ID: 1071476710

View in Genome Browser
Species Human (GRCh38)
Location 10:86031865-86031887
Sequence CAGTGCAAAGACTCTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071476710_1071476716 20 Left 1071476710 10:86031865-86031887 CCCTGCTCAGAGTCTTTGCACTG 0: 1
1: 0
2: 5
3: 60
4: 444
Right 1071476716 10:86031908-86031930 GTTCTTCCCCTACGTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071476710 Original CRISPR CAGTGCAAAGACTCTGAGCA GGG (reversed) Intronic
900092503 1:926539-926561 CACTGCAAAGACTCTGCCCCTGG - Intronic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901589631 1:10329714-10329736 CAGAGCAAAGACTCTGTCTAGGG + Intronic
902104463 1:14022834-14022856 CAGTGCAAAGACACTGATTAGGG + Intergenic
902421881 1:16287204-16287226 CAGTGCAAAGACCCAGAGTTGGG - Intronic
903065720 1:20698190-20698212 CACAGCAAAGAGTCTGAGCCAGG - Intronic
903249581 1:22043092-22043114 AAGAGCAAAGCCTCTGAGCTAGG + Intergenic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
903934663 1:26887116-26887138 CACTGCAAAGACTCTGTAAATGG + Intronic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
905260612 1:36715612-36715634 CAGTGCAAAGGCGCAGAGGAGGG - Intergenic
905831966 1:41076713-41076735 AAGTGCAAAGAGTCTGAGACAGG + Intronic
906187629 1:43872947-43872969 CAGTGCAAAAGCTCTGAGGTGGG + Intronic
906610472 1:47198433-47198455 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
906796013 1:48696921-48696943 CAGTGCAAAGGGTGTCAGCAAGG - Intronic
908794723 1:67819789-67819811 CAGTGCAAAGGCACTGAGCTGGG - Intronic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
910967278 1:92820175-92820197 TAGTACAACGACTCTGAGCTAGG + Intergenic
912475594 1:109932710-109932732 CACTTCAAAGCCTCTAAGCAAGG + Intergenic
912870283 1:113297994-113298016 AAGTGCAAAGGCTCTGAGGTAGG - Intergenic
913335783 1:117708183-117708205 CAGAACAAACCCTCTGAGCAGGG - Intergenic
915693904 1:157719704-157719726 CAGTACAAAAACTCTGCCCAAGG - Intergenic
915840708 1:159210712-159210734 AAGTGCAAAGACTCTTAGAGTGG - Intergenic
915951876 1:160195105-160195127 AAGAGCAAAGACTCAGAGCGTGG + Exonic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917603404 1:176600794-176600816 GAGTGGAAAGACTCTGTGCCTGG - Intronic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
918255606 1:182743637-182743659 CAATGCAAAGACCCTGAGACAGG - Intergenic
919052699 1:192531278-192531300 AAGTACAAAGGCTCTGAGGAAGG + Intergenic
919117379 1:193297205-193297227 CAGTTTAAAGAGACTGAGCAAGG + Intergenic
920573471 1:207036210-207036232 CATGGCAAAAACTCTAAGCATGG + Intronic
921183844 1:212653481-212653503 AAGTGCAAATACTCTGGGCTGGG - Intergenic
921364470 1:214360666-214360688 CAGAGCACAGGCTCTGAGTAAGG + Intronic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
923380042 1:233408142-233408164 AAGTGCAAAGAGGCTGGGCATGG + Intergenic
923404254 1:233644685-233644707 GAGTGCAAAGGCCCTGAGCTAGG + Intronic
923415978 1:233760351-233760373 CAGTGCAAAGTCCCTGAACCTGG - Intergenic
924266749 1:242290479-242290501 CAGTGCAGAGGCTGTGATCAAGG + Intronic
924331357 1:242943910-242943932 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
924466337 1:244302065-244302087 CAGAGCAAAGAATCTGAGCCTGG - Intergenic
1062957155 10:1547875-1547897 CAGAGCCAAGACTCAGGGCAGGG + Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064168625 10:13008290-13008312 CAGTTCAGAGAATCAGAGCATGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1067059226 10:43069410-43069432 CAGTGCCAAGCATCTAAGCAGGG + Intergenic
1067154658 10:43768082-43768104 CAGTGCAAAGAATATTATCAGGG - Intergenic
1068748514 10:60563747-60563769 TGGGGCATAGACTCTGAGCATGG - Intronic
1069606986 10:69745135-69745157 CAGAGCAAAGACTCACAGCCAGG - Intergenic
1069899418 10:71698601-71698623 TCGTGCAAAGGCTCTGAGCTGGG - Intronic
1069998136 10:72355639-72355661 AAGTGCAAAGGCTCTGAAAAGGG + Intergenic
1071286334 10:84150173-84150195 CAGTGAAAAGTTTCTGAACATGG + Exonic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1073638115 10:105220210-105220232 TAGGGCAAAGATTCTGAGCCAGG - Intronic
1074897662 10:117791206-117791228 CAGTGCAGAGACCCCCAGCAGGG + Intergenic
1074924480 10:118053360-118053382 CAGTGCAAAGACTGTCATCTAGG - Intergenic
1074975478 10:118577736-118577758 CAGTTCAAGGACTGTCAGCACGG + Intergenic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1078818656 11:14853079-14853101 AAGTGCAAACACTCTCAGAAAGG - Intronic
1079003902 11:16779262-16779284 CAGGGCAAAGACTCTAATAAAGG + Intronic
1079056587 11:17211422-17211444 GTGTGCAAAGGCTCTGAGAAAGG + Intronic
1079156836 11:17955791-17955813 CAGGGCAAAGAATCAGAGCAAGG + Intronic
1081109506 11:39117249-39117271 AAGTGCAAAGGCTCTGAGACAGG - Intergenic
1082731828 11:56807379-56807401 GAGAGCAAAGATTCTGAGGAAGG - Intergenic
1083571899 11:63765536-63765558 CAGTGGAAAGGCTTGGAGCAGGG - Intronic
1083633289 11:64106609-64106631 CAGTGCCAAGCCTCTGATCTAGG + Intronic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1085636601 11:78164023-78164045 CAGTGCCAAGACTCTGACCCAGG - Intergenic
1086931685 11:92700359-92700381 CAGTGGAAAGCCTTTAAGCAGGG + Intronic
1087095697 11:94315309-94315331 CAGATCAAAGGCTGTGAGCAGGG - Intergenic
1087208493 11:95421335-95421357 CAGTGCCAAGACCCTAAGCTGGG + Intergenic
1087266457 11:96066880-96066902 AAGAGCAAAGACTCTGAGATGGG + Intronic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1089409911 11:118232173-118232195 TGGTGCAAAGGCTCTGAGGAGGG - Intronic
1089676329 11:120092492-120092514 CAGAGCAAAGGCTCTGAGAAGGG + Intergenic
1090431237 11:126648352-126648374 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1092033367 12:5308821-5308843 CAGAGCCAAGACTCTCAGCATGG - Intergenic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092692222 12:11126656-11126678 CAGTGCAATTACTTTGAGTATGG - Intronic
1092953546 12:13529362-13529384 CAGTGCAAAGGCTCTGTGAAAGG - Intergenic
1092958392 12:13571768-13571790 CAGATCAAGGACTCTGAGCTTGG + Intronic
1093142180 12:15521739-15521761 CAGTGCAAAGACTGTCAGGGTGG - Intronic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1097740563 12:63237064-63237086 GAGTGCAAAGGCCCTGAGCCAGG - Intergenic
1098205952 12:68109831-68109853 AACAGCAAAGTCTCTGAGCAAGG - Intergenic
1098429277 12:70402080-70402102 TATTGCAAAGAGTTTGAGCAAGG - Intronic
1098573931 12:72019404-72019426 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1099470710 12:83044341-83044363 GAGTGAAAAGACTCTGAACCAGG + Intronic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103162526 12:118741452-118741474 AAGTGCAAAGAGTCTGAGGCAGG - Intergenic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103455627 12:121063170-121063192 CATTGCAGACACTCTGTGCATGG + Intergenic
1103639012 12:122333456-122333478 AAGTGCACAGGCTCTGAGAAAGG + Intronic
1103662031 12:122527763-122527785 GAGTGCAAAGACTCGGAGGCTGG - Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104577273 12:129979429-129979451 CGATGCATAGATTCTGAGCAGGG - Intergenic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1105932327 13:25064236-25064258 CAAGGAAAAGTCTCTGAGCAAGG + Intergenic
1106075444 13:26456826-26456848 CAGTGCAAACACTCCAATCATGG + Intergenic
1108048276 13:46403949-46403971 TAGTGCAAAGAGGCTGGGCACGG - Intronic
1108620756 13:52181778-52181800 CAGTGCCAACATTCTGAGAAAGG + Intergenic
1108665994 13:52631200-52631222 CAGTGCCAACATTCTGAGAAAGG - Intergenic
1108974800 13:56425868-56425890 AAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1110443902 13:75555138-75555160 AAGTGCAAAGACTCTGAAGCAGG - Intronic
1111856058 13:93639264-93639286 AAGTACAAAGACCCTGAGGAAGG + Intronic
1112008447 13:95274218-95274240 CAGTACAAAGGCCCTGAACAGGG - Intronic
1112666236 13:101577140-101577162 TGGTGCAAAGTCTCTGAACAAGG + Intronic
1112796291 13:103060000-103060022 AAATGCAAACACTCTGAGCAGGG - Intronic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1113663114 13:112120431-112120453 GAGAGCCAAGAGTCTGAGCAGGG + Intergenic
1114827114 14:26094471-26094493 CAGTGGACAGAGTCTGAGAAGGG + Intergenic
1115360688 14:32497900-32497922 CAGAGCAAAGACTATAACCAAGG - Intronic
1116097547 14:40389977-40389999 CAGTGCCAAGTCTTTGACCAGGG - Intergenic
1116626100 14:47265980-47266002 GATTGCAAACACTATGAGCAAGG + Intronic
1117292219 14:54344829-54344851 AAGTGCAAAGCCTCTGAGGAAGG - Intergenic
1117573966 14:57079007-57079029 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1117587166 14:57221230-57221252 AAGTGCAAAGAGACTAAGCAAGG + Intronic
1117830051 14:59741219-59741241 CAGTGCAAAGGCCCTGAGCTGGG - Intronic
1118129411 14:62945789-62945811 AAGTACAAAGACTCTGAGACAGG + Intronic
1118163462 14:63313679-63313701 AAGTGCAAAGGCCCTGAGCTGGG - Intronic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119521287 14:75287755-75287777 CAGTGCAAAGTCTCTGAAGGGGG + Intergenic
1119897245 14:78230654-78230676 AATTGCAAAGACTCTGAGGTTGG + Intergenic
1121176212 14:91892503-91892525 CAGGGCACAGAATCTGAGAAGGG - Intronic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121502921 14:94452728-94452750 CAGAGCAAAGGCACTGAGCAGGG + Exonic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1123151003 14:106181728-106181750 CAATGCACAGACTCTGTCCAAGG - Intergenic
1123399416 15:19969585-19969607 CAATGCACAGACTCTGTCCAAGG - Intergenic
1123759634 15:23422489-23422511 CTGTGCAGAGACTCAGGGCATGG - Intergenic
1124720089 15:32104275-32104297 CAGTGCAAAGGCCCTGAGGGGGG - Intronic
1125354725 15:38804969-38804991 CAATGCAAAGGCTCTGAGCCTGG + Intergenic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1126534579 15:49747521-49747543 CAGTACAAAGGCTCTGAGGCAGG + Intergenic
1126883696 15:53126420-53126442 AAGTGCAAAGACTCGCAGTAAGG - Intergenic
1127854554 15:62943639-62943661 CAGTGCCAAGGGCCTGAGCAGGG - Intergenic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1128705185 15:69832932-69832954 CAGTGCAAAGGCCCTGAGCTGGG - Intergenic
1128865319 15:71110726-71110748 CTTTGCAAAGACCCTGAGGAAGG - Exonic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1131210383 15:90490301-90490323 CAGTGCAGAGAAGATGAGCAAGG + Intronic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131395285 15:92080770-92080792 CAGACCAAAGTCACTGAGCATGG - Intronic
1132469058 16:91849-91871 CTGGGCAGAGACTCAGAGCAGGG - Intronic
1132884340 16:2176006-2176028 CAGGTCAAAGACACTGAGCAAGG - Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134312053 16:13083858-13083880 CTGTGAAAAGAATCTGGGCAGGG + Intronic
1134456712 16:14400407-14400429 CTGTGCAGAGACTCAGGGCACGG + Intergenic
1135128763 16:19834474-19834496 CAGTGCAAAGCTTCTCAGCATGG + Intronic
1135345990 16:21688860-21688882 CAGCACAAAGGCTCTGAGCCTGG + Intronic
1139614980 16:68083523-68083545 CAGTGGAAGGACTTAGAGCAGGG - Intergenic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140289494 16:73639265-73639287 CAGTGCAATATATCTGAGCAGGG - Intergenic
1140345824 16:74212290-74212312 ACGTGCAAAGCCTCTGAGGAAGG + Intergenic
1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG + Intergenic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141157226 16:81605650-81605672 CAGTGCAAAGGCTCAGAGGTGGG - Intronic
1141171381 16:81693831-81693853 CAGAGCAAGGAATCTGAGCTGGG + Intronic
1141641430 16:85343953-85343975 CAGTGCAAAGGCCCTGAGACGGG - Intergenic
1143664469 17:8348467-8348489 CAAAGGAAAGATTCTGAGCAAGG + Intergenic
1143708145 17:8714823-8714845 AAGTGCAAGGACTGTGAGCTGGG + Intergenic
1144961120 17:19044749-19044771 CAGTGCCAAGGCTCTGAGGTGGG + Intronic
1144974041 17:19129775-19129797 CAGTGCCAAGGCTCTGAGGTGGG - Intronic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1145248988 17:21287174-21287196 CACTGCACATGCTCTGAGCAAGG - Intronic
1147218930 17:38916945-38916967 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
1148472253 17:47902189-47902211 CAATGCAAAGACCCTCAGCAGGG + Intronic
1148705648 17:49628941-49628963 CAGTACAAATACTCTGATGAAGG + Intronic
1149455612 17:56785776-56785798 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150908206 17:69361254-69361276 AAGTGCAAAGGCCCTGAGGAGGG + Intergenic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151258950 17:72901766-72901788 CACTGCTAAGACTCTTAACAGGG + Intronic
1151929681 17:77224404-77224426 CAGTGCAAAGAGACTCAGTAAGG - Intergenic
1153147989 18:2055593-2055615 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG + Intergenic
1156126679 18:33914282-33914304 AAGTGCAAAGACCCTGAGACAGG + Intronic
1156357254 18:36352485-36352507 CAATGCACAGTCGCTGAGCATGG - Intronic
1156360560 18:36381009-36381031 CAGTGCAAAGAACCTGGCCAGGG - Intronic
1157855735 18:51103893-51103915 CAGAGCAAAGAATATGATCAGGG - Intergenic
1158261378 18:55609744-55609766 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1159563624 18:70023208-70023230 GATTGCAGAGACTCTGAGCGAGG + Intronic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161497732 19:4596791-4596813 CAGTGCAAAGGCCCTGAGTCAGG - Intergenic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162189140 19:8931060-8931082 AGGTGCAAAGACTCTGAGGGTGG + Intronic
1162295542 19:9811010-9811032 CAGCTCAAGGACTCTGAGCTTGG + Exonic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162615653 19:11798549-11798571 GAGTGCAGAGACTCTGAGTGCGG - Exonic
1162747901 19:12809391-12809413 CAGTACAAAGGCCCTGAGCTGGG - Intronic
1162804553 19:13130366-13130388 CAGTGCAGAGAGGCTGGGCACGG - Intronic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162837887 19:13333282-13333304 AAGTGCAAAGGCCCTGAGCTAGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163632956 19:18426420-18426442 CAGTACAAGAGCTCTGAGCAGGG + Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1163919591 19:20276219-20276241 CAGGGCACAGTCACTGAGCAGGG + Intergenic
1163977115 19:20862946-20862968 CAGTGCACAGTCACTGAACAGGG + Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1165844596 19:38810024-38810046 CAGTGCAAAGGCCCTGAGACAGG - Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166195294 19:41201931-41201953 CAATGCAATGACTTTGAGCAGGG + Intronic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166515676 19:43445014-43445036 AAGTGCAAAGGTTCTGAGAAGGG + Intergenic
1166672537 19:44719507-44719529 CAGTGCAAAGGCCCCGAGGAAGG - Intergenic
1166807405 19:45495714-45495736 CAGTGCAAAGGCCCTGAGCCAGG + Intronic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167485183 19:49758604-49758626 CAGGGCAAAGAGTCTGGGCTGGG - Intronic
1167569484 19:50277997-50278019 CAGTGCAAAGGCCCTGAGATGGG + Intronic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
1168335717 19:55596502-55596524 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1168421511 19:56207228-56207250 CAGTGCAGGGACCCTGGGCAGGG - Exonic
1168426772 19:56245391-56245413 CAGTGCAGGGACCCTGGGCAGGG - Exonic
925568916 2:5288194-5288216 CTCTGCAAAGCCTCTGACCATGG + Intergenic
925853807 2:8110196-8110218 CAGTACCCACACTCTGAGCATGG + Intergenic
926801161 2:16662161-16662183 CAGTGCTAGGAGCCTGAGCATGG + Intronic
926812977 2:16772829-16772851 CAGCGCAAAGGCTCTGAGCAGGG - Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
929852442 2:45604604-45604626 AAGTGCAAAGACCCTGAGGCAGG - Intronic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
930122622 2:47772227-47772249 CAGTGCAGAGGCTCTGAGATGGG + Intronic
933292488 2:80453212-80453234 CCTTGCACAGACCCTGAGCAAGG - Intronic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
934932641 2:98440700-98440722 TAGTGCCAAGACTCTGGGGATGG + Intergenic
936637241 2:114272782-114272804 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937705042 2:124910920-124910942 CAGAGCAAAGACTCAGATTAAGG + Intronic
937817865 2:126273485-126273507 CACACCAAAGGCTCTGAGCAAGG - Intergenic
938898255 2:135774552-135774574 AAGTGCAAAGAAGCTGGGCATGG + Intronic
938951440 2:136258315-136258337 CTGAGCAAAGGCTCAGAGCAGGG + Intergenic
941005765 2:160245356-160245378 CAGTGCAAAGGCCCTGAGATGGG - Intronic
941162983 2:162055978-162056000 AAGTGCAAAGTCTCTGAGGCAGG - Intronic
942619093 2:177828671-177828693 CAGTGCAAAGCCCCTGAGGTGGG + Intronic
942675924 2:178426880-178426902 AAGTGAAAAAACTCTGAGCATGG - Intergenic
943103653 2:183516273-183516295 CAATGCAAATAATCTGAGCATGG + Intergenic
943659520 2:190543395-190543417 CAGTGTAAAAACTGTGAGCCAGG - Intergenic
944027502 2:195189180-195189202 CATTCCTAAGCCTCTGAGCATGG + Intergenic
944265829 2:197725310-197725332 AAGTGAGAAGACTCTTAGCAGGG + Intronic
944526738 2:200627262-200627284 CACTGCACATCCTCTGAGCAGGG - Intronic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
944968240 2:204960993-204961015 AAGTGCAAAGACCCTGAGGCAGG + Intronic
945737046 2:213613467-213613489 AAGTGCAAAGGCCCTGAGAATGG - Intronic
945932807 2:215872695-215872717 AATTGCAAAGGCTCTGAGCTGGG + Intergenic
946243327 2:218370345-218370367 AAGTGCAAAGGCTGTGAGCATGG + Intergenic
946872895 2:224100844-224100866 ATGTGCAAAGACTCTGAGGTGGG - Intergenic
947288292 2:228542895-228542917 GAGTGCAAAGACTCTGAGCTGGG - Intergenic
947436922 2:230080744-230080766 CAGTGCCCACACTCTAAGCATGG - Intergenic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1168846727 20:950172-950194 CAGTGTGAGGACTCAGAGCAGGG + Intergenic
1168971250 20:1932424-1932446 CAGTGCCAAGACCCTGAGACGGG + Intronic
1169025911 20:2371280-2371302 GAATGAAAAGATTCTGAGCAAGG + Intergenic
1169417302 20:5428276-5428298 CAGTCCACAGTCTCTGTGCAGGG + Intergenic
1170048312 20:12111548-12111570 GAGTGCAAAGACTATGAGGCAGG + Intergenic
1170286074 20:14710472-14710494 CTGTGGAAAGACGATGAGCATGG + Intronic
1170728983 20:18955796-18955818 CAGTGCCAGGACTTTGAGCCAGG + Intergenic
1170810603 20:19671221-19671243 CAGTGCAAAGGCTCTGGGAGAGG + Intronic
1170982841 20:21230926-21230948 CAGCTGAAAGGCTCTGAGCACGG - Intronic
1171238933 20:23549559-23549581 CTCTGGAAAGACTCTGTGCAAGG - Intergenic
1171245158 20:23604779-23604801 CTCTGGAAAGACTCTGTGCAAGG - Intronic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172281838 20:33713290-33713312 CAGTGCAAAGACCTTGAGATAGG - Intronic
1172781229 20:37437956-37437978 CAGTGCCAAGACCCTGAGAGAGG - Intergenic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1173288644 20:41694962-41694984 AAGTGCAAAGGCTCTGAGCGGGG + Intergenic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1174117614 20:48237992-48238014 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
1174264966 20:49324712-49324734 CAGTGCAAAGTCGCTGAGGCAGG - Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174390113 20:50213810-50213832 AAGTGCAAAGGCTCTGAGATGGG + Intergenic
1174394693 20:50239723-50239745 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1177904399 21:26958169-26958191 CAGTGCAAATACGCTGAGGGAGG + Intronic
1178050936 21:28746733-28746755 TAGTGCAAAAACTTTGAGAAGGG + Intergenic
1178081587 21:29072036-29072058 TAGTACAAAGACCCTGAGGAAGG - Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1178781156 21:35604400-35604422 CAGTGCCAAGCCCCTGGGCATGG - Intronic
1179177637 21:39020806-39020828 CACTCCATGGACTCTGAGCAGGG - Intergenic
1179523261 21:41959171-41959193 CTGTGCAGAGACACTGATCACGG - Intergenic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181414038 22:22746556-22746578 CAGTGACAGGACACTGAGCAGGG + Intronic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1183340063 22:37275089-37275111 CTGAGCACAGACTCTGAGCCAGG - Intergenic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1184568499 22:45308013-45308035 CAGACCCAAGACTCTGCGCAGGG - Intergenic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
949584826 3:5427244-5427266 CAGGGCTCAGACTCAGAGCAGGG - Intergenic
950016925 3:9760963-9760985 AAGTGCAAAGGCCCTGAGGAGGG - Intronic
950144428 3:10638831-10638853 CAGAGCAAAGAATATTAGCAGGG + Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950456988 3:13098622-13098644 CAGTGGAAAGGCTCTGAGCTAGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
951595872 3:24317564-24317586 CAGTGCAATGGCTCTGAGTGTGG - Intronic
953445436 3:42960898-42960920 CTGTGCATGGAGTCTGAGCAGGG - Intronic
953552077 3:43910905-43910927 CAGCTAACAGACTCTGAGCATGG - Intergenic
954123027 3:48511496-48511518 CAATGCAAAGGCTCTGAGTGTGG - Intergenic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
954996147 3:54883666-54883688 AAGTGCAAAGGCCCTGAGAAGGG - Intronic
955406426 3:58628458-58628480 AAGTGCAAAGGCCCTGAGAAGGG - Intergenic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
956897979 3:73683319-73683341 AAGTGCAAAGTCTCTGAGGCAGG + Intergenic
957764803 3:84609675-84609697 CAGTGCAAAGACTATCTGGATGG - Intergenic
958428809 3:94013113-94013135 TAGTACAAAGACCCTGAGGAGGG - Intronic
958715832 3:97779250-97779272 CAGTGCAATGATTCTGAGGAAGG - Intronic
959000334 3:100956848-100956870 CAGTGCAAAGACTCAGAGAAAGG + Intronic
959002738 3:100983178-100983200 CCTTGCTAAGACTCTGAACAGGG - Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
964419688 3:156488453-156488475 CAGTGCAAAGGCCCTGAGATGGG + Intronic
965859123 3:173125559-173125581 CAGTGCAAAGGTTCTGAGTTGGG - Intronic
967741570 3:193008850-193008872 AAGTGCAAAGACCCTGAGGCTGG - Intergenic
967937918 3:194743941-194743963 AAGTGCAAAGGCTCTGAGCCAGG - Intergenic
968821976 4:2861124-2861146 AAGTACAAAGACTCTGAGGCAGG + Intronic
969551391 4:7870321-7870343 CAGATCCAAGAGTCTGAGCAGGG + Intronic
970459525 4:16258911-16258933 CAGGGCAAGGACTCTGATCCAGG - Intergenic
971494490 4:27249501-27249523 CAGTGCAAGTGCCCTGAGCAAGG - Intergenic
971861447 4:32110954-32110976 AAGAGCAAAGACCCTGAGAAAGG + Intergenic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973333164 4:48930521-48930543 AAGTGCAAAGACCCTGAGGTTGG + Intergenic
973644572 4:52937204-52937226 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
974626998 4:64438620-64438642 CAGTGAAAAGACCTTCAGCAAGG - Intergenic
974737831 4:65961670-65961692 TAGTGCAGAGACTCAGAGTATGG + Intergenic
975044571 4:69785412-69785434 CACTACAAAGACTTTGGGCAAGG - Intronic
975441863 4:74420257-74420279 AAGTGCAAAGCCACTGAGCCTGG - Intergenic
975855982 4:78624842-78624864 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
976496079 4:85731316-85731338 CAATGCAAGGACTGTGAGTATGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977587905 4:98795208-98795230 CACTGCAAGGGCTCTGAGCCTGG - Intergenic
978874248 4:113619586-113619608 AAGTGCAAAGGCTCTGAGACAGG - Intronic
980847532 4:138342007-138342029 CAGCCCAAAGACACTGATCATGG - Intergenic
981767367 4:148266444-148266466 AAGTGCAAAGTCTCTGAGACAGG + Intronic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
984582569 4:181527003-181527025 CAGGGCTAAGTCACTGAGCAAGG - Intergenic
984731374 4:183070880-183070902 CACAGCAAGGACTCTGAGGAAGG - Intergenic
987130569 5:14856297-14856319 TATTGCAAAGACTTTGAGCATGG - Intronic
987543122 5:19280357-19280379 AAGTGCAAAGACTGTGAGACAGG - Intergenic
988485848 5:31667612-31667634 CAGTGCAAGGGCCCTGAGCAGGG + Intronic
988877526 5:35463939-35463961 CAGTGTATATACTGTGAGCAGGG - Intergenic
990343539 5:54849048-54849070 CAGTGCCAACCTTCTGAGCAGGG - Intergenic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
992622236 5:78605346-78605368 CACTGCCTGGACTCTGAGCAGGG + Intronic
992679612 5:79141009-79141031 CAGTGCCAAGGCTCTGAGGTAGG - Intronic
993454610 5:88113251-88113273 GTGTGCAAAGGCTCTGACCAGGG + Intergenic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
994672012 5:102773593-102773615 CAGTGCAGAAACAGTGAGCAGGG + Intronic
996060903 5:119032198-119032220 CAGTGCAAAGGCCCTGAGTGTGG - Intergenic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998835236 5:146196857-146196879 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999451240 5:151679713-151679735 CTCTGGAAAGACTCTGAGGATGG + Intronic
999509843 5:152238255-152238277 CAGTGAAAAAACACTGAGCAGGG - Intergenic
999711135 5:154319660-154319682 CATTGCAAAGAGGCTGGGCATGG - Intronic
1000006591 5:157190765-157190787 AAGTACAAAGACCCTGAGGAAGG + Intronic
1000303816 5:159977855-159977877 AAGTGCAAAGTCCCTGAGCTGGG - Intergenic
1000550412 5:162655195-162655217 ATGTACAAAGACTCTGAGGATGG - Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1003455527 6:6278433-6278455 CAGTGCAAAGACCCTGTGGGAGG + Intronic
1005199991 6:23333996-23334018 CAGTGCAAAGGTTCTGAGACAGG - Intergenic
1005765645 6:29009036-29009058 CTGTGCAAAGGCACTGTGCAAGG + Intergenic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1007078047 6:39080332-39080354 AAGTACAATGACTCTGATCATGG - Intronic
1007251236 6:40496515-40496537 CAGTGCAAAGATTCTAAGACTGG - Intronic
1008473038 6:51905488-51905510 TTGTGCAAAGACCCTGAGGAAGG + Intronic
1008493713 6:52111873-52111895 AAGTGCAAAGACCCTGAGAAAGG + Intergenic
1009557438 6:65191707-65191729 CAGTGCCAATACCCTGAACAAGG + Intronic
1010096562 6:72053186-72053208 CAGTTCAAAGAGTCTGGTCATGG - Intronic
1010700942 6:79046195-79046217 CAGTGCAAAGACCCTAAGTTTGG - Intronic
1011531267 6:88323887-88323909 CAGTGAAAAGACTAGCAGCAAGG + Intergenic
1012618189 6:101303589-101303611 CAGCCCAAAGACATTGAGCATGG - Intergenic
1012676146 6:102115420-102115442 CAGTGCAGAGATCCTGTGCAGGG - Intergenic
1013947257 6:115736144-115736166 CAGTGCAAAGGCTCTGTGTAGGG - Intergenic
1016213982 6:141573017-141573039 CAGTGCAAAGTCTCTGGGGAAGG + Intergenic
1016762314 6:147751111-147751133 CAGTGCAAAGGCCCTGAGATGGG - Intergenic
1017601333 6:156085575-156085597 CAGAGCAAAGACTATAACCAAGG - Intergenic
1020610167 7:10386141-10386163 CATTTCAAATACTCTGAGAAAGG + Intergenic
1022029467 7:26479160-26479182 AAGTGCAAGGGCACTGAGCAGGG - Intergenic
1022054255 7:26713145-26713167 AAATTCAAAGGCTCTGAGCATGG - Intronic
1023834517 7:44060417-44060439 CAGAACATGGACTCTGAGCAGGG + Intronic
1025002103 7:55325060-55325082 CAGTGCCAGGACTCACAGCATGG - Intergenic
1025788561 7:64666524-64666546 CAGGGCACAGTCACTGAGCAGGG - Intronic
1025813054 7:64887823-64887845 CAGGGCTCTGACTCTGAGCAGGG + Intronic
1026382453 7:69813180-69813202 TAATGCAAAGACTCTGAGTTGGG - Intronic
1026393402 7:69926400-69926422 CAGAGCAAAGACTATTACCAGGG - Intronic
1028130809 7:87170508-87170530 AAGTGCAAAGGCTCTGAGACAGG - Intronic
1028159823 7:87473418-87473440 CAATGCAAAGACCCTGAGTCAGG - Intronic
1028505952 7:91570338-91570360 GAGGGCAAGGACTCTGTGCAAGG - Intergenic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1030289532 7:107858522-107858544 AAGTGCAAAGGCCCAGAGCAGGG - Intergenic
1030328352 7:108246231-108246253 CAGAAGAAAGACTGTGAGCATGG - Intronic
1030385680 7:108865207-108865229 CAATGCAAAGACTTTGAGATAGG - Intergenic
1030717483 7:112827063-112827085 CAGAGCAAAGAATATGATCAGGG - Intronic
1032220379 7:129989913-129989935 CAATCCTAAGACTCTGGGCACGG + Intergenic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1032682907 7:134203756-134203778 CAGTGCAGAGATTCTGAGCAGGG - Intronic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037737539 8:21579614-21579636 CAGAGAAGAGACTCTGAGCTGGG - Intergenic
1037751772 8:21686912-21686934 CACTGGAAAGGCTCTGAGCAGGG + Intergenic
1038925782 8:32137790-32137812 CAGCGCATAGACTCTCAGAAGGG - Intronic
1039277405 8:35948517-35948539 CAGTTCAAATACTATAAGCAGGG - Intergenic
1040054941 8:43049330-43049352 AAGTCCAAAGATACTGAGCAGGG - Intronic
1040987419 8:53311550-53311572 CAGTGCTATGTCTCTGAACATGG - Intergenic
1041967078 8:63690915-63690937 CAGTGCTAAGCCTCTGTGAATGG - Intergenic
1042375058 8:68040491-68040513 CAGTACAAAGGCCCTGAGAAGGG - Intronic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1043658978 8:82710540-82710562 CAGTCCAAAGATGCAGAGCAGGG + Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1045094614 8:98784811-98784833 CTGTGCAGAGATTCTGTGCAGGG + Intronic
1045496708 8:102715446-102715468 AGGTGCAAAGACTCAGCGCAAGG - Intergenic
1045564865 8:103303546-103303568 AAGTACAATGCCTCTGAGCATGG + Intronic
1045748930 8:105458769-105458791 AAGAGCAAAGACTCTGAAGATGG - Intronic
1048364224 8:133724287-133724309 TAGTGCAAAAACTCTGAGGCAGG - Intergenic
1048682210 8:136855753-136855775 AAGTGGAAAGACTCAGAGTATGG + Intergenic
1048881322 8:138875012-138875034 CAGTGAAGAGACTCTGATGAAGG - Intronic
1049649594 8:143759297-143759319 CAGTGCCAGAACTCTGTGCAAGG - Intergenic
1050697608 9:8296866-8296888 CTGCGCATACACTCTGAGCAGGG - Intergenic
1050941473 9:11464729-11464751 CATTGCAAAGACTCTTGTCAAGG + Intergenic
1051139829 9:13966398-13966420 CATTGGAAAGAGTCTGATCATGG - Intergenic
1053130268 9:35610527-35610549 CAGAGCAGGGACTCAGAGCAGGG - Intronic
1053877090 9:42556055-42556077 CAGAGCAAAGACTATTACCAGGG - Intergenic
1053895584 9:42738638-42738660 CAGAGCAAAGACTATTACCAGGG + Intergenic
1054234606 9:62545667-62545689 CAGAGCAAAGACTATTACCAGGG + Intergenic
1054265234 9:62910723-62910745 CAGAGCAAAGACTATTACCAGGG + Intergenic
1055157155 9:73078373-73078395 CAGCTCAAAGACAATGAGCAGGG - Intronic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1058115045 9:101075930-101075952 CAGTGCAAAGACCCTGAAACTGG + Intronic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1058723737 9:107782816-107782838 CAGTCCAAAGACTCTCAACTGGG - Intergenic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1058970125 9:110073722-110073744 CAGAGAAAAGACTCTGGGGAGGG - Intronic
1059334974 9:113563344-113563366 CAGAGCATAGACTCTGTGCCAGG - Intronic
1060553815 9:124498357-124498379 CAATTCAAAGACTTTGAGAAGGG + Intronic
1060835818 9:126754582-126754604 CTGTGCAAAGACTCAGAGGAGGG - Intergenic
1060975864 9:127764610-127764632 AAGTGCAAAGACCCTGAGGTGGG - Intronic
1061469915 9:130816198-130816220 AAGTGCAAAGGCCCTGGGCAGGG - Intronic
1061750425 9:132773191-132773213 CAGTGCAAAGGCCCTGAGTTAGG - Intronic
1185477486 X:424177-424199 GTGTGCAAAGACTCTGAGCTGGG + Intergenic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1187006262 X:15235591-15235613 CAATACAAAGACTCAGAGAATGG - Intronic
1187452556 X:19411737-19411759 AAGTGCAAAGGCCCTGAGGAGGG + Intronic
1189305782 X:39985683-39985705 CAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1189464903 X:41271142-41271164 CAGTGAAAATACTCTGGGCTGGG + Intergenic
1191666062 X:63703918-63703940 CAGTGCAAAGGCTCTAAGGGAGG + Intronic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1192911534 X:75609654-75609676 GAGTGCAAAGACAGTGAGAAAGG - Intergenic
1193148108 X:78098142-78098164 CAGTGCAGAAAATCTGAGCAAGG + Intronic
1196175566 X:112635948-112635970 CAATGGAAAGTTTCTGAGCAGGG + Intronic
1197809515 X:130428969-130428991 AAGTGCAAAGACCCTGAGGTGGG + Intergenic
1198727563 X:139692697-139692719 CTGGGCAAAGACTCGGCGCAAGG + Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199709382 X:150457976-150457998 CAGTCCAAAGACTCTTCCCATGG - Intronic
1199799835 X:151239508-151239530 CTGTGCAAAGAATGTGAGGAAGG - Intergenic
1201228698 Y:11843045-11843067 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic