ID: 1071472554

View in Genome Browser
Species Human (GRCh38)
Location 10:85994068-85994090
Sequence CCAGGACATGTTTGATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071472554_1071472559 -5 Left 1071472554 10:85994068-85994090 CCAGCTAATCAAACATGTCCTGG 0: 1
1: 1
2: 1
3: 10
4: 79
Right 1071472559 10:85994086-85994108 CCTGGGCCAGGAGCTGCAAACGG No data
1071472554_1071472561 26 Left 1071472554 10:85994068-85994090 CCAGCTAATCAAACATGTCCTGG 0: 1
1: 1
2: 1
3: 10
4: 79
Right 1071472561 10:85994117-85994139 TTTCAAACACACCAAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071472554 Original CRISPR CCAGGACATGTTTGATTAGC TGG (reversed) Intronic
902749314 1:18496105-18496127 TCAGGAGATGCTTGATGAGCTGG + Intergenic
907529381 1:55078633-55078655 CCAGGTAATGTTTGCTTTGCGGG - Exonic
910330086 1:86062724-86062746 TCAGTACATGTTTGATTTGCAGG + Intronic
913536555 1:119778529-119778551 TCAGGACATGTTTGGTTATGGGG + Intergenic
1063007393 10:1986551-1986573 CCAGAAGATGATTGATTAGTGGG + Intergenic
1064960626 10:20960783-20960805 CCAGGACATGTTTAATTAGCAGG - Intronic
1071421818 10:85508094-85508116 CAAAGACATTTTTAATTAGCTGG - Intergenic
1071472554 10:85994068-85994090 CCAGGACATGTTTGATTAGCTGG - Intronic
1077363102 11:2149582-2149604 CCAGGGCATGGTACATTAGCGGG + Intronic
1077454261 11:2668811-2668833 AGAGGAAATGTTTGATTAACTGG - Intronic
1081766444 11:45614457-45614479 CCAGCAAATGTTTCATTGGCTGG - Intergenic
1082012465 11:47459381-47459403 CCAGCACCTGTTTCAGTAGCAGG - Intergenic
1084369036 11:68726068-68726090 CAAGGACATGTGTGATCTGCTGG + Intronic
1087228701 11:95632738-95632760 CCAGCACATTTCTGATTATCAGG - Intergenic
1093961390 12:25276602-25276624 TCAGGTCATGTTTAATTAGTAGG + Intergenic
1098033875 12:66282416-66282438 ACAGGACATGTGTCATTAACAGG + Intergenic
1098851410 12:75600648-75600670 CCAGCACATGTTTCATCAGGTGG - Intergenic
1098990532 12:77060605-77060627 GCAGGGCAGGTTTGAGTAGCAGG - Intronic
1099990846 12:89719347-89719369 CCAGGACATGTGGGAATTGCGGG - Intergenic
1104668139 12:130662128-130662150 CCAGGTCTTGTGTGATGAGCGGG - Intronic
1111824077 13:93246351-93246373 CCAGGACAGCTGAGATTAGCAGG + Intronic
1115409397 14:33056052-33056074 CAAGGATATTTTTGAATAGCTGG - Intronic
1121837191 14:97102559-97102581 TCAGGACCGGTTAGATTAGCAGG + Intergenic
1124797126 15:32792628-32792650 CCAGGAAATGTAGGCTTAGCTGG - Intronic
1126051205 15:44686917-44686939 CCTGGACTTTTTTGATTAGTAGG - Intronic
1130056871 15:80533603-80533625 CCATGACATGCTTCATTGGCTGG - Intronic
1131624286 15:94101255-94101277 TCAGGAAATGTTTGGGTAGCTGG + Intergenic
1132115544 15:99132926-99132948 GCAGGCCATGTTTGATAAGAAGG + Exonic
1135350266 16:21723350-21723372 CCAGATCATGTTTGAAAAGCAGG - Intronic
1138343298 16:56304958-56304980 CCAGGACAGGTAGGGTTAGCCGG + Intronic
1140036368 16:71374483-71374505 GCAGGGCATGTTTGATTACCTGG + Intronic
925826233 2:7850755-7850777 CCAGGAGATTTTTTATTAGCAGG + Intergenic
930621254 2:53646203-53646225 CCAGGACTTGATGGATCAGCTGG + Intronic
934574357 2:95390924-95390946 CCATGAGATGTTTGAGTGGCGGG - Intergenic
940540492 2:155009972-155009994 CCAGGACATTTTTCATTAGCTGG + Intergenic
940566123 2:155363339-155363361 CCTGGTCATGTTTGCTTAGCTGG - Intergenic
946577865 2:221095873-221095895 CAAGGACTTGTTTGAGTAGATGG - Intergenic
1170284776 20:14694932-14694954 CCAGGCCATGTTTAAGTAGAGGG - Intronic
1173009128 20:39165403-39165425 CCAGGCCATGATGGATGAGCTGG - Intergenic
1178089781 21:29150326-29150348 CCAGGTCAGGTTTGAAGAGCTGG + Intronic
1183814636 22:40289338-40289360 AGAGGACATGTTTGAATGGCAGG + Intronic
955092624 3:55767592-55767614 CCTGGGCATGTCTGATTAGGCGG - Intronic
967773886 3:193364262-193364284 CCAGGAGGTGTTTGGTTACCGGG - Exonic
968778224 4:2558541-2558563 CCAGAAAAATTTTGATTAGCTGG - Intronic
968939681 4:3631349-3631371 GCAGCAGATGTTTGATGAGCCGG + Intergenic
973618132 4:52701278-52701300 ACAGGACATGTTAGATGAACTGG + Intergenic
977825182 4:101523156-101523178 CAAGGTCATGTTATATTAGCAGG - Intronic
986251310 5:6060915-6060937 CCAGGACATGTTGGACAAGTTGG - Intergenic
986831084 5:11579235-11579257 CAAGTTCTTGTTTGATTAGCAGG - Intronic
987311542 5:16685758-16685780 CCAGGAGATGCATGATGAGCAGG - Exonic
989526766 5:42462072-42462094 CCAGGACAGGTTTCAGAAGCAGG + Intronic
990208800 5:53458998-53459020 CCAGGACTTGATGGATCAGCTGG + Intergenic
997779307 5:136640893-136640915 CCAGGACATGCATGTTTACCTGG - Intergenic
1000199726 5:158996251-158996273 CCCGGACATGTTTGTTGATCTGG - Intronic
1001218407 5:169877240-169877262 TCAGGACAAGATTGTTTAGCGGG + Intronic
1001345484 5:170893490-170893512 CCAGATCATGTTTCTTTAGCTGG - Intronic
1001647776 5:173295080-173295102 CCAGGACAGGCTTGATTTGGTGG - Intergenic
1001805478 5:174582047-174582069 ACACAACATGTTTGATTGGCTGG - Intergenic
1003510592 6:6776577-6776599 CCAGATCCTGTTTGATCAGCAGG + Intergenic
1004805521 6:19200048-19200070 CCAGGGCATTTTTTATTGGCAGG + Intergenic
1005017875 6:21391142-21391164 GCAGGACATTTTTGAATGGCAGG + Intergenic
1005225115 6:23633871-23633893 CTTAGACATGTTTAATTAGCTGG + Intergenic
1008444800 6:51575780-51575802 CCTGCACATAATTGATTAGCTGG - Intergenic
1008479592 6:51971642-51971664 CCAGGATATGTGTGCTTAGGGGG + Intronic
1010950133 6:82026261-82026283 CCAAGATATGTTTTATAAGCTGG + Intergenic
1013164922 6:107581114-107581136 CAAGGACCTGTTTGATTAGTGGG + Intronic
1013554952 6:111247334-111247356 CCAGGCAATTTTTGATTAGCAGG - Intergenic
1017815700 6:158014988-158015010 CCAGGACACATTTGATTTCCTGG - Intronic
1022911352 7:34901993-34902015 CCTGGCCATGTTTTATTAGTGGG + Intergenic
1024595167 7:50926931-50926953 CCTGGACATTATTTATTAGCAGG - Intergenic
1026378317 7:69774109-69774131 CCTGGACATCTTTGCTTAGCAGG - Intronic
1034330093 7:150275137-150275159 CCAGGACATGTATGCTTTTCTGG - Intronic
1034667962 7:152834723-152834745 CCAGGACATGTATGCTTTTCTGG + Intronic
1036230838 8:6998906-6998928 CCAGGACATGTGTGTTTAGAAGG + Intronic
1036233283 8:7018005-7018027 CCAGGACATGTGTGTTTAGAAGG + Intronic
1036876561 8:12478088-12478110 CCAGGAACTGATTGATCAGCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041566155 8:59281237-59281259 CCAGGACCTGTGTGATTTGATGG - Intergenic
1042526691 8:69771797-69771819 ACATGGCATGTTTGATTAGCTGG + Intronic
1043780956 8:84334177-84334199 CCAGGCCATGTTTTAATACCAGG + Intronic
1044516663 8:93146778-93146800 CCAGGACTTTTTTGGTTAGTAGG - Intronic
1044592660 8:93929344-93929366 CCAGGAACTGTTTTATTTGCTGG + Intergenic
1045252365 8:100492641-100492663 CCAGGGCATGTTTGTTTCACTGG - Intergenic
1047326648 8:123844967-123844989 TCAGGACATGTTTGCTGAGGTGG + Intergenic
1047681618 8:127259375-127259397 CCAGAACTTGTCTGATGAGCAGG - Intergenic
1047991195 8:130288435-130288457 TCAGGACATGTTTTATTTGGAGG + Intronic
1053093426 9:35301727-35301749 CCAGGACATCCTTGTATAGCTGG + Intronic
1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG + Intergenic
1187866337 X:23726529-23726551 CCGGGAAATGTTTAATTAACAGG + Intronic
1191078548 X:56484098-56484120 CCAGGACAAGTTGGACTAACAGG - Intergenic
1192633720 X:72797719-72797741 CCAGGACCTGATGGATTTGCTGG - Intronic
1192647990 X:72923082-72923104 CCAGGACCTGATGGATTTGCTGG + Intronic