ID: 1071470980

View in Genome Browser
Species Human (GRCh38)
Location 10:85983926-85983948
Sequence CAGGACGCTCACCCTCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071470973_1071470980 25 Left 1071470973 10:85983878-85983900 CCTTTCTTTTCAGGCTTCACCTC 0: 1
1: 0
2: 1
3: 30
4: 375
Right 1071470980 10:85983926-85983948 CAGGACGCTCACCCTCATCATGG No data
1071470972_1071470980 26 Left 1071470972 10:85983877-85983899 CCCTTTCTTTTCAGGCTTCACCT No data
Right 1071470980 10:85983926-85983948 CAGGACGCTCACCCTCATCATGG No data
1071470974_1071470980 6 Left 1071470974 10:85983897-85983919 CCTCACAATATCATTCTCTCCCA 0: 1
1: 0
2: 1
3: 42
4: 540
Right 1071470980 10:85983926-85983948 CAGGACGCTCACCCTCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071470980 Original CRISPR CAGGACGCTCACCCTCATCA TGG Intronic
No off target data available for this crispr