGTCAAGCTGG - Intergenic
1112385163 13:98932328-98932350 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1113237695 13:108298904-108298926 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1114006409 14:18318747-18318769 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1115030417 14:28786836-28786858 TTGGTTGCAGTATGCCAAGATGG - Intronic
1115314088 14:32008275-32008297 GGGGTTGCAGACAGTCAGGAGGG - Intronic
1115563196 14:34601657-34601679 GAGGTTGCAGAGAGCCAAGATGG - Intronic
1116816458 14:49588590-49588612 CAGGTTGCAGTTAGCCAAGATGG - Intronic
1117214597 14:53537523-53537545 CTGGTTTCTGCAAGTCTAGATGG + Intergenic
1117522444 14:56564381-56564403 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1117877032 14:60263151-60263173 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1117898278 14:60509412-60509434 CTGGGGGCTGAAATTCAAGATGG - Exonic
1118110849 14:62717890-62717912 CTGGTTGCATAAAGTAAAGGTGG + Intronic
1118268154 14:64315537-64315559 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1118461322 14:65989680-65989702 CTGGTTGCAGTGAGCCGAGATGG + Exonic
1118617653 14:67585802-67585824 CTGCTTGTAGATATTCAAGATGG + Intronic
1119235365 14:73015164-73015186 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1119422788 14:74517416-74517438 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1119508221 14:75191028-75191050 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1119557438 14:75564596-75564618 GAGGTTGCAGTAAGCCAAGACGG - Intergenic
1119714090 14:76845951-76845973 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1120218795 14:81709644-81709666 CTGTCTGCAGAAAGTCAATGGGG - Intergenic
1121342264 14:93112502-93112524 GAGGTTGCAGTAAGTCGAGATGG - Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122441996 14:101738175-101738197 CTCGTTTCAGGAAGTCAACAAGG - Intergenic
1122479208 14:102035163-102035185 GAGGTTGCAGCAAGCCAAGATGG + Intronic
1122532866 14:102441127-102441149 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1122621637 14:103061052-103061074 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1122739696 14:103864920-103864942 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1123101548 14:105805456-105805478 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1123390333 15:19865396-19865418 GGGGTTGCAGTGAGTCAAGATGG - Intergenic
1124036721 15:26060039-26060061 GTGGTTGCTAAAAGTTAAGATGG - Intergenic
1124122038 15:26895746-26895768 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1124261611 15:28197684-28197706 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1124433544 15:29628812-29628834 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1124940972 15:34217488-34217510 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1125829694 15:42705496-42705518 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1125912032 15:43449060-43449082 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1125995291 15:44153901-44153923 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1126551417 15:49934708-49934730 CTGGTTGTAGAAAGACAATATGG - Intronic
1126752391 15:51890231-51890253 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1126791657 15:52227083-52227105 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1127115986 15:55727729-55727751 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1127160731 15:56182066-56182088 CTAGTTGCAGAAAAACAAGCAGG + Intronic
1127265612 15:57358998-57359020 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1127734150 15:61826778-61826800 CAGGTGGGAGAAAGTCAGGAAGG + Intergenic
1128730834 15:70019725-70019747 CAGGCTGCAGTAAGTCAAGCTGG - Intergenic
1128952887 15:71905696-71905718 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1130080893 15:80732594-80732616 CTGGTTGCAGAATGGAAAGTAGG + Intronic
1130317933 15:82812291-82812313 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1130389626 15:83444257-83444279 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1130839961 15:87689111-87689133 GTGGTTGCAGAATGTGGAGATGG - Intergenic
1131845273 15:96484520-96484542 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1132510115 16:336168-336190 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1132680232 16:1137393-1137415 CAGGTTGCAGTCAGCCAAGATGG + Intergenic
1132719062 16:1307092-1307114 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1133830642 16:9320367-9320389 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1134138219 16:11694510-11694532 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1134203886 16:12221547-12221569 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1134492481 16:14705300-14705322 GAGGTTGCAGAGAGCCAAGATGG + Intergenic
1134497862 16:14744422-14744444 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1135195095 16:20387683-20387705 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1136087286 16:27894635-27894657 CTGTTTGCAAAATGTCAATATGG + Intronic
1136285982 16:29242450-29242472 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1136319701 16:29475927-29475949 GAGGTTGCAGAGAGCCAAGATGG - Intergenic
1136434272 16:30215272-30215294 GAGGTTGCAGAGAGCCAAGATGG - Intergenic
1136507872 16:30717675-30717697 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1136565478 16:31067153-31067175 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1136706232 16:32190070-32190092 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1136761678 16:32739335-32739357 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1136806422 16:33131054-33131076 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1137656793 16:50166670-50166692 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1137980943 16:53069067-53069089 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1138073832 16:54020904-54020926 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1138133502 16:54501771-54501793 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1138165250 16:54795478-54795500 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1138498792 16:57425664-57425686 GAGGTTGCAGTAAGGCAAGATGG - Intergenic
1138524684 16:57596221-57596243 GAGGTTGCAGTAAGTCAAGATGG - Intergenic
1139252861 16:65512838-65512860 CTGGGTGCAGAAGGTGAAAAGGG - Intergenic
1139667091 16:68464890-68464912 ATGGTTGCAAAAAGTAAATATGG + Intergenic
1139929470 16:70514143-70514165 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1140599227 16:76455444-76455466 CTGGGTGCAGCAAATCAAGGGGG - Intronic
1140799287 16:78470592-78470614 GAGGTTTCAGTAAGTCAAGATGG - Intronic
1140843779 16:78867028-78867050 CTCCTTCCACAAAGTCAAGAAGG - Intronic
1140845759 16:78885987-78886009 GAGGTTGCAGCAAGCCAAGATGG - Intronic
1140974846 16:80049901-80049923 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1141580767 16:84996959-84996981 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1142091320 16:88212643-88212665 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1142397744 16:89842275-89842297 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1203063835 16_KI270728v1_random:999649-999671 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1144210210 17:13008133-13008155 GAGGTTGCAGTAAGTCGAGATGG + Intronic
1144431602 17:15197497-15197519 TTGTTTACAGAGAGTCAAGAAGG - Intergenic
1144867047 17:18342869-18342891 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1146014678 17:29223367-29223389 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1146488531 17:33263172-33263194 CTGGTTGCATAAAGACAAGCCGG + Intronic
1146542334 17:33708098-33708120 CTGGTTGCCTAAGGTAAAGAAGG + Intronic
1146702470 17:34973274-34973296 GTGGTTGCAGTGAGTCGAGATGG + Intronic
1146774853 17:35604691-35604713 GTGGTTGCAGGAAGCAAAGATGG + Intronic
1147409313 17:40237999-40238021 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1147943725 17:44068279-44068301 CGGGTTGCAGTGAGCCAAGATGG - Intergenic
1148680701 17:49471963-49471985 CTGATGGCTGAAAGCCAAGAAGG - Intronic
1148898955 17:50860499-50860521 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1149228792 17:54507612-54507634 CTGGTTGTAAAAGGTTAAGATGG - Intergenic
1149413978 17:56439007-56439029 ATGGTTGCACAAAGTAAGGAAGG + Intronic
1149767715 17:59293471-59293493 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1149789652 17:59465921-59465943 CTGGGTTGAGAAATTCAAGAAGG + Intergenic
1150144802 17:62759541-62759563 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1150260674 17:63787774-63787796 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1150425224 17:65072275-65072297 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1150899293 17:69252770-69252792 GAGGTTGCAGTAAGCCAAGACGG + Intronic
1151272773 17:73009645-73009667 TTGGTTGCAGAAAATTATGAAGG + Intronic
1153087757 18:1307924-1307946 CTGATGGCAGAAGGTGAAGAAGG + Intergenic
1153202364 18:2659180-2659202 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1153519637 18:5939710-5939732 CTGTTTGCAGAAAGCCTAGCGGG + Intergenic
1153890037 18:9504891-9504913 GAGGTTGCAGCAAGCCAAGATGG - Intronic
1154952060 18:21219942-21219964 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1155197500 18:23488673-23488695 GTGGTTGCAGTGAGTCAAGATGG + Intergenic
1155768550 18:29669114-29669136 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
1155878595 18:31116680-31116702 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1155947156 18:31867812-31867834 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1156617860 18:38809268-38809290 CACATTGTAGAAAGTCAAGAGGG - Intergenic
1157812909 18:50710416-50710438 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1157914121 18:51647862-51647884 GAGGTTGAAGAAAGTCAAGGGGG - Intergenic
1158454871 18:57597262-57597284 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1159149915 18:64507695-64507717 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1161034336 19:2076056-2076078 GGGGTTGCAGTAAGCCAAGATGG + Intronic
1161035473 19:2082119-2082141 CTGGTGGCAGGAAGTGACGATGG - Intronic
1161104912 19:2438525-2438547 CTTGGCGCTGAAAGTCAAGAGGG + Exonic
1161159106 19:2751871-2751893 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1161987493 19:7664529-7664551 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1162124646 19:8492930-8492952 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1162893443 19:13750290-13750312 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1163366871 19:16880388-16880410 CTGGTGGCAGGAAGTCAGCAAGG - Intergenic
1164570368 19:29370237-29370259 GAGGTTGCAGTAAGACAAGATGG + Intergenic
1164705392 19:30315484-30315506 CTGGTTTGAGAAGGTCAACAGGG + Intronic
1165110937 19:33501610-33501632 GAGGTTGCAGGGAGTCAAGATGG + Intronic
1165876714 19:39012893-39012915 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1165905691 19:39193327-39193349 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1166159270 19:40939590-40939612 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1166168203 19:41007520-41007542 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1166562448 19:43742081-43742103 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1166662560 19:44656906-44656928 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1166850924 19:45760539-45760561 GGGGTTGCAGTAAGCCAAGATGG + Intronic
1166877988 19:45909647-45909669 CAGGTTGCAGTGAGCCAAGAAGG - Intergenic
1167283020 19:48581967-48581989 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1167304579 19:48700086-48700108 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1167932290 19:52875713-52875735 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1168058297 19:53875783-53875805 GAGGTTGCAGTAAGTCAAGATGG + Exonic
1168070319 19:53946657-53946679 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1168215706 19:54924030-54924052 GAGGTTGCAGAGAGCCAAGATGG - Intronic
924998782 2:387068-387090 CTGTTTGGAGAAAGTGAAGGGGG - Intergenic
925179177 2:1805819-1805841 GAGGTTGCAGTAAGCCAAGATGG + Intronic
925678867 2:6395879-6395901 CTGGTTGCAGAAACTCATCCTGG + Intergenic
926106353 2:10154433-10154455 GAGGTTGCAGTGAGTCAAGATGG + Intronic
926503470 2:13682440-13682462 CTTTTTGCAGAAAGTAAAAATGG + Intergenic
926831626 2:16968949-16968971 CTGGTTGCAAAAAATACAGAGGG - Intergenic
927576971 2:24208291-24208313 CTGGGTGCAGAAGATCAAGGCGG - Exonic
927776262 2:25906140-25906162 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
927801961 2:26108974-26108996 CAGGTTGCAGTGAGCCAAGATGG - Intronic
928057448 2:28072235-28072257 AAGGTTGCAGTAAGCCAAGATGG - Intronic
928112878 2:28524910-28524932 GAGGTTGCAGCAAGCCAAGATGG - Intronic
928261689 2:29773419-29773441 CTGGTAGCAACAAGTAAAGAGGG - Intronic
928301260 2:30127317-30127339 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
928491528 2:31788797-31788819 CCGGTTTCAGATAGTTAAGAGGG - Intergenic
928931660 2:36631389-36631411 CTTTCTGCAGAAAGTAAAGATGG + Intronic
929245594 2:39699088-39699110 GAGGTTGCAGTAAGCCAAGATGG - Intronic
929499091 2:42474461-42474483 CAGGTTGCAGTGAGCCAAGATGG + Intronic
930750964 2:54933665-54933687 GAGGTTGCAGCAAGCCAAGATGG + Intronic
933489635 2:82969621-82969643 CAGGTTGCAGAGAGCCAAAATGG - Intergenic
934883434 2:98004131-98004153 CTTGTAGCAGAAAGAAAAGAGGG + Intergenic
934915025 2:98294568-98294590 CTGGATGCCGAAAGGCAAGGAGG + Intronic
935625132 2:105166200-105166222 AAGGTTGCAGTAAGCCAAGATGG - Intergenic
935670088 2:105547851-105547873 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
936381308 2:111988882-111988904 GAGGTTGCAGTAAGCCAAGATGG + Intronic
936408366 2:112229504-112229526 GTGTTGGCAGAAACTCAAGAGGG - Intronic
936644384 2:114351794-114351816 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
937036188 2:118784617-118784639 TTGGTAGCAGAAAGTCATAAGGG + Intergenic
937057121 2:118948170-118948192 CTTTCTGCAGAAAGTAAAGATGG - Intronic
937057650 2:118952925-118952947 CTTTCTGCAGAAAGTAAAGATGG - Intronic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
937409049 2:121656950-121656972 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
937756388 2:125543701-125543723 GAGGTTGCAGACAGCCAAGATGG + Intergenic
938158496 2:128961354-128961376 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
938530156 2:132176724-132176746 GGGGTTGCAGTGAGTCAAGATGG + Intronic
939342476 2:140916192-140916214 CTGGTTCCAGAAAGAAAAAAAGG + Intronic
939734379 2:145825908-145825930 AAGGTTGCAGAAAGCGAAGATGG - Intergenic
939781875 2:146459217-146459239 CTGGCTGCAGAAATTTAAGCTGG - Intergenic
940269307 2:151874042-151874064 CTGGTAGCAGAAGGCCAAGCGGG - Intronic
940283120 2:152007834-152007856 GAGGTTGCAGTAAGCCAAGATGG - Intronic
940385504 2:153066529-153066551 TTGGTTTGAGAAAGACAAGACGG + Intergenic
940775574 2:157879917-157879939 GAGGTTGCAGTAAGCCAAGATGG + Intronic
941957506 2:171219663-171219685 GAGGTTGCAGGAAGCCAAGATGG - Intronic
942054686 2:172171733-172171755 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
942440534 2:176030646-176030668 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
942553969 2:177152036-177152058 CAGGTGGTAGAAAGCCAAGAAGG - Intergenic
942671692 2:178382961-178382983 CTGATTTCACAAAATCAAGAAGG - Intronic
942750917 2:179286164-179286186 ATGGTTGCAGTGAGCCAAGATGG + Intergenic
942793777 2:179792437-179792459 GTGGTTGCAGTGAGCCAAGATGG - Intronic
943056092 2:182981842-182981864 GAGGTTGCAGTAAGGCAAGATGG + Intronic
943356039 2:186857097-186857119 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
943723279 2:191227686-191227708 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
945261378 2:207846656-207846678 GAGGTTGCAGAAAGCCAAGATGG + Intronic
945471220 2:210229689-210229711 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
945961278 2:216137575-216137597 TTGGTTCCAATAAGTCAAGAAGG - Intronic
946170424 2:217892160-217892182 GAGGTTGCAGTAAGCCAAGATGG - Intronic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946383420 2:219365224-219365246 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
946494822 2:220185500-220185522 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
946836937 2:223782074-223782096 GAGGTTGCAGTAAGCCAAGATGG - Intronic
947044469 2:225965232-225965254 CTGATTGAAGAAAATAAAGATGG + Intergenic
947145625 2:227061422-227061444 GTGATTGCAGAAATGCAAGAGGG - Intronic
947187209 2:227466149-227466171 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
947306435 2:228753501-228753523 CTGGTGGCAGAAACACAACAAGG + Intergenic
947576988 2:231283492-231283514 GAGGTTGCAGTGAGTCAAGATGG - Intronic
947660899 2:231867015-231867037 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
947786049 2:232821265-232821287 GAGGCTGCAGTAAGTCAAGATGG - Intronic
948432441 2:237928443-237928465 CAGGTTGCAGCGAGCCAAGACGG - Intergenic
948710519 2:239822234-239822256 GGGGTTGCAGGAAGGCAAGAAGG + Intergenic
948811578 2:240481070-240481092 CTGGTAGCAGAACTTGAAGAAGG + Exonic
949057119 2:241934110-241934132 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1169193709 20:3672627-3672649 CTGGGACCAGAAAGGCAAGAAGG + Intronic
1169242093 20:3991314-3991336 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1169478819 20:5958302-5958324 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1170537101 20:17350973-17350995 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1170631220 20:18067623-18067645 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1171145806 20:22781513-22781535 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1171955660 20:31461252-31461274 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1172472071 20:35206408-35206430 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1172550486 20:35795298-35795320 AAGGTTGCAGTAAGCCAAGATGG - Intronic
1173020364 20:39262086-39262108 CTGGTAGCAAGAATTCAAGAAGG - Intergenic
1173599289 20:44281293-44281315 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1173786932 20:45800927-45800949 GAGGTTGCAGAGAGCCAAGATGG + Intronic
1174009129 20:47435346-47435368 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1174251399 20:49222372-49222394 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1174578888 20:51556913-51556935 CGTGGTGCAGAAAGTCAAGCAGG + Intronic
1174609438 20:51787028-51787050 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1175387580 20:58607067-58607089 CTTGGTGCCTAAAGTCAAGAGGG - Intergenic
1175614914 20:60389794-60389816 CTTGTTGCAGAAAGTCACATAGG - Intergenic
1175700422 20:61132888-61132910 CGAATTGCAGAAAATCAAGAGGG + Intergenic
1176002503 20:62839165-62839187 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1176051823 20:63123943-63123965 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1176424067 21:6537019-6537041 AAGGCTGCAGTAAGTCAAGATGG - Intergenic
1176766344 21:13023020-13023042 GGGGTTGCAGTGAGTCAAGATGG - Intergenic
1177101711 21:16906025-16906047 CTAGTTGAAAAAAATCAAGAAGG + Intergenic
1177288830 21:19084191-19084213 CTGATTGCAGAGAGCCGAGATGG + Intergenic
1178073936 21:28998525-28998547 CTGGACTCAGGAAGTCAAGAAGG + Intergenic
1178222346 21:30674727-30674749 TGGGCTGCAGAAAGGCAAGAAGG + Intergenic
1178518561 21:33268130-33268152 CTGGTGGCAGAAAGCTATGAGGG - Intronic
1178892171 21:36529351-36529373 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1179235489 21:39541786-39541808 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1179560837 21:42215200-42215222 CTGGTTGCAGAAACTCACCAGGG + Intronic
1179699560 21:43145334-43145356 AAGGCTGCAGTAAGTCAAGATGG - Intergenic
1180152206 21:45955269-45955291 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1180430916 22:15249557-15249579 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1181794700 22:25297749-25297771 CTGGTAGAAAAAAGTCAAGGAGG + Intergenic
1181834685 22:25594304-25594326 CTGGTAGAAAAAAGTCAAGGAGG + Intronic
1181852256 22:25758076-25758098 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1182039295 22:27224027-27224049 CTGGTTGGAGTAAGGCAGGAGGG + Intergenic
1182379841 22:29879211-29879233 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1182434700 22:30322963-30322985 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1182611015 22:31547682-31547704 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1182955204 22:34417896-34417918 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1183392755 22:37554931-37554953 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1184112560 22:42403897-42403919 CTGGATCCAGAAAGCAAAGAAGG + Intronic
1184500250 22:44867216-44867238 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1184602299 22:45550787-45550809 CTGGTCTCGGAAAGTCAAGGGGG + Intronic
1184860590 22:47171361-47171383 CTGGATCCAGGAAGTCAGGAAGG - Intronic
949256865 3:2058820-2058842 CTTGTTTCAGAAAGAAAAGAGGG - Intergenic
949404417 3:3699322-3699344 CTGGTTGCAGTGAGCCGAGATGG + Intergenic
949683765 3:6544826-6544848 GAGGTTGCAGCGAGTCAAGATGG + Intergenic
950099125 3:10346388-10346410 CAGGTTGCAGACAGCAAAGAGGG - Intronic
950288358 3:11762971-11762993 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
951210297 3:19967207-19967229 GAGGTTGCAGCAAGCCAAGATGG - Intronic
951823468 3:26840679-26840701 CTGGTTGCAGTTTGACAAGATGG - Intergenic
952256274 3:31698384-31698406 GAGGTTGCAGTAAGCCAAGATGG + Intronic
953082037 3:39629708-39629730 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
953125592 3:40088871-40088893 CTGGAGGCAGGAAGTCAGGAAGG + Intronic
953172454 3:40519861-40519883 AAGGTTGCAGTAAGCCAAGATGG - Intergenic
953259855 3:41327249-41327271 CTTGTTACAGAAAGTCCATAGGG + Intronic
953440278 3:42910274-42910296 GAGGTTGCAGTGAGTCAAGATGG + Intronic
953690559 3:45114479-45114501 CAGGTTGCAGTGAGCCAAGATGG - Intronic
953706364 3:45234046-45234068 CTAGTTAGAGAAGGTCAAGAAGG - Intergenic
953715661 3:45315030-45315052 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
954008580 3:47614232-47614254 CTGGTAGCAGAAATCCAAAAAGG + Intronic
954026675 3:47788663-47788685 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
954362528 3:50129711-50129733 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
955849421 3:63203932-63203954 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
955941517 3:64150700-64150722 CTGGTGGCAGACAGACCAGAGGG - Intronic
957043356 3:75354271-75354293 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
957324388 3:78674314-78674336 CTGTTTGCAAACAGTAAAGAAGG + Intronic
958011787 3:87888380-87888402 ATGGGTGCAGAAAATCAACATGG + Intergenic
958944742 3:100350468-100350490 CTGGTTAAAGCAAGTCAAGGTGG - Intronic
959041403 3:101426542-101426564 GAGGTTGCAGTGAGTCAAGATGG - Intronic
959208232 3:103341064-103341086 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
959546587 3:107603711-107603733 GTGGTTGCTGAATGTCAGGATGG - Intronic
960199539 3:114813684-114813706 GAGGTTGCAGTGAGTCAAGATGG + Intronic
960468648 3:118031983-118032005 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
960537777 3:118832211-118832233 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
960609218 3:119540022-119540044 GAGGTTGCAGTAAGCCAAGATGG - Intronic
960678519 3:120222339-120222361 GAGGTTGCAGTAAGCCAAGATGG - Intronic
960893607 3:122478095-122478117 GAGGTTGCAGTAAGCCAAGATGG + Intronic
961580112 3:127874095-127874117 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
961605096 3:128087753-128087775 CTCGGTCCAGAAGGTCAAGAGGG + Exonic
961803974 3:129475585-129475607 GAGGTTGCAGTAAGCCAAGATGG + Intronic
961890614 3:130127524-130127546 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
962492424 3:135907346-135907368 GAGGTTGCAGAAACTCGAGATGG + Intergenic
962565780 3:136657755-136657777 CAGGTTGCAGTGAGCCAAGATGG + Intronic
963237939 3:142973918-142973940 CTGGCTGCAGACACTCAGGAAGG + Intronic
963421110 3:145061755-145061777 CTGGCTGCAGAAATTCAATCTGG - Intergenic
963800198 3:149668541-149668563 GTGGTTGCAGTAAGCCGAGATGG + Intronic
963937931 3:151073648-151073670 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
964091722 3:152885175-152885197 CTAATGGCAGAAAGTTAAGAGGG + Intergenic
964193935 3:154039443-154039465 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
964265182 3:154888000-154888022 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
964339566 3:155693863-155693885 GAGGTTGCAGTAAGCCAAGATGG + Intronic
964716217 3:159725180-159725202 CTGGTGGCAGAGATACAAGATGG - Intronic
964842198 3:161006745-161006767 GTGCTTGCAGTAAGCCAAGATGG - Intronic
966406954 3:179608063-179608085 GGGGTTGCAGTGAGTCAAGATGG - Intronic
966637118 3:182147948-182147970 CTGTTTGCAGACAGTAAAAATGG - Intergenic
967665650 3:192168901-192168923 CTACTTGAAGAAAGTCAAGAAGG + Intronic
967836349 3:193966607-193966629 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
967973949 3:195020587-195020609 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
968180869 3:196594211-196594233 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
969001996 4:3989943-3989965 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
969363852 4:6682427-6682449 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
969553736 4:7891987-7892009 GAGGTTGCAGTAAGCCAAGAAGG + Intronic
969752008 4:9118563-9118585 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
969811919 4:9654866-9654888 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
969956801 4:10898774-10898796 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
970019279 4:11548669-11548691 TTGGATGCAGAAAGATAAGAAGG - Intergenic
971582282 4:28357197-28357219 CTTGTTGAAGAAAGCAAAGAAGG + Intergenic
971791243 4:31172666-31172688 CAGATTGCAGTAAGCCAAGATGG - Intergenic
972011005 4:34182061-34182083 TTGATTGCACAATGTCAAGATGG + Intergenic
972638396 4:40904364-40904386 CAGGTTGCAGTAAGCCGAGATGG + Intronic
972756610 4:42054291-42054313 GAGGTTGCAGTGAGTCAAGATGG + Intronic
973552050 4:52045690-52045712 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
973887594 4:55338966-55338988 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
973888125 4:55343291-55343313 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
973973499 4:56239226-56239248 GAGGTTGCAGTGAGTCAAGATGG + Intronic
974802613 4:66837951-66837973 GAGGTTGCAGAGAGCCAAGATGG - Intergenic
975040915 4:69743679-69743701 CTGGGTGCCCAAAGTCCAGAGGG + Intronic
977962257 4:103099293-103099315 CTGGTCCCAGAAAGACAGGAAGG - Intronic
978224766 4:106320820-106320842 GAGGTTGCAGTGAGTCAAGATGG - Intronic
978993927 4:115125684-115125706 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
979292272 4:118991210-118991232 GAGGTTGCAGTGAGTCAAGATGG - Intronic
979687995 4:123531856-123531878 CAGGGTGCAGAAACTCAAGATGG + Intergenic
980085169 4:128383244-128383266 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
980302182 4:131009839-131009861 CTGTTTGCATACAGTCAAGCAGG - Intergenic
980925998 4:139138350-139138372 GAGGTTGCAGTAAGCCAAGATGG + Intronic
981318867 4:143368847-143368869 GAGGTTGCAGTAAGTCAAGATGG - Intronic
981921790 4:150093444-150093466 GAGGTTGCAGTAAGCCAAGATGG - Intronic
983936983 4:173509031-173509053 CTGGTAGCAGAAGGTGCAGATGG + Intergenic
984174276 4:176396869-176396891 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
984504300 4:180597584-180597606 CTGTTTGAAGAAAATCAAGCAGG + Intergenic
984776514 4:183485893-183485915 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
984849678 4:184143060-184143082 TGTGGTGCAGAAAGTCAAGAGGG - Intronic
986038973 5:3968542-3968564 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
986212627 5:5688768-5688790 CTGGCTGCAGAAAGTGATGTGGG - Intergenic
986309336 5:6540333-6540355 CTGGATGCAGAAAATCAGAATGG - Intergenic
988453760 5:31369485-31369507 ATGCTTGCAGAATGTCAAGTAGG - Intergenic
988487595 5:31679570-31679592 GAGGTTGCAGTAAGCCAAGATGG - Intronic
988559007 5:32263500-32263522 GAGGTTGCAGTAAGCCAAGATGG - Intronic
988584357 5:32495705-32495727 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
988635089 5:32974793-32974815 CTTGATGCAATAAGTCAAGAAGG - Intergenic
988863186 5:35306204-35306226 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
988949905 5:36245798-36245820 GAGGTTGCAGTAAGTCGAGATGG - Intergenic
989659027 5:43779023-43779045 CTTGGTCCAGAAAGTCTAGAAGG + Intergenic
990267731 5:54096476-54096498 TTGGTTGCAGTGAGCCAAGATGG - Intronic
990462839 5:56045824-56045846 CTGATTGCAGAGAATCAAGTTGG - Intergenic
990499000 5:56376427-56376449 CTGGGTGCAGGAACTCAAAAAGG - Intergenic
991071544 5:62488113-62488135 CTGCTTGCAGAAAGTCTATCTGG + Intronic
991220866 5:64214385-64214407 CTGAGTGCAGGAAGTCCAGAGGG - Exonic
991381649 5:66034352-66034374 GAGGTTGCAGAGAGCCAAGATGG - Intronic
991699326 5:69302354-69302376 GAGGTTGCAGTAAGCCAAGATGG + Intronic
992406375 5:76461301-76461323 GAGGTTGCAGTAAGTCATGATGG + Intronic
992434360 5:76740840-76740862 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
992707467 5:79411418-79411440 ATGGCTGCAGTGAGTCAAGATGG + Intronic
992778414 5:80107582-80107604 GAGGTTGCAGTAAGTCGAGATGG - Intergenic
993054772 5:82969183-82969205 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
994028677 5:95114942-95114964 CTGTTTGGAGAAAGTAAGGAAGG + Intronic
994993014 5:107021837-107021859 ATTGTTGCAGAAGGTCAAGAAGG + Intergenic
995203450 5:109451959-109451981 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
995344397 5:111094935-111094957 CTGGTTGCAGTAAGTAAGTATGG + Exonic
995442584 5:112208179-112208201 GAGGTTGCAGTGAGTCAAGATGG + Intronic
995509882 5:112897992-112898014 GTGGTTGCAGTGAGCCAAGATGG + Intronic
996044063 5:118850411-118850433 GAGGTTGCAGTGAGTCAAGATGG + Intronic
996304659 5:122033523-122033545 GAGGTTGCAGTGAGTCAAGATGG - Intronic
996393749 5:122991522-122991544 GAGGTTGCAGTAAGCCAAGATGG - Intronic
997007302 5:129833238-129833260 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
997030154 5:130118081-130118103 GTGCTTGCGGAAAGTGAAGAGGG - Intronic
997268191 5:132511364-132511386 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
997961795 5:138327570-138327592 GAGGTTGCAGTAAGTCAAGATGG + Intronic
998125451 5:139617116-139617138 GAGGTTGCAGTGAGTCAAGATGG + Intronic
998132157 5:139656787-139656809 GGGGTTGCAGTGAGTCAAGATGG - Intronic
998176776 5:139906070-139906092 GAGGTTGCAGTGAGTCAAGATGG - Intronic
998443118 5:142178705-142178727 GAGGTTGCAGTAAGTTAAGATGG + Intergenic
998516296 5:142757640-142757662 TTGTTTGAAGAATGTCAAGAAGG + Intergenic
998832977 5:146179165-146179187 GTGGTTGCAGTGAGCCAAGATGG + Intronic
999755419 5:154660801-154660823 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
999765032 5:154733625-154733647 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1000994163 5:167942141-167942163 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1001351546 5:170972244-170972266 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1001622654 5:173101615-173101637 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1002162755 5:177325732-177325754 GAGGTTGCAGTGAGTCAAGACGG + Intergenic
1003606891 6:7570457-7570479 CTGGTTCCACAGAGCCAAGATGG - Exonic
1003821077 6:9897793-9897815 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1004437597 6:15612133-15612155 GTGGTTGCTGAAGGTTAAGATGG - Intronic
1004508488 6:16265473-16265495 CTGGACCCAGAAAGTCAAGCTGG - Intronic
1004649062 6:17590942-17590964 GAGGTTGCAGAGAGCCAAGATGG + Intergenic
1004895437 6:20143377-20143399 CTAGTTGCTGAAGGTCAAGGAGG + Intronic
1005453436 6:25996001-25996023 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1005956035 6:30664121-30664143 CAGGTTGCAGTGAGTCATGATGG + Intronic
1006468733 6:34213295-34213317 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1007437751 6:41828382-41828404 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1007727487 6:43925285-43925307 GAGGTTGCAGTAAGTCGAGATGG - Intergenic
1008032581 6:46713693-46713715 GTGGTGGAAGAAAGTGAAGAGGG + Intronic
1009168761 6:60372920-60372942 CTGGATGAAGAAAGCAAAGAAGG + Intergenic
1009480443 6:64151423-64151445 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1010218279 6:73424916-73424938 GAGGTTGCAGTGAGTCAAGATGG - Exonic
1010745433 6:79555383-79555405 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
1011214464 6:84990507-84990529 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1011440317 6:87380514-87380536 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1012352883 6:98275337-98275359 TTGGTTACAGAAATTGAAGATGG + Intergenic
1012732204 6:102897764-102897786 CTGGCAGCAGAAAGTCACGTAGG + Intergenic
1013101512 6:106991211-106991233 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1013229806 6:108152011-108152033 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1013249286 6:108318098-108318120 CATGTTACAGAAAGTCTAGAGGG - Intronic
1013494334 6:110683109-110683131 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1013527390 6:110987130-110987152 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1014330658 6:120059851-120059873 CTGGTGATAGAAAGTGAAGAGGG + Intergenic
1014428821 6:121341852-121341874 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1015111796 6:129600824-129600846 CTCTTTGGAGAAATTCAAGAAGG + Exonic
1017435880 6:154415293-154415315 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1018324280 6:162648444-162648466 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1018515018 6:164570014-164570036 CTCATTGCAGAAGGTGAAGAGGG + Intergenic
1018581910 6:165315221-165315243 GAGGTTGCAGCAAGCCAAGATGG - Intergenic
1019187158 6:170227489-170227511 CTGGTTACAGGAACTCGAGATGG - Intergenic
1019495646 7:1338972-1338994 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1021781627 7:24112762-24112784 CTGGAAGCAGAAAGTGAAAATGG - Intergenic
1022006987 7:26275099-26275121 GAGGTTGCAGCAAGCCAAGATGG - Intergenic
1022362088 7:29670680-29670702 CAGGTTGCAGTAAGCCGAGATGG + Intergenic
1023058937 7:36311371-36311393 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1023383043 7:39627319-39627341 TTAGTTTCTGAAAGTCAAGAGGG + Intronic
1023829813 7:44032468-44032490 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1024722537 7:52153561-52153583 CTGTTTCCAGAAAGTTAAGGAGG + Intergenic
1024767250 7:52674211-52674233 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1024866624 7:53910616-53910638 CTGGTCCCAGACACTCAAGAAGG + Intergenic
1025118343 7:56277842-56277864 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1025257720 7:57396917-57396939 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1025706780 7:63873946-63873968 TTGAATGCAGAAAGACAAGAGGG - Intergenic
1026213965 7:68331856-68331878 CTGGTTGAAGAAATCCAACAAGG - Intergenic
1026272575 7:68849633-68849655 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1026332271 7:69363078-69363100 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1026433044 7:70367196-70367218 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1026458403 7:70592912-70592934 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1026459413 7:70600338-70600360 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1026549586 7:71356844-71356866 GTGGTTGCAGTGACTCAAGATGG - Intronic
1026622262 7:71960066-71960088 GTGGTTGCAGTGAGTCAGGATGG + Intronic
1027198904 7:76050094-76050116 TTGGTTGCAGTGAGCCAAGATGG - Intronic
1027303359 7:76865774-76865796 CAGTTTGGAGAAATTCAAGAGGG - Intergenic
1027345997 7:77260561-77260583 CTGTTAGAAAAAAGTCAAGATGG - Intronic
1027948103 7:84777112-84777134 CTCATTGCAGAAGGTGAAGAGGG - Intergenic
1028572798 7:92309858-92309880 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1029192686 7:98782990-98783012 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1029226962 7:99035244-99035266 CTGCTTCCAAAAAGCCAAGAGGG - Intronic
1029720061 7:102357551-102357573 CAGGTTGCAGGGAGCCAAGATGG + Intergenic
1029752552 7:102551706-102551728 CAGGTTGCAGGGAGCCAAGATGG - Intronic
1029758120 7:102585914-102585936 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1029770503 7:102650799-102650821 CAGGTTGCAGGGAGCCAAGATGG - Intronic
1029776058 7:102684992-102685014 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1030602496 7:111608794-111608816 GAGGTTGCAGTAAGTCAAGATGG - Intergenic
1030845004 7:114399170-114399192 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1031484088 7:122307449-122307471 CTGGTGGCATTCAGTCAAGAAGG - Intronic
1031726023 7:125240514-125240536 ATGGTTGCAGAAAGTTGAGGTGG - Intergenic
1031737266 7:125382044-125382066 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1032334316 7:131010880-131010902 CTGGTTGAAGAAACTAAGGAAGG - Intergenic
1032507151 7:132444317-132444339 GTGGTTGCAGTGAGCCAAGAGGG - Intronic
1033163281 7:139016130-139016152 CTCATTGCAGAAAATCTAGAAGG + Intergenic
1033354420 7:140587973-140587995 CAGGTTGCAGTGAGCCAAGATGG - Intronic
1033782291 7:144685417-144685439 CAGGCTGCAGTAAGCCAAGATGG + Intronic
1034018829 7:147617776-147617798 CTAATAGAAGAAAGTCAAGATGG + Intronic
1034695348 7:153048468-153048490 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1035060849 7:156068493-156068515 GAGGTTGCAGCAAGCCAAGATGG - Intergenic
1035234852 7:157489588-157489610 GAGGTTGCAGAGAGCCAAGATGG + Intergenic
1035514605 8:221946-221968 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1035514948 8:224845-224867 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1036375222 8:8194000-8194022 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1036854317 8:12229148-12229170 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1036875678 8:12471648-12471670 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1037244176 8:16812913-16812935 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1037338545 8:17815680-17815702 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1037865303 8:22438589-22438611 GAGGTTGCAGAGAGCCAAGATGG - Intergenic
1038694569 8:29794779-29794801 CAGATAGCAGAAAGACAAGAGGG - Intergenic
1038718518 8:30012703-30012725 CTGGCTCCAGAAAGGCCAGAAGG - Intergenic
1039061631 8:33576433-33576455 GAGGTTGCAGCAAGCCAAGATGG + Intergenic
1039105097 8:33981721-33981743 CTTGATGCACAAAGTCCAGAGGG + Intergenic
1039544551 8:38399711-38399733 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1039961479 8:42251185-42251207 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1041162342 8:55058435-55058457 CTGGTAGCTGAAGGTCAAGTCGG + Intergenic
1041974588 8:63782747-63782769 CTGCATGGAGATAGTCAAGAAGG + Intergenic
1042064276 8:64857175-64857197 CTGGTTGTAGACAAACAAGAAGG + Intergenic
1042543314 8:69928713-69928735 AAGGTTGCAGTGAGTCAAGACGG - Intergenic
1042893591 8:73641292-73641314 GTGGTTGCAGTGAGCCAAGATGG + Intronic
1043334665 8:79160258-79160280 CAGGTTGCAGAAAGTAAATTTGG + Intergenic
1043400397 8:79878869-79878891 GAGGTTGCAGTAAGTCGAGATGG + Intergenic
1044373586 8:91443499-91443521 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1044435598 8:92158880-92158902 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1044562540 8:93627165-93627187 CAGGTTGCAGTGAGCCAAGATGG + Intergenic
1044982612 8:97731680-97731702 GTGGTTGCAGTGAGCCAAGATGG + Intergenic
1045710556 8:104978492-104978514 CTGGTTAGAGAAAGGCAAGGTGG - Intronic
1046229340 8:111332727-111332749 ATGGAAGCAGAAAGTCTAGAAGG + Intergenic
1046462259 8:114555425-114555447 CTGATTCCAGAAAGTAGAGATGG + Intergenic
1046629884 8:116612940-116612962 GTGGTTCCACAAAGTCAACAAGG + Intergenic
1047120680 8:121900792-121900814 CAGGTTTAAGAAAGTGAAGAAGG + Intergenic
1047134773 8:122064656-122064678 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1047830693 8:128626630-128626652 ATGGATGGAGAAAGTAAAGATGG + Intergenic
1047860641 8:128962702-128962724 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1048183849 8:132220682-132220704 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1048563963 8:135574248-135574270 CTGGTGGAAGAAAGGCATGATGG - Intronic
1049117103 8:140698516-140698538 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1050167530 9:2781196-2781218 CAGGTGGCAGCAAGACAAGATGG - Intronic
1050171616 9:2825545-2825567 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1050504092 9:6329139-6329161 CTGGTTCCAGAAAGTGGAGATGG - Exonic
1050913723 9:11105785-11105807 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1051259866 9:15252581-15252603 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1051407873 9:16758402-16758424 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1051483533 9:17584436-17584458 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1051507026 9:17838616-17838638 CTGGCTGCAGAAAGTTACTATGG - Intergenic
1051778254 9:20659340-20659362 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1051937431 9:22460017-22460039 CCTCTTGCAGAAAGTGAAGATGG - Intergenic
1052504043 9:29329714-29329736 TTGGTGGCAGAAACACAAGATGG + Intergenic
1052515825 9:29478249-29478271 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1052786790 9:32835808-32835830 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1053708764 9:40783183-40783205 GGGGTTGCAGTGAGTCAAGATGG + Intergenic
1054418674 9:64903978-64904000 GGGGTTGCAGTGAGTCAAGATGG + Intergenic
1055495242 9:76847961-76847983 CTGGTTTCAAAAAGTTAATATGG + Intronic
1057042755 9:91859264-91859286 GTGGTTGCAGTGAGCCAAGATGG - Intronic
1057107368 9:92432258-92432280 GAGGTTGCAGTGAGTCAAGATGG + Intronic
1057564136 9:96153420-96153442 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1057895158 9:98903401-98903423 AAGGTTGCAGTAAGCCAAGATGG - Intergenic
1058043038 9:100325593-100325615 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1058467087 9:105240055-105240077 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1058963069 9:110009772-110009794 CTGGTAGCAGGAAGCCATGAGGG - Intronic
1059231346 9:112724405-112724427 CTCGTGGCAGAAGGACAAGAAGG + Intergenic
1059998071 9:119933224-119933246 CTGCCTGCAGAAAAGCAAGAAGG - Intergenic
1060982392 9:127801009-127801031 CAGGTTGCAGTGAGCCAAGATGG + Intronic
1062688183 9:137827197-137827219 CTGGTTGCAGACAGACTGGAAGG - Intronic
1185510969 X:665026-665048 CAGGTTGCAGTGAGCCAAGATGG - Intergenic
1185661681 X:1733435-1733457 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1185679666 X:1878128-1878150 GAGGTTGCAGTAAGCCAAGAAGG + Intergenic
1185859145 X:3561601-3561623 GTGGTTGCAGTGAGACAAGATGG - Intergenic
1186968613 X:14815232-14815254 CTGGGTGCAGCAAGCCAACATGG + Intergenic
1187467941 X:19542935-19542957 CTGGCTGCAGAAAGGCTAAAGGG + Intronic
1187663005 X:21571944-21571966 CTGGGTGAATAAAGTCAAAACGG - Intronic
1187686706 X:21822585-21822607 AAGGTTGTAGAAAGACAAGATGG - Intergenic
1187818198 X:23256161-23256183 CTGGCTCCAGAGAGTCCAGATGG + Intergenic
1187846451 X:23542654-23542676 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1187919057 X:24183247-24183269 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1188349588 X:29111992-29112014 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1188544706 X:31291747-31291769 CTGGTTTCATAAAGGCAAGTAGG - Intronic
1189485937 X:41431900-41431922 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1190294484 X:49017306-49017328 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1190342842 X:49311130-49311152 CTGTTTGCAGCAAGTCCAGGGGG - Intronic
1190356757 X:49613043-49613065 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1192343924 X:70285788-70285810 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1193123512 X:77847673-77847695 GAGGTTGCAGTGAGTCAAGATGG - Intronic
1193144416 X:78062341-78062363 CTGGTTTCAGGAAGGAAAGAGGG + Intergenic
1193890137 X:87033895-87033917 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1194093389 X:89604415-89604437 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1196414517 X:115456341-115456363 CTGGTTGCAGAAAGAGAACAGGG + Intergenic
1196701827 X:118678535-118678557 GAGGTTGCAGTAAGCCAAGATGG - Intronic
1197785963 X:130197269-130197291 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1198440967 X:136662873-136662895 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1198467324 X:136915343-136915365 GTGGTTGCAGTGAGCCAAGATGG - Intergenic
1199082000 X:143587566-143587588 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1199282600 X:146020078-146020100 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1199664126 X:150083062-150083084 TTGCTTTCTGAAAGTCAAGAAGG + Intergenic
1200446019 Y:3260518-3260540 GAGGTTGCAGTGAGTCAAGATGG + Intergenic
1200828866 Y:7670789-7670811 GAGGTTGCAGTAAGCCAAGATGG + Intergenic
1200952727 Y:8917018-8917040 GAGGTTGCAGTAAGCCAAGATGG - Intergenic
1201237891 Y:11929346-11929368 GAGGTTGCAGTGAGTCAAGATGG - Intergenic
1202185056 Y:22178564-22178586 GAGGTTGCAGTAAGCCAAGATGG + Intronic
1202206304 Y:22407837-22407859 GAGGTTGCAGTAAGCCAAGATGG - Intronic