ID: 1071482949

View in Genome Browser
Species Human (GRCh38)
Location 10:86078774-86078796
Sequence GCCAGGGGGCTGGGGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 9, 3: 83, 4: 730}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071482949_1071482964 30 Left 1071482949 10:86078774-86078796 CCTAGGACCCCCAGCCCCCTGGC 0: 1
1: 0
2: 9
3: 83
4: 730
Right 1071482964 10:86078827-86078849 CCTTCCCCCAGCACCCAGCATGG No data
1071482949_1071482958 -4 Left 1071482949 10:86078774-86078796 CCTAGGACCCCCAGCCCCCTGGC 0: 1
1: 0
2: 9
3: 83
4: 730
Right 1071482958 10:86078793-86078815 TGGCCTTGCAGCTAAATCCCTGG No data
1071482949_1071482959 -3 Left 1071482949 10:86078774-86078796 CCTAGGACCCCCAGCCCCCTGGC 0: 1
1: 0
2: 9
3: 83
4: 730
Right 1071482959 10:86078794-86078816 GGCCTTGCAGCTAAATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071482949 Original CRISPR GCCAGGGGGCTGGGGGTCCT AGG (reversed) Intronic
900119218 1:1041464-1041486 GACAGGGGTCTGGGGGTCGAGGG - Exonic
900130956 1:1087080-1087102 TCCTGGGGGCTGGGGGCCGTCGG - Intronic
900136024 1:1117194-1117216 GCAAGGGAGCTGGGGGGTCTGGG - Intergenic
900296714 1:1955608-1955630 TCCAGGGGGCTGAGGGGCCCAGG - Intronic
900459930 1:2798168-2798190 GCTGGGAGGCTGGGGGTACTGGG - Intronic
900464819 1:2820586-2820608 GCCAGGGGGCCAGGGGTCCAGGG + Intergenic
900464865 1:2820685-2820707 GCCAGGGGGCCAGGGGGCCAGGG + Intergenic
900494152 1:2968926-2968948 GGCAGGAGGCTGGTGGGCCTCGG - Intergenic
900594871 1:3476185-3476207 GCCTGGGGGCTGGGCCTCCTAGG + Intronic
900656757 1:3762473-3762495 GCCAAGGGGCTGGGGGATGTGGG - Intronic
900754514 1:4424436-4424458 GCCAGGTGGCAAGGGGTTCTCGG + Intergenic
901004445 1:6165185-6165207 GCCTGGGGGCTGGGGGCCAGGGG - Intronic
901232119 1:7647140-7647162 GCTGGGGGTCTGGGGATCCTGGG - Intronic
901325236 1:8361348-8361370 TCCTGGGGGCTGGGGATGCTCGG + Exonic
901399816 1:9008063-9008085 TCCACGGGTCCGGGGGTCCTAGG - Intronic
901405557 1:9042738-9042760 AGCTGGGGGCTAGGGGTCCTGGG - Intronic
901506590 1:9689472-9689494 GGCTGGGGGCGGGGCGTCCTCGG - Intronic
901716086 1:11155705-11155727 CCCAGGGGGCTGTGGGTAATAGG - Intronic
902242710 1:15099584-15099606 CACATGGGGCTTGGGGTCCTGGG - Intronic
902810582 1:18885747-18885769 GGCAGGGGGCTGAGGGCCCAGGG - Intronic
903183971 1:21619203-21619225 GCTAGCTGGCTGGGGGCCCTGGG + Intronic
903292531 1:22323735-22323757 CCCAGGGTGCTGGGTGACCTTGG + Intergenic
903322574 1:22551868-22551890 GCCTAGGGGCTGGGGGCGCTGGG - Intergenic
903328087 1:22582737-22582759 ACCAGGGTGCGGGGGGTGCTGGG - Intronic
903371196 1:22837261-22837283 GAAAGGGGACTGGGGGTCCCAGG - Intronic
903879664 1:26500402-26500424 GCCCGCGGGATGGGGCTCCTCGG + Intergenic
903884103 1:26531103-26531125 CCCTGGGGGCTGGGGACCCTGGG - Intronic
905240049 1:36575635-36575657 ACCAAGGGGCTGGGGGGCATGGG - Intergenic
905309272 1:37038138-37038160 GGGAGGGGGCTGGGAGTCTTGGG - Intergenic
905422891 1:37860162-37860184 AGAAGGGAGCTGGGGGTCCTAGG - Intergenic
905634070 1:39537575-39537597 GCCAGGGGACTAGGGGGCGTAGG + Intergenic
905833508 1:41094994-41095016 GCCAGGGGTTTGGGGGTGATGGG - Intronic
906109442 1:43313130-43313152 GTCGGGGGGCTGGAGGCCCTGGG - Exonic
906231765 1:44170585-44170607 GCTAGGGGGCTGGCGGTCAGAGG + Intergenic
906263148 1:44407860-44407882 GCTCGGGGGCTGGAGGTCCTTGG + Intronic
906317704 1:44799125-44799147 GCCAGGAGGCCTGTGGTCCTGGG + Intergenic
907291021 1:53412902-53412924 GGCAGGGGGCTGGCAGTCCAGGG + Intergenic
907540820 1:55214734-55214756 GCCACTGGGCTGGAGTTCCTGGG - Intronic
908179459 1:61589414-61589436 GGCTGGGGGCTGGGGGTCTTCGG + Intergenic
908940311 1:69424399-69424421 GACAGAGGCCTGGGGGTGCTTGG - Intergenic
909752259 1:79177401-79177423 GTCAAGGGGCTAGGGGTCTTGGG - Intergenic
909863085 1:80633358-80633380 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
910760830 1:90729644-90729666 GCCGGGGCGCTACGGGTCCTCGG + Intergenic
911761195 1:101619223-101619245 GCCTGGGGTCTGGGGACCCTGGG + Intergenic
912401022 1:109392928-109392950 GCTAGACGGCTGGGGGTGCTAGG + Intronic
912549030 1:110472657-110472679 GCCAGGAGGCTGGGTAGCCTCGG + Intergenic
915299075 1:154941804-154941826 GCCTGGGGCCTAGGGGACCTGGG + Intergenic
915306673 1:154983852-154983874 GCCTGGGAACAGGGGGTCCTGGG - Exonic
915463029 1:156081126-156081148 TCCAGGCGGCTGGGGGCCCCAGG + Intronic
918004516 1:180529222-180529244 TGCAGGGAGCTGGGTGTCCTTGG + Intergenic
918047079 1:180948063-180948085 GCGAGGGTGCCGGGGGCCCTGGG - Exonic
918434859 1:184500888-184500910 GCCGGGGGGCTGGGGGTATGAGG - Intronic
918955190 1:191198826-191198848 GCCTGGGGGGAGGGGCTCCTGGG + Intergenic
919370883 1:196724281-196724303 GACAGAGGGCTGAGGTTCCTGGG + Intronic
919743085 1:200992221-200992243 ACCAGGAGGCTGGGAGTGCTAGG + Intronic
919861333 1:201740887-201740909 GAAAGGGGGCTGGGGTTTCTGGG + Intronic
920366260 1:205449835-205449857 GGCCAGGGGCTGGGGGTCCCAGG + Intronic
920416164 1:205800529-205800551 GCCGGGGGGCTGGGGGTGCTGGG + Intronic
920424758 1:205866178-205866200 GCCCAGGGGTTGGGGATCCTTGG + Intergenic
920878728 1:209860933-209860955 GCCAGGGGGCTGTTGGGCTTGGG - Intergenic
921573035 1:216801416-216801438 GACAGGGGGCAGGGGGTTGTCGG - Intronic
922879727 1:228971550-228971572 GCCAGGGAGTTGGTGGTCCGTGG + Intergenic
924068767 1:240254544-240254566 GCCAGGGGTAGGGGGGACCTGGG - Intronic
1062843665 10:689330-689352 GCGCGGGGTCTGGGGGTCCGGGG + Intronic
1062882172 10:988038-988060 TCCGGGAGTCTGGGGGTCCTGGG - Exonic
1063449158 10:6140090-6140112 GCCAGAAGGCTGGGGGATCTGGG - Intergenic
1066780820 10:38943000-38943022 GGCAGGGGGCTCGGGAGCCTAGG - Intergenic
1066989635 10:42500632-42500654 GCGGGGGGGGGGGGGGTCCTCGG - Intergenic
1067495467 10:46756962-46756984 GCAAGGGGGCAGGGGGGTCTAGG + Intergenic
1067539893 10:47143785-47143807 GCCAGAGGGCAGGGGGGCCTGGG + Intergenic
1067599186 10:47583426-47583448 GCAAGGGGGCAGGGGGGTCTAGG - Intergenic
1067681231 10:48442596-48442618 GCCATGGGGATGGGGAGCCTCGG - Intergenic
1067948847 10:50710011-50710033 GCAAGGGGGCAGGGGGGTCTAGG - Intergenic
1069197384 10:65570394-65570416 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1069950768 10:72016650-72016672 CCCAGGGTGCTGGGGGTTATAGG - Intergenic
1070813170 10:79308447-79308469 AGCACGTGGCTGGGGGTCCTGGG + Intronic
1070884165 10:79875003-79875025 GCAAGGGGGCAGGGGGGTCTAGG - Intergenic
1071430585 10:85603336-85603358 GCAAGGGGGCGTGGGTTCCTGGG + Intronic
1071472304 10:85992256-85992278 GCCAGGGTGCTGGTCTTCCTTGG - Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1071650719 10:87391303-87391325 GCAAGGGGGCAGGGGGGTCTAGG - Intergenic
1071926556 10:90416005-90416027 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1072538537 10:96381208-96381230 GCCAGGCGGCTGGAGGACCAGGG - Intronic
1073074537 10:100815545-100815567 GGTTGGGGGCTGGAGGTCCTTGG - Intronic
1073951468 10:108814129-108814151 GCCATGGGGCAGGGATTCCTTGG + Intergenic
1074186625 10:111103840-111103862 GCCCGGGGGCCGGGGGGTCTTGG - Intergenic
1074823875 10:117201052-117201074 GCAAAGGGGCTGCTGGTCCTTGG + Intronic
1075020546 10:118948942-118948964 GGCAGGGGGCTGCGAATCCTTGG - Intergenic
1075400634 10:122159092-122159114 TCCAGGGAGCTGGGGGAGCTGGG + Intronic
1075483397 10:122800403-122800425 GCCTGGGGGCAGGGGAGCCTGGG + Intergenic
1076131372 10:128016358-128016380 ACCTGGGGGCTGGGGGTGCCTGG - Intronic
1076410234 10:130244194-130244216 GGGAAGGGGCTGTGGGTCCTGGG + Intergenic
1076437069 10:130453796-130453818 GCCAGGGGTGTTGGGATCCTCGG + Intergenic
1076484739 10:130808775-130808797 GTGAGGGGCCTGGGGGTTCTAGG - Intergenic
1076750798 10:132541834-132541856 GCCAGGTGGCTGGGGTGCCTGGG + Intronic
1076899123 10:133328498-133328520 GCCTGAGATCTGGGGGTCCTTGG - Intronic
1077037311 11:501679-501701 AGCTGGGGGCTGGGAGTCCTCGG - Intronic
1077254123 11:1572918-1572940 GCGGGAGGGCTGGGGGTCGTGGG - Intergenic
1077309965 11:1883950-1883972 ACCAAGGGGCTGGGTGTCCTGGG - Exonic
1077553245 11:3213481-3213503 GAGAGGGGGCTGTGGATCCTGGG - Intergenic
1077608084 11:3625768-3625790 GACCTGGGGCTGGGGGTCTTGGG - Intergenic
1078063277 11:8061803-8061825 GCAAGAGAGCTGGGGGACCTTGG - Intronic
1078265829 11:9755911-9755933 GGCAGTGGGCTGCGGGTCTTGGG - Intergenic
1079229009 11:18633791-18633813 GTTAGGGGGTTTGGGGTCCTTGG - Intronic
1080454568 11:32406525-32406547 GCCCGGGGGTTGGGGGCCTTTGG + Intronic
1081723379 11:45306442-45306464 CCCAGGATCCTGGGGGTCCTGGG - Intergenic
1081758424 11:45560632-45560654 GCCAGGGCGCTCTGGGCCCTCGG - Intergenic
1081779542 11:45700429-45700451 GCCAGGTGGGAGGGGGTCCCTGG - Intergenic
1082773640 11:57228916-57228938 GACAAGGGGCTGGGAGTACTAGG + Intergenic
1083252551 11:61477769-61477791 GACCGGGGTCGGGGGGTCCTAGG - Intronic
1083562224 11:63681826-63681848 GCCTGGGGGCTGGGGGGATTAGG + Intronic
1083571982 11:63765887-63765909 GCCGAGGGCCTGGGGGTCCAGGG - Exonic
1083629501 11:64088343-64088365 ACCAGGGGGCAGTGGGGCCTTGG + Intronic
1083644376 11:64164282-64164304 GTGATGGGGCTGGGGTTCCTGGG - Intronic
1083657685 11:64237547-64237569 GTCAGGGCGCTGGTGGTGCTGGG - Exonic
1083879940 11:65543361-65543383 CCCTGGGGGGTGGGGGTCCTGGG + Intronic
1083883883 11:65561337-65561359 GCCTGTGGGCTGAGGGGCCTGGG + Intergenic
1083935077 11:65865797-65865819 GCCAGGAGGCTGGGGGGCAGGGG - Exonic
1084007790 11:66332408-66332430 GCCAGGGAGATGGGGATGCTGGG - Exonic
1084326200 11:68401605-68401627 CCCAAGGGGCTCTGGGTCCTCGG - Intronic
1084381820 11:68817657-68817679 GGCAGGAGGCTGGGGGTCAAGGG + Intronic
1084387739 11:68854754-68854776 GCAGAGGGGCTGGGGGTCCAGGG + Intergenic
1084489572 11:69471130-69471152 GCGAGGGGGCCGGGGGTGCGCGG - Intergenic
1084513016 11:69617835-69617857 GCCAGGGGGCTCGGGGCCCTGGG - Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1085029046 11:73258565-73258587 GGAAGGGGGCTGGGGGTTCTAGG + Intergenic
1085311457 11:75519335-75519357 GCCAGGGGCCTGGGGTTGCCCGG - Intronic
1085518474 11:77124709-77124731 GCCAGGCAGCTGGGGGCCTTTGG + Exonic
1085922968 11:80981072-80981094 CCCAGGGGGTTGGGAATCCTTGG + Intergenic
1087083553 11:94194940-94194962 CCCTGGGGGCTGGGGTTCCCTGG - Intergenic
1087130881 11:94668510-94668532 GCCAGGGGGCTGGGGGCCGGGGG - Intergenic
1088541909 11:110921727-110921749 GCCAGGGTGCTGGGGGGCCGTGG - Intergenic
1089255602 11:117192391-117192413 GGGAGGGGTCTGGGGGGCCTTGG + Intronic
1089378311 11:118010792-118010814 TCACGGGGGCTGGGGGTCCAAGG - Intergenic
1089959678 11:122604748-122604770 GGCAGTGGGCTGGGGGTTCAGGG + Intergenic
1090146960 11:124335301-124335323 TCCAGAGGGCTGGGAGTCCTAGG - Intergenic
1090352161 11:126114618-126114640 GCCAGGATGGTGGAGGTCCTGGG - Intergenic
1090380815 11:126326373-126326395 CACACGGGGCTGTGGGTCCTTGG + Intronic
1090558577 11:127903702-127903724 TCCAGGGGGTTGGGGGTCTGAGG - Intergenic
1090837508 11:130464020-130464042 GCAAGGAGGCGGGCGGTCCTGGG + Intronic
1091037180 11:132244798-132244820 GCCGGTGGGCTGGGGGAACTGGG - Intronic
1091309256 11:134561107-134561129 GCCATGGGGCTGGAGCTCCCTGG + Intergenic
1091775469 12:3182107-3182129 GACTGGGGGCCGGGGGTCCAGGG - Intronic
1091844507 12:3645496-3645518 GCCAAGGGGCTGGGGGTGGTGGG + Intronic
1092578458 12:9814499-9814521 CCCAGGGGCCTGGGGATCCATGG + Intergenic
1093146728 12:15575382-15575404 GTCAGGTGGGAGGGGGTCCTTGG - Intronic
1093576023 12:20730893-20730915 GCCAGGGGGCTGCCGGCACTAGG + Intronic
1094496789 12:30993840-30993862 GGCAGTGGGCAGGGGGTGCTGGG + Exonic
1094870881 12:34598654-34598676 CACAGGGTGCTGGGGATCCTGGG + Intergenic
1095628269 12:44343548-44343570 GCCAGGGGCCTGGGGGACAGGGG + Intronic
1096495514 12:52037327-52037349 GCCTGGAGGCCGGGGGTCCCGGG - Intronic
1096523289 12:52196000-52196022 GGCTGGGGGCTGAGGGTCTTTGG + Intergenic
1096534432 12:52262335-52262357 GGCAGGGGGCTGGGGGGCTCTGG - Intronic
1096634651 12:52950423-52950445 GCTAGAGAGCTGGGGGTCCAGGG + Intronic
1096648635 12:53051168-53051190 GCCAGGGTGCAGGGGGTCGGGGG + Intronic
1096725328 12:53556760-53556782 GCCAGGGGGCTGTGGGTGCTTGG + Intronic
1097263386 12:57732339-57732361 GCAGAGGGGCTGGGGATCCTAGG - Intronic
1097268423 12:57759193-57759215 GCTGGGGGGCTGGAGGCCCTAGG - Exonic
1098805453 12:75016141-75016163 GCCAGGTGGGAGGGGGTCCCTGG - Intergenic
1101163449 12:102004279-102004301 TTCAGGTGGCTGGGGGGCCTTGG - Intronic
1101302414 12:103495685-103495707 GGCAGGGGGGTGGGGGGCCAAGG - Intronic
1101346639 12:103891989-103892011 GCCTGGGTGCTGGGTGGCCTTGG - Intergenic
1102033956 12:109760434-109760456 GCCAGGGGGATGGAGGACCTGGG + Intronic
1102581395 12:113890545-113890567 GCCAGTGGGGTGGGGGTGATCGG - Intronic
1102789645 12:115634228-115634250 GCCAGGGGGCTCTTGGGCCTTGG - Intergenic
1103411019 12:120711122-120711144 GCCAGAGGGCTGGGGGAGCCTGG - Intronic
1103727054 12:123003229-123003251 GCCATGAGCCTGGTGGTCCTGGG - Intronic
1103962378 12:124617206-124617228 CCCCGGGGGCAGGGGGTGCTGGG - Intergenic
1104285328 12:127419461-127419483 GCTAGGGGCCTGGGGCACCTGGG + Intergenic
1104636089 12:130438499-130438521 GTGGGGGTGCTGGGGGTCCTGGG + Exonic
1104939956 12:132390411-132390433 GCCAGGGAGCGTGGGGTCCTTGG - Intergenic
1105223863 13:18409137-18409159 GAGTGGGGGCTGGGGGTCCTGGG + Intergenic
1106434188 13:29709195-29709217 GCCAGGGGCTGGGGGTTCCTGGG - Intergenic
1106773903 13:32990278-32990300 CTCAAGGGGCTGGGGGTGCTGGG - Intergenic
1106913505 13:34487870-34487892 GGCAGGGGGCTTCGGCTCCTTGG + Intergenic
1108344583 13:49532591-49532613 AAAAGGGGGCTGGGGCTCCTAGG + Exonic
1108417145 13:50209189-50209211 GGCAGGGGGCTGGGGGTAGAAGG + Intronic
1111823062 13:93236422-93236444 GCCTGGGGGTTGGGGATCCCTGG - Intronic
1112050667 13:95641909-95641931 GCTGGGGAGCTGGGGGTCCGGGG + Intronic
1112192424 13:97191188-97191210 GCCAGGTGGGAGGGGGTCCCCGG + Intergenic
1113335417 13:109372236-109372258 GACTGGAGACTGGGGGTCCTGGG - Intergenic
1113904956 13:113814890-113814912 GCCCCGGGGCAGGGGGTGCTGGG + Exonic
1113952116 13:114077730-114077752 GCCAGGGGACTGGGCATCATCGG - Intronic
1114008010 14:18333963-18333985 GAGTGGGGGCTGGGGGTCCTGGG + Intergenic
1114632265 14:24166710-24166732 GCCTGGGCCCTGTGGGTCCTGGG + Exonic
1115651308 14:35404383-35404405 GGCCCGGGGCTGGGGGTCGTCGG - Intronic
1115771478 14:36666825-36666847 GTCAGGGCGCTGGGGGTCTGGGG + Intronic
1116176220 14:41473535-41473557 GCCAGGGGATTGGGGGCACTGGG + Intergenic
1117157017 14:52951229-52951251 GGGAGGGGGCTGCGGGTCCCGGG + Intronic
1117617524 14:57548710-57548732 GCCAAGGACCTGGGGGTCGTTGG + Intergenic
1117630385 14:57684616-57684638 GCCAGGAGGTTGGGGAGCCTGGG + Intronic
1117828536 14:59727485-59727507 TCCAGGGGGCTGGGGATGGTTGG + Exonic
1118346134 14:64942533-64942555 CCCAGGCGCCTGGTGGTCCTTGG - Exonic
1118895390 14:69941460-69941482 ACGAAGGGGCTGGGTGTCCTGGG - Intronic
1119428626 14:74551620-74551642 GACAGGGGGCTGGAGTTCCAGGG - Intronic
1119927683 14:78511826-78511848 GCCTGGGAGCTGGAAGTCCTGGG - Intronic
1121252991 14:92513609-92513631 GCCTCGGGGCGGGGGGTGCTGGG - Intergenic
1121491668 14:94365370-94365392 GCCAGGGTGCTGGGGGCCCCAGG - Intergenic
1121494417 14:94381948-94381970 GCCAGGGTCCTGGGGGCCCCAGG - Intronic
1121774931 14:96584291-96584313 GGGAGGGGGCTGAGGGACCTTGG - Intergenic
1122080251 14:99262209-99262231 GCCAGGGAGGGCGGGGTCCTTGG - Intronic
1122268766 14:100558966-100558988 GCCTGGGGCCTGGGGGTTGTTGG + Intronic
1122280861 14:100621801-100621823 GCCACGGGGCTGCGGGATCTTGG - Intergenic
1122399146 14:101457402-101457424 GCCGTGGGGCGGGGGGTCCCAGG + Intergenic
1122419067 14:101564082-101564104 GACAGGAGGAGGGGGGTCCTGGG - Intergenic
1122540770 14:102496592-102496614 GGCAGGTGGCAGGGGCTCCTGGG + Intronic
1122599550 14:102914566-102914588 CCCTGGGGCCTGGGGGTCCCTGG - Intergenic
1122754772 14:103969828-103969850 GTGGGGGGGCTGTGGGTCCTGGG + Intronic
1122770507 14:104095662-104095684 CCCAGGGGCCCGGGGCTCCTAGG + Intronic
1122796784 14:104210082-104210104 GCCAGTGGGCTGTGGGTGCTGGG + Intergenic
1122811897 14:104293353-104293375 GCCAGGGGCCTGGAGGGCCAGGG + Intergenic
1122822587 14:104354882-104354904 GGCTGGGGGCTGGGGGTTGTGGG + Intergenic
1122937848 14:104968137-104968159 GCCAGGGCGCTGGGGGGCCCGGG - Intronic
1123016128 14:105376573-105376595 ACCTGGGGACCGGGGGTCCTCGG + Intronic
1123038957 14:105482685-105482707 GGAAGGGTGCTGGGGGTCCCGGG - Intergenic
1123048947 14:105531454-105531476 TCAAGGGGGCTGGGGGGCCGGGG + Intergenic
1123083286 14:105706078-105706100 GCCAGAAGGCGGGGGGCCCTGGG + Intergenic
1202898832 14_GL000194v1_random:24464-24486 GCCACGGAGAAGGGGGTCCTGGG - Intergenic
1202902133 14_GL000194v1_random:50149-50171 GCCACTGGGCTGGGGCTCATGGG - Intergenic
1202894228 14_KI270722v1_random:188876-188898 GCCTGGGGGTTGGGGATCCCTGG - Intergenic
1125750217 15:42022803-42022825 GCCAGGGGGTTGGGGGCCCCTGG + Intronic
1126143706 15:45457197-45457219 GCAAGGGGGGCGGGGGTGCTGGG + Intergenic
1126285329 15:47003793-47003815 GACATGGGGGTGGGGGTACTGGG - Intergenic
1127553379 15:60063121-60063143 GGCAGGGGGCGGGGGGACGTGGG + Intergenic
1127863358 15:63012523-63012545 GCCTGGGGGTTGGAGGTCCCTGG - Intergenic
1128003508 15:64216641-64216663 GCCATGGTGCTGGAGCTCCTTGG - Exonic
1128240851 15:66100103-66100125 GCACGGGGGCAGGGGGACCTTGG - Intronic
1128245160 15:66127892-66127914 GCCACGGGGCTGCCAGTCCTGGG + Intronic
1128995499 15:72291514-72291536 GCTAGGCAGATGGGGGTCCTTGG + Intronic
1129024167 15:72553544-72553566 GCCTAGGGGCTGGGGGACTTGGG - Intronic
1129108120 15:73322883-73322905 GCCCCGGCGCTGGGGGACCTGGG + Exonic
1129262001 15:74373897-74373919 GGCAGGGGACTGGGGGCCCCGGG + Intergenic
1129266604 15:74396726-74396748 GTCAGGGGGCTGGAGGACATGGG + Intergenic
1129271483 15:74421519-74421541 GCCAGGAACCTGGGGGTCATGGG - Intronic
1129330446 15:74824361-74824383 GCCAGGTGGGCGGGGGGCCTTGG - Exonic
1129656275 15:77527436-77527458 GCCCGGGGCCTCGAGGTCCTGGG + Intergenic
1130307919 15:82727094-82727116 GCCTTGGGGCTCGGGGGCCTCGG + Intergenic
1131062637 15:89413340-89413362 GCCAGGGGGCTGGGAGTTGGGGG - Intergenic
1132150146 15:99453283-99453305 GGGAGGGGGCTGTGGGTCCCAGG - Intergenic
1132574368 16:657785-657807 GCCAGGGCGCTGGGGCTCGCGGG - Exonic
1132619232 16:856496-856518 GCCGGGAGGGTGGGGATCCTGGG + Intronic
1132644476 16:992458-992480 GGCAGGGGCCTGGGGGTCCCTGG + Intergenic
1132670986 16:1102252-1102274 GCCAGGGGACGGGAGGTGCTGGG + Intergenic
1132850226 16:2021722-2021744 GCCTGGTGGATGGAGGTCCTCGG - Intergenic
1132909914 16:2304182-2304204 GCCAGCAGGCTGGGGGGCCCAGG + Intronic
1132993146 16:2807749-2807771 GGCCTGGGGGTGGGGGTCCTGGG - Intergenic
1133050677 16:3115685-3115707 GCCAGGGGGCTGTGGGCCATGGG - Intronic
1133297553 16:4762318-4762340 GCCGGGGAGCTGGAGGGCCTGGG + Exonic
1133333630 16:4991952-4991974 TCCAGGGAGCTGGGGTCCCTCGG - Exonic
1133763864 16:8821688-8821710 GCCAAGGGGCTAGTGGCCCTAGG - Intronic
1134040004 16:11061046-11061068 AGCAGGGGGCTGGGGGACATGGG + Intronic
1134108413 16:11499710-11499732 GCCAGGCAGCTGGGGTCCCTGGG - Intronic
1134607336 16:15581473-15581495 GCCAGAAGGCTGGGGTTCCTTGG - Intronic
1134607825 16:15584913-15584935 ACCAAGAGGCTGGGGGTACTGGG + Intronic
1134626608 16:15726975-15726997 GCCGGGGAGCTGCGGGTCCTGGG - Exonic
1134831969 16:17331105-17331127 GCCAAGGGGCTGTGGGGACTCGG - Intronic
1135521741 16:23183050-23183072 TCCGGGGGTCTGGGGGTCCCGGG + Intronic
1135553495 16:23416447-23416469 GCCAGGGAGCTCTGGGTCCAAGG + Intronic
1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG + Exonic
1136060928 16:27725976-27725998 GCCTGGGGGCTGGGGACCCCTGG - Intronic
1136189398 16:28606674-28606696 GGGAGGGGGCTGGGTGGCCTTGG + Intronic
1136232464 16:28894689-28894711 GGCAGAGGGCTGGGTGTACTGGG - Intronic
1136540379 16:30924886-30924908 CCCGGGAAGCTGGGGGTCCTAGG + Intronic
1136570546 16:31094100-31094122 GCCAGGGAGCTGGAGATTCTGGG - Intronic
1136997719 16:35202169-35202191 GCAAGGAGGCTGAGGGTCCTTGG + Intergenic
1137024129 16:35456324-35456346 GTAAGGAGGCTGAGGGTCCTTGG + Intergenic
1138514012 16:57526035-57526057 GCCTGGGGGCTGGGGGCCCGCGG - Exonic
1139429727 16:66904702-66904724 GCGAGGAGGCTGGGGGTACCAGG - Intergenic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1141179428 16:81742461-81742483 GCATGGGGGCTGGGGCTCCAGGG - Intronic
1141516596 16:84549083-84549105 GGCAGGGGACTGGGGATCCAAGG - Intronic
1141605089 16:85148273-85148295 GCCAGGGGGCTGGGGAACCACGG - Intergenic
1141697627 16:85627667-85627689 GCCGGGGGGCCGGGGGGCCGGGG - Intronic
1141700733 16:85640905-85640927 GCCAGAGGGCTGGTGGTCAGGGG + Intronic
1141749951 16:85951760-85951782 GTCAGGGAGCTAGGGGGCCTGGG + Intergenic
1141876034 16:86825215-86825237 GCCAGGGAGCTGGGGAACGTGGG - Intergenic
1141990594 16:87607177-87607199 CTCAGGGGGCCAGGGGTCCTGGG - Intronic
1142018629 16:87766082-87766104 GGCAGCGGGCTCGGGGGCCTCGG + Intergenic
1142115630 16:88354745-88354767 GCCAGGAGGCTTGGGAGCCTTGG - Intergenic
1142130202 16:88428757-88428779 GCCTGGCGGGTGGGGGCCCTGGG - Exonic
1142201896 16:88765100-88765122 GCCAGGGGGCTGGGTGCCGCTGG - Intronic
1142358893 16:89616987-89617009 GGCGGGAGGCTGGAGGTCCTGGG + Intronic
1142362828 16:89635414-89635436 CCCAGGAGGATGGGGGTCCCAGG + Intronic
1142957575 17:3531967-3531989 GCGAGGAGGCTGTGGCTCCTGGG - Intronic
1143174332 17:4947874-4947896 GACGGGGAGCTGGGGGTCCAAGG + Intronic
1143185021 17:5004803-5004825 GCCTGGGGGCAGGGGACCCTTGG - Intronic
1143206100 17:5140053-5140075 GTCGTGGGGCTGGGGGTGCTGGG - Intronic
1143622032 17:8086269-8086291 GCCAGAGGGGTGGGCGGCCTGGG - Intronic
1143758189 17:9081727-9081749 GGCAGGAGGCTGGGGGTCAGGGG + Intronic
1144021084 17:11240795-11240817 GCCGGGCGGCTGGGGGACCCGGG + Intergenic
1144726453 17:17504885-17504907 GTCAGGGGGCCTGGAGTCCTGGG + Intergenic
1144764458 17:17725052-17725074 GGCAGGGGGAGGGGGCTCCTGGG + Intronic
1144832111 17:18137559-18137581 GCCAGGTGGATGGGGGTGCTGGG - Intronic
1145214992 17:21044103-21044125 GCCAAGGGTCTGGGGGAACTTGG + Intergenic
1145249339 17:21288821-21288843 GGCAGGAAGCCGGGGGTCCTGGG + Intronic
1145285839 17:21505580-21505602 GCCAGGGGGCTGGGAGCGCCTGG - Intergenic
1145391762 17:22460720-22460742 GCCAGGGGGCTGGGAGGGCCTGG + Intergenic
1145710060 17:26963297-26963319 GGCAGGGGGCTTGGGCGCCTAGG - Intergenic
1145790153 17:27621565-27621587 GCCAGGGGGACTGGGATCCTGGG - Intronic
1146683884 17:34827552-34827574 GGGAAGGGGCTGAGGGTCCTTGG - Intergenic
1146832470 17:36081780-36081802 GCCTGGGTGCTTGGGGACCTGGG + Intergenic
1146846950 17:36188097-36188119 GCCTGGGTGCTTGGGGACCTGGG + Intronic
1146854823 17:36253744-36253766 GTCGTGGGGCTGGGGGTGCTGGG + Intronic
1146865797 17:36334632-36334654 GTCGTGGGGCTGGGGGTGCTGGG - Exonic
1146870723 17:36377636-36377658 GTCGTGGGGCTGGGGGTGCTGGG + Exonic
1146878081 17:36428717-36428739 GTCGTGGGGCTGGGGGTGCTGGG + Exonic
1146882022 17:36449821-36449843 GTCGTGGGGCTGGGGGTGCTGGG + Intergenic
1147068667 17:37935244-37935266 GTCGTGGGGCTGGGGGTGCTGGG - Exonic
1147073606 17:37978260-37978282 GTCGTGGGGCTGGGGGTGCTGGG + Intergenic
1147080190 17:38014781-38014803 GTCGTGGGGCTGGGGGTGCTGGG - Intronic
1147085128 17:38057798-38057820 GTCGTGGGGCTGGGGGTGCTGGG + Exonic
1147096138 17:38138741-38138763 GTCGTGGGGCTGGGGGTGCTGGG - Intergenic
1147101074 17:38181764-38181786 GTCGTGGGGCTGGGGGTGCTGGG + Intergenic
1147376868 17:40027643-40027665 GAGAGGGTGCTGGGGGTCTTTGG - Intronic
1147403663 17:40195523-40195545 GGGAGGGGGCTGGGGGTCCCTGG - Exonic
1147744511 17:42687047-42687069 GCCAGTGGGCAGGGGGGTCTGGG + Intronic
1148733611 17:49852089-49852111 GCAGGGGGCCTGGGTGTCCTCGG + Intergenic
1148988907 17:51648250-51648272 GCCAAGGGGATGTGGGTGCTTGG + Intronic
1149038307 17:52158646-52158668 GCCAGGCAACTGGGGGTTCTGGG - Exonic
1149996047 17:61406418-61406440 GACATGTGGCTGGGGGTGCTGGG - Intronic
1150292256 17:63988596-63988618 GTCTGGGGGCGGGGGGTCTTAGG - Intergenic
1150745496 17:67813431-67813453 GCGAAGGCGCTGGGGGCCCTAGG + Intergenic
1151053245 17:71003845-71003867 GCAAGGGGGCTGGGAGGACTTGG - Intergenic
1151680751 17:75621459-75621481 GCCATGGGTCTGGGGGGCCGTGG - Intergenic
1151828803 17:76537955-76537977 GCCGGGGCGCTGGGGGTCCCGGG + Intronic
1151907100 17:77055999-77056021 GCCTGTGGGCTGGGGCTCCGGGG - Intergenic
1152083369 17:78202611-78202633 GTGAAGGGGCTGGGGGTCCCGGG + Intronic
1152108145 17:78342436-78342458 GCCTGGGGCCTGCGGGTCCCGGG + Intergenic
1152240392 17:79157786-79157808 GCCAGGGAGTGGGGTGTCCTTGG - Intronic
1152421111 17:80193691-80193713 GCCAGGGGGCAGGTGAGCCTGGG - Intronic
1152549917 17:81024092-81024114 GCCAGGGGGCTGGGATGCCAGGG + Intergenic
1152738134 17:82007456-82007478 GCTGTGGGCCTGGGGGTCCTTGG + Intronic
1152887322 17:82860077-82860099 GTATGGGGGCTGGGAGTCCTAGG + Intronic
1152919593 17:83059371-83059393 ACCTGGGGGCTGGGGGTGCCTGG - Intergenic
1152935384 17:83133701-83133723 GCCAGCGGCCTGGGGCTCCACGG - Intergenic
1153941886 18:9985843-9985865 GCCCCGGGGCTGGGAGACCTGGG + Intergenic
1153970904 18:10226163-10226185 GGCAGGGGGCGGGGGGGCTTGGG - Intergenic
1154027973 18:10725504-10725526 GCCTGGGAGCTGGGAGTCGTGGG + Intronic
1154266530 18:12883740-12883762 GGCCCGGGTCTGGGGGTCCTTGG - Intronic
1154331270 18:13430807-13430829 GCGAGGGGGCTGGGGGGCCTAGG - Intronic
1154356819 18:13627844-13627866 GCCAGAGGGCAGACGGTCCTGGG + Intronic
1154475288 18:14748707-14748729 GAGTGGTGGCTGGGGGTCCTGGG + Intronic
1154529442 18:15329977-15329999 GAGTGGGGGCTGGGGGTCCTGGG - Intergenic
1156290887 18:35747897-35747919 GCCTGGGGACTGGGGGGCCGTGG - Intergenic
1157785116 18:50474596-50474618 GCCAAGGGACTGGGGGTTGTGGG - Intergenic
1158640860 18:59202534-59202556 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1159031178 18:63233720-63233742 GCCTGGGGGCTGGGGACCCCTGG + Intronic
1159917168 18:74198099-74198121 GCCAGGGGGCTGAGGAGGCTCGG + Intergenic
1159941641 18:74413017-74413039 GCCACGGAGATGAGGGTCCTGGG - Intergenic
1159992765 18:74929276-74929298 GCCACGTGGCTGGGTGACCTTGG - Intronic
1160065285 18:75568326-75568348 GCAAGAGGCCTGTGGGTCCTAGG - Intergenic
1160155301 18:76429223-76429245 GCCAAGGGCCTGAGGGTCCCAGG + Intronic
1160183977 18:76660507-76660529 GGGATGGGGCTGTGGGTCCTAGG + Intergenic
1160344971 18:78124827-78124849 GCCAGAGACCTGGGGGTCCGGGG - Intergenic
1160442634 18:78904051-78904073 GCCCGAGGGGTGGGGGACCTTGG + Intergenic
1160527234 18:79544890-79544912 GCCACGTGGCCGGGGGTCCCGGG - Intergenic
1160658867 19:289081-289103 GCCATGGCACTGGGGCTCCTGGG + Intronic
1160686509 19:439215-439237 GGGAGGGGGCTGGGGAACCTGGG + Intronic
1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG + Intronic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1160857052 19:1222362-1222384 GTCATGGAGCTGGGGGCCCTGGG - Intronic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1160980821 19:1815840-1815862 GCCAGAGGGCTGGGGGGCAGAGG + Exonic
1161009440 19:1953242-1953264 GCCAGGGGGGCAGGGGTCCCCGG - Intronic
1161236663 19:3201642-3201664 GGCAGGGGGATGGGGGTGCGGGG + Intronic
1161242256 19:3228839-3228861 GGCAGGGGGCTGGGGGTGGCTGG + Intronic
1161295812 19:3519738-3519760 CCCTGGGGGCAGGGGCTCCTGGG - Intronic
1161299913 19:3537614-3537636 GCCAGGAGGCCGGGGGGCCGGGG + Intronic
1161309576 19:3586283-3586305 GTCTGGGGGCTGGAGGTCCCGGG + Intronic
1161473454 19:4472594-4472616 CCTGGGGGTCTGGGGGTCCTGGG + Intronic
1161473502 19:4472712-4472734 CCTCGGGGCCTGGGGGTCCTGGG + Intronic
1161473531 19:4472812-4472834 TCCCGGGGTCTGGGGGTCCTCGG + Intronic
1161473560 19:4472891-4472913 CCCCGGGGTCTGGGGGCCCTGGG + Intronic
1161473672 19:4473244-4473266 GCCAATGGTCTGGGGGTCCTGGG + Intronic
1161475091 19:4480326-4480348 GCCTGGGAGCTGGGGGGCCAGGG - Intronic
1161493387 19:4574997-4575019 TCGAGGGGGCTGGGGCTCCAAGG + Intergenic
1161545106 19:4875794-4875816 GGCAGGGGCCTGGGGGCTCTGGG + Intergenic
1161576377 19:5056805-5056827 GCCCTGGGGCGGGGAGTCCTGGG + Intronic
1161752517 19:6108833-6108855 GCCCGGGCGCTTGGGGCCCTCGG + Intronic
1161854240 19:6754384-6754406 GCCGGGGCGCTGGCGGTGCTGGG - Exonic
1162420187 19:10561748-10561770 GTCGGGGGGCTGAGGGGCCTGGG - Intronic
1162444449 19:10713566-10713588 CCAAGGTGGCTGGGGGGCCTGGG - Intergenic
1162575769 19:11497908-11497930 GCCCTGGAGCTGGGGGTCCCAGG - Intronic
1162932513 19:13964039-13964061 GCTGGCGGGCTGGGGTTCCTTGG - Intronic
1162951776 19:14075234-14075256 GCCAGGGGGCGGTAGGACCTGGG - Intergenic
1163040245 19:14596871-14596893 GCCAGGGGACTGGAGTTGCTGGG - Exonic
1163104439 19:15115394-15115416 GCCATGGGTCTGGGGGCCCGGGG - Exonic
1163118299 19:15200886-15200908 GCCATGGGGCCGGGGGCCCGTGG - Exonic
1163485044 19:17580522-17580544 CCCAGGGGTCTGGCGGTCATGGG - Intronic
1163520222 19:17787723-17787745 GCCACGGGGCTGGGTGTGCTGGG - Exonic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163578064 19:18122142-18122164 CCCAGGGGGTGGGGGGTCATGGG + Intronic
1163628309 19:18403566-18403588 TCCTGGGGTCTGGGGATCCTGGG + Intergenic
1163628315 19:18403582-18403604 TCCTGGGGACTGAGGGTCCTGGG + Intergenic
1163628336 19:18403646-18403668 TCCTGGGGCCTGAGGGTCCTGGG + Intergenic
1163628349 19:18403678-18403700 TCCAGAAGTCTGGGGGTCCTGGG + Intergenic
1163638931 19:18450749-18450771 GCCAGGGGGTCGTGGGCCCTCGG + Exonic
1163649207 19:18507357-18507379 GCCAAGGGGCTGTGGGTCTGTGG - Intronic
1163678847 19:18669248-18669270 GCCAGGGTCCCGGGGGTCTTGGG - Exonic
1164715120 19:30385348-30385370 GCCTGGGGCCTGGGTGCCCTGGG + Intronic
1165164218 19:33840179-33840201 GCTGGGGAGCTGGGCGTCCTGGG - Intergenic
1165325391 19:35111656-35111678 GGCAGATGGCTGGGGGTCCTGGG - Intergenic
1165350627 19:35273213-35273235 GCCAGATGGCTGAGGGTACTGGG - Intronic
1165351376 19:35277709-35277731 GGCAGGGGGCTGGGGGTCCGTGG + Intronic
1165504208 19:36214599-36214621 GTGAGGGGTCTGGGAGTCCTGGG - Exonic
1165735752 19:38174386-38174408 GCCAAGTGGCTGGGGGCCCTCGG + Intronic
1166360050 19:42249285-42249307 GCCAGGTGGGTGGGCGTCATGGG + Exonic
1166504350 19:43361831-43361853 GGCTGGGGGCCGGGGCTCCTGGG + Intronic
1166525535 19:43507614-43507636 GGCTGGGGGCCTGGGGTCCTGGG - Intronic
1166805692 19:45485654-45485676 GCCAGAGGGCTGCGGGGGCTGGG + Exonic
1167121581 19:47520574-47520596 CCCTGGGGGCTGGGGGCCTTGGG - Intergenic
1167249885 19:48394084-48394106 GCCAGGCGTCTGGGCGTCCCCGG + Intergenic
1167299485 19:48670713-48670735 GGATGAGGGCTGGGGGTCCTGGG + Exonic
1167314282 19:48754982-48755004 GGCAGGGGGCTTGGACTCCTGGG - Intronic
1167353901 19:48992085-48992107 GGCTGGGGGCTGGGGCTCCTGGG - Intronic
1167356864 19:49009910-49009932 GCCAGGGGGATGGGCGAGCTTGG + Intronic
1167414449 19:49362683-49362705 GGCTGGGGGCTGGGACTCCTGGG + Intronic
1167414458 19:49362705-49362727 GTCTGGGGGCTGGGACTCCTGGG + Intronic
1167431060 19:49454619-49454641 GCCTGGGTGCTGGGGGACCCTGG - Intronic
1167705156 19:51077633-51077655 GCTGGGGGACTGGGGCTCCTGGG + Intronic
1168057134 19:53869965-53869987 GCCTGGGGGCCTGGGCTCCTGGG + Intronic
1168211457 19:54893779-54893801 GCCAGGGGGCTGCCGGCACTAGG - Intergenic
1168263052 19:55207573-55207595 GCCTGGGGGCCTGGGGGCCTGGG + Intronic
1168263242 19:55208121-55208143 GCCTGGGGGCCTGGGGGCCTGGG + Intronic
1168508468 19:56955661-56955683 GCCCGGGGCCGGGGGCTCCTTGG - Intergenic
1168687480 19:58357512-58357534 GTCTGGAGGCTGGGGGGCCTGGG - Exonic
1168692883 19:58387348-58387370 GCCGCGGGGCCGGGGATCCTAGG + Exonic
925085311 2:1103017-1103039 ACCAGGGGGCGGGGGCTCCAGGG - Intronic
925360730 2:3278504-3278526 GCCAGGGTGCTGTGGGGACTGGG - Intronic
926051265 2:9746318-9746340 TGGAGGTGGCTGGGGGTCCTTGG - Intergenic
926214124 2:10893215-10893237 CCCACAGAGCTGGGGGTCCTAGG - Intergenic
926243551 2:11105558-11105580 GTGAGGGGGATGGTGGTCCTGGG + Intergenic
927430771 2:23024712-23024734 GCCAGAGGGCTGAGGGGCCTTGG + Intergenic
927496321 2:23554056-23554078 TCCATGGGGCTGGGGGTCACTGG + Intronic
927519491 2:23690370-23690392 GGCAGGGAGCTGGGGGCACTGGG - Intronic
927682562 2:25149614-25149636 GCCAGAGAGCTGGGGGTGCCAGG + Intronic
927843148 2:26457813-26457835 GCCTGTGGGCTGGGGAGCCTTGG - Exonic
928098035 2:28417431-28417453 GCAGGGGGGCTGGGGGAGCTGGG + Intergenic
928182973 2:29082704-29082726 GCCAGGTGGGTGGGGGTCCCTGG - Intergenic
928199611 2:29239316-29239338 GAGAAGGAGCTGGGGGTCCTGGG + Intronic
929536118 2:42785067-42785089 GCCAGGGTGCTGTGTGCCCTTGG + Intronic
929924328 2:46196380-46196402 TGCTGGGGGTTGGGGGTCCTAGG + Intergenic
931690219 2:64829355-64829377 GGCATGGGGCTGGGGGACCCAGG + Intergenic
931882432 2:66581625-66581647 CCCCGCGGGCTGGGGGCCCTGGG + Intergenic
932336239 2:70932914-70932936 GCCAGGAGGCTAGGGGCCCTGGG - Exonic
932708581 2:74046417-74046439 TGCTGGGGACTGGGGGTCCTTGG + Exonic
933728075 2:85437668-85437690 GCCAGGGGGCGGGGGCGTCTGGG + Intergenic
933822756 2:86129301-86129323 GACTGGGGGATGGGGGTTCTGGG + Intronic
933924056 2:87076247-87076269 GCCAGGGGGCTAGGGCGCCATGG - Intergenic
935214993 2:100968910-100968932 GCCAGTGGGCGCGGGTTCCTGGG + Intronic
935523653 2:104140420-104140442 GCCAGGAGGTTGGTGCTCCTGGG + Intergenic
936228230 2:110677918-110677940 CCCAGGGGGCTGGGGCGCCTGGG - Intronic
936816670 2:116469198-116469220 GCCTGAGGGCTGGGACTCCTCGG + Intergenic
937153136 2:119699656-119699678 GCCAGGTGGGAGGGGGTCCCTGG - Intergenic
937205663 2:120235513-120235535 GCCAGGGGGTTGGGGGTTAGGGG + Intergenic
937242412 2:120470806-120470828 GCCACAGAGCTGGGTGTCCTGGG + Intergenic
937251636 2:120527683-120527705 GGCAGGAGGCTGGGGGTGCTTGG - Intergenic
937987306 2:127643863-127643885 CCCCTGGGGCTGGGGGGCCTGGG - Intronic
937989862 2:127656318-127656340 GCCAGGAGGCTGGGGGGACCAGG - Intronic
938106942 2:128538480-128538502 GGCAGGTGGCTGGGCTTCCTTGG + Intergenic
938289748 2:130142891-130142913 GCCATAGGGCTGGAGATCCTGGG + Intronic
938528541 2:132161399-132161421 GAGTGGGGCCTGGGGGTCCTGGG - Intronic
940954576 2:159712977-159712999 GCCGTGGGGCGGGGGGTCTTCGG + Intronic
942346088 2:175004815-175004837 GGCGGGGGCCTGGGGGGCCTGGG - Intronic
942838909 2:180336425-180336447 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
943116564 2:183679200-183679222 GCCAGGGGGCTGATGGCACTAGG - Intergenic
944547316 2:200811520-200811542 GCCCGAGGGCGGGGGGCCCTCGG - Intronic
944660112 2:201914598-201914620 GGAAGTGGGGTGGGGGTCCTGGG + Intergenic
945384529 2:209181039-209181061 GCCATGAGTCTGGGGATCCTGGG - Intergenic
946252323 2:218421251-218421273 GCCAGGGGGCTGTGTGTAGTGGG + Intronic
946431769 2:219630148-219630170 GCCCGGGGGCTGGGGGAGCTGGG - Exonic
946433381 2:219637153-219637175 GCTAAGGGGCTGGGTGTCCTTGG + Intronic
947711885 2:232321213-232321235 GCTAGTGCTCTGGGGGTCCTTGG - Intronic
947793171 2:232879171-232879193 GCCAGGGGCATGGGGGGCCCTGG + Exonic
947819380 2:233059769-233059791 GCCTGGGTGCTGGGAGACCTTGG - Intergenic
948144647 2:235699235-235699257 GTCAGGGGGATGGGGGTCTAGGG + Intronic
948368994 2:237475501-237475523 GTCCGGGGTCTCGGGGTCCTGGG - Intergenic
948427079 2:237895092-237895114 GCCATGGTGCTGGGGGGCCGTGG - Intronic
948696366 2:239735008-239735030 GGGAGGTGGCTGGGGATCCTGGG - Intergenic
948798873 2:240421117-240421139 GCCTGAGGGCTGGGGGTTTTGGG - Intergenic
948839874 2:240643610-240643632 GGCTGGGGGCTGAGGGTACTGGG - Intergenic
949014392 2:241701559-241701581 CCCCGGGGGCTCGGGGTCCGGGG + Intergenic
1168997798 20:2145835-2145857 GCCAGGGAGAGGGGGGTGCTGGG - Exonic
1169117152 20:3072948-3072970 GCCTGGGGGGAGGGGGCCCTGGG + Intergenic
1169729793 20:8774281-8774303 GCAAAGAGGCTGGGGGCCCTAGG - Intronic
1170602793 20:17854442-17854464 GCCAGGGTGCAGGGGAGCCTGGG + Intergenic
1170969192 20:21102372-21102394 GCCAGGGAGCAGGGGGTTGTGGG - Intergenic
1171035030 20:21707197-21707219 CCAGGGAGGCTGGGGGTCCTGGG + Intronic
1171298769 20:24041369-24041391 GCCAGGAGGCTGGAGGCCTTAGG - Intergenic
1172009097 20:31836168-31836190 GTCTGGGGCTTGGGGGTCCTGGG + Intergenic
1172229492 20:33327211-33327233 TCCTGGGGGCTGGGGGTCAAGGG + Intergenic
1172271463 20:33657849-33657871 ACCAGGAGGCTGGGGGTCAGAGG + Exonic
1172351961 20:34250098-34250120 GCCAGAGACCTGGGGGTTCTTGG - Intronic
1172701621 20:36856648-36856670 GCTGGGGGTCTTGGGGTCCTGGG - Intronic
1172772192 20:37388307-37388329 GCCAGGAGGCTGGGGCTGCCAGG + Intronic
1172891816 20:38271127-38271149 GCCAGGGCTCTGGGGGGACTTGG + Intronic
1173034680 20:39397102-39397124 GCCAGGAGGCTGGGTTTCCTTGG + Intergenic
1173341330 20:42155319-42155341 GCCAAGGGCCTTGGGCTCCTAGG - Intronic
1173569213 20:44066022-44066044 GACAGGGGGCTGGGGGGCTGGGG - Exonic
1173851365 20:46220445-46220467 GCCAGGGAGCAGGGGATCCCAGG + Intronic
1174171246 20:48619499-48619521 GGAAGAGGGCAGGGGGTCCTGGG - Intergenic
1174185520 20:48703461-48703483 GCGAGGATGCTGGGGGTCCCAGG - Intronic
1174419593 20:50391011-50391033 GGCAGGGGGCTGTGAGGCCTCGG - Intergenic
1174460383 20:50678284-50678306 ACCTGGGGGCTGGGTGGCCTTGG + Intronic
1175497424 20:59424227-59424249 GCCAGAGTGCTGGGGGTTGTTGG + Intergenic
1175891150 20:62316596-62316618 GGCTGGGGGCTGAGGGTCCCTGG + Intronic
1175895877 20:62335389-62335411 GTCAGGGTGCAGGGGCTCCTGGG - Intronic
1175973537 20:62699072-62699094 CCCAGGAGGGTGGGGGTCCCAGG + Intergenic
1176042366 20:63072316-63072338 CCCAGGGGGCCGCGGGTCCGGGG + Intergenic
1176079131 20:63262888-63262910 CCCTGGGGACTGGGGGTCCCAGG - Intronic
1176236624 20:64056525-64056547 GGCAGGGGGTGGGGGCTCCTGGG + Intronic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1176427889 21:6560001-6560023 GCCATGGGGCTGGGCGTCCAGGG + Intergenic
1176621502 21:9064916-9064938 GCCACTGGGCTGGGGCTCATGGG - Intergenic
1176767956 21:13038491-13038513 GAGTGGGGGCTGGGGGTCCTGGG + Intergenic
1177298032 21:19202438-19202460 CCCAGGGAGCTGGGGCTCTTGGG - Intergenic
1178507868 21:33177486-33177508 GGTAGGGGGCTGGGAGTGCTGGG - Intergenic
1179058263 21:37955750-37955772 GCCTGGGGGCTGGGGACCCCTGG + Intronic
1179349959 21:40599367-40599389 GCCAGGGGGTTGGGGGCCAAGGG - Intronic
1179502668 21:41819902-41819924 GTGAGGGGGCTGGGGGCGCTGGG + Intronic
1179703381 21:43168318-43168340 GCCATGGGGCTGGGCGTCCAGGG + Intergenic
1179808667 21:43856188-43856210 GCCACGGCGCTCGAGGTCCTGGG - Intergenic
1179822885 21:43947073-43947095 GGTGGGGGGCTGGAGGTCCTTGG + Intronic
1179891068 21:44335356-44335378 GCCAGGACTCTGGGGGTCCCAGG + Intronic
1180063758 21:45402728-45402750 GCCAGGTCCCTGGGGGGCCTTGG - Intergenic
1180086178 21:45508944-45508966 GCCTGGGGGCTGGGATTTCTAGG + Intronic
1180092903 21:45542038-45542060 GCCTGGGGTCTGGGGGGCCCTGG - Intronic
1180092928 21:45542098-45542120 GCCTGGGGTCTGGGGGGCCCTGG - Intronic
1180213645 21:46311550-46311572 GGCAGGAGGCTGGGGGACCTAGG + Exonic
1180432517 22:15264773-15264795 GAGTGGGGGCTGGGGGTCCTGGG + Intergenic
1180515088 22:16132753-16132775 GAGTGGGGGCTAGGGGTCCTAGG + Intergenic
1180921897 22:19525389-19525411 GCCTGGGGGCTGGGGTGCCAGGG - Intronic
1180951274 22:19721685-19721707 GCCAAGGGGCAGCGGGTCCGGGG + Exonic
1180995384 22:19962908-19962930 TCCAGGGGGCTGGGAACCCTGGG + Intronic
1181033934 22:20161001-20161023 GCAAGGGGCCTGTGGGTCCCTGG - Intergenic
1181058697 22:20271806-20271828 GCCAGGGAGCTGGGGGGTGTTGG + Intronic
1181509422 22:23382402-23382424 GCAAGGGGCCTGTGGGTCCCTGG + Intergenic
1181523016 22:23460113-23460135 CCCAGGCAGCTGGGGGTCCCAGG - Intergenic
1182419994 22:30244409-30244431 GGCAGTGGGCTGTGGGTGCTGGG - Intronic
1183284011 22:36951499-36951521 GGCAGGGCCCTGGGGGTGCTGGG + Intergenic
1183524762 22:38316809-38316831 GGGAGGGGGCTTGGGGTGCTGGG - Intronic
1183541434 22:38431418-38431440 GCCAGTGGGCTGGTGGGCCTGGG - Intronic
1183587454 22:38761099-38761121 GCCGGAGGGCTGGTGGGCCTTGG + Intronic
1183748170 22:39704175-39704197 AGGAGGGAGCTGGGGGTCCTGGG + Intergenic
1184098893 22:42331214-42331236 GCCAGGCGGGCGGGTGTCCTGGG - Intronic
1184302452 22:43569639-43569661 GCCAGGGTGCAGGGGCTGCTAGG - Intronic
1184409510 22:44318430-44318452 GCCAGGGGGAAGCGGGTGCTGGG + Intergenic
1184413714 22:44340092-44340114 GCCAGGAGGCTTGGGGGACTGGG + Intergenic
1184839872 22:47046359-47046381 GCCACGGGCCTGTGGGTCCCTGG + Intronic
1184892592 22:47388998-47389020 GCCAGTGGCTTGGGAGTCCTGGG + Intergenic
1184947129 22:47811457-47811479 GACAGGGGGCTGGGGATGTTGGG - Intergenic
1185079518 22:48701922-48701944 TCCCGGGGACTGGGGGGCCTTGG + Intronic
1185091323 22:48776395-48776417 ACCAGGGGGCTGGAGAGCCTGGG + Intronic
1185092775 22:48785294-48785316 TCCCGGGGGCGGGGGGTCATGGG - Intronic
1185216202 22:49601256-49601278 GCCAGGGGGCTCAGGGGTCTGGG + Intronic
1185314820 22:50174454-50174476 GCCAGGGGCCTGGTGCTGCTTGG - Intronic
1185347697 22:50317617-50317639 CTCGGGGGGCTGGGGGCCCTGGG + Intronic
1203289133 22_KI270735v1_random:17307-17329 GGCAGGGGGCTCGGGCACCTAGG + Intergenic
949419675 3:3852349-3852371 TTCTGGGGGCTGGGGGTGCTAGG + Intronic
950117770 3:10462424-10462446 GCCAGGGGGCTGAGGGGCTGTGG - Intronic
950395950 3:12734306-12734328 GCCATCGGGCTGGGGCCCCTTGG - Exonic
950428146 3:12935721-12935743 TCCAGGGGCCTGGGGGGCCGGGG + Exonic
950613352 3:14139941-14139963 CCCAGGAGGATGGGGTTCCTCGG + Intronic
951078319 3:18424311-18424333 GCGAGGGGGGTGGGGGTGATTGG - Exonic
951346073 3:21547943-21547965 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
951993886 3:28705302-28705324 GCCTGGTGGCTGGGGGTCCCTGG - Intergenic
952093586 3:29921492-29921514 GGCAGGGGGGTGGGGGGGCTGGG + Intronic
952485343 3:33804344-33804366 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
952945033 3:38473366-38473388 GCGAGTGGGCTGGGGGTCAAGGG + Intronic
953605639 3:44411460-44411482 GCCAGGGGACGGGGCGCCCTGGG + Intergenic
953841897 3:46395934-46395956 GCTAGGAGGTTGTGGGTCCTGGG + Intergenic
954199156 3:49013998-49014020 GCGAGGCGGCTTGGGGTGCTGGG - Exonic
954294740 3:49667976-49667998 GACTGAGGGCTGGGGGCCCTGGG + Exonic
954409939 3:50366044-50366066 GCCAGGGGGCTGAGGGGCACAGG + Exonic
955004912 3:54959324-54959346 TCCAGGGAGCTGGGTGTGCTTGG + Intronic
959623434 3:108423250-108423272 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
960149015 3:114232295-114232317 GGCAGGGGCCTGGAGGTCCAGGG + Intergenic
960587505 3:119334107-119334129 GCCTGGGGGAAGGGGGTCCCTGG - Intronic
961438065 3:126932891-126932913 GCCGCTGGGCTGAGGGTCCTAGG + Intronic
961442110 3:126959380-126959402 GCCTGGGTGCTGGGGCTCCGAGG - Intronic
961458706 3:127036943-127036965 GCCAAGGGGCCAGTGGTCCTGGG - Exonic
961552647 3:127677907-127677929 GCCAGGGCCCTGGGGGTCTGTGG + Intronic
961644659 3:128386432-128386454 CCCACAGGGCTGGGGGCCCTGGG - Intronic
961714251 3:128847819-128847841 GCCACTGGGCTGGGTGTGCTGGG + Intergenic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
962941166 3:140125947-140125969 GGCAGGGGGCTGGAGGGCCCTGG + Intronic
963275922 3:143329774-143329796 GCCTGGGGGCTTGGGCTCCCAGG - Intronic
965429497 3:168568756-168568778 GCCAGGGGGCCAGGGGGCCAGGG - Intergenic
966749566 3:183309318-183309340 ACTAGGGGGCTGGGGGTTGTGGG - Intronic
967896820 3:194402051-194402073 GCCAAGGGACAGGGAGTCCTAGG - Intergenic
968450702 4:674742-674764 GGCAGGGACCTGGGGGTCCTGGG + Intronic
968505903 4:971410-971432 GCCAGGTGGCAGGGGCTTCTCGG + Intronic
968610292 4:1554006-1554028 GCCAGGGGGCTGTGGGTCATGGG - Intergenic
968614139 4:1569760-1569782 GCCGGGGGTCTGGGGGTCCTTGG - Intergenic
968618171 4:1591707-1591729 TCCAGGGGCCTGGGAGTCCCTGG + Intergenic
968703316 4:2066812-2066834 CTCAGGGGCCTGGGGCTCCTGGG + Exonic
968735199 4:2291614-2291636 GGGACAGGGCTGGGGGTCCTGGG + Intronic
968816594 4:2824726-2824748 GCAAGGTGACTGGGGGTCCGAGG + Exonic
969086977 4:4663957-4663979 GGCAGAGGGCTGGGGGCCCAGGG + Intergenic
969114234 4:4861047-4861069 GCCAGGGGGCCGTGAGGCCTTGG - Intronic
969394296 4:6910335-6910357 GCCTGGGGACTGAGGGTCCGAGG - Intronic
969436412 4:7191976-7191998 GCCAGAGGCCTGGCAGTCCTTGG + Intergenic
971711408 4:30118318-30118340 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
972511169 4:39770042-39770064 GCCCGGAGGCTGGGGTCCCTGGG - Intronic
972923108 4:43968173-43968195 CCCTGGGGGTTGGGGGCCCTTGG - Intergenic
974000423 4:56506157-56506179 GCCTTGGGGCAAGGGGTCCTGGG - Intronic
974675274 4:65080054-65080076 GCCAGGTGGCAGGGAGTCCCTGG + Intergenic
975614679 4:76234628-76234650 GCCAGGTGGGAGGGGGTCCCCGG - Intronic
976123162 4:81805052-81805074 GCCAAGGGCCTGGGAGTCCCGGG - Intronic
976826202 4:89263353-89263375 GCCAGGTGGGAGGGGGTCCCCGG + Intronic
977713470 4:100154230-100154252 GTCAGGGGGTCGGGGGTGCTAGG - Intergenic
979524051 4:121698569-121698591 GCCAGTGGGGTGGGGGTGATGGG - Intergenic
980726601 4:136769827-136769849 GCCAGGTGGAAGGGGGTCCCTGG + Intergenic
981255420 4:142656032-142656054 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
981847381 4:149184962-149184984 GCCAGGGGGCTGAGTGTGCTAGG + Intergenic
983878430 4:172904498-172904520 GTCAGGGGACTGGGGCACCTAGG - Intronic
985490578 5:176126-176148 GCCAGGAGGCTGGGGGCCAGAGG - Intronic
985539104 5:479569-479591 GCAAGGGAGCTCGGGGTCCTAGG + Intronic
985574315 5:666456-666478 CGCCGGGAGCTGGGGGTCCTAGG + Intronic
985697199 5:1347278-1347300 GCCAGGCGGCTGTGGCTGCTTGG + Intergenic
985759498 5:1737949-1737971 GCCTGGGGGCAGGAGGTCCCTGG - Intergenic
986177649 5:5365442-5365464 GCCTGTGGGCCTGGGGTCCTGGG + Intergenic
987071123 5:14337901-14337923 GCCAAGGGGCTGGTGCTTCTTGG + Intronic
987925189 5:24331692-24331714 GCCAGAGGGCTGGAGCTCCAGGG - Intergenic
988899550 5:35717790-35717812 ACCAGGTGGCAGGGGGTCCCTGG - Intronic
988900200 5:35723164-35723186 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
989472639 5:41838198-41838220 AACAGGGGGCTGGAGGTCCAGGG + Intronic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
991505429 5:67319036-67319058 GCCAGGGGGCTGGCACTGCTGGG - Intergenic
991657182 5:68915808-68915830 CCGAGGGGGCTGGGTGTCATGGG - Intergenic
992662920 5:78979476-78979498 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
993705012 5:91160032-91160054 GCTAGGGGGCTGGGGATGGTGGG - Intronic
993900157 5:93579585-93579607 ACCCGGGGGCTGGGGGGTCTCGG - Intergenic
995032331 5:107494418-107494440 GCCAGTGGGCTGGCGCTGCTGGG - Intronic
995393900 5:111667076-111667098 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
995499705 5:112791405-112791427 GCCTGGGGGCTGGGGACCCCTGG - Intronic
995830456 5:116348842-116348864 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
995952955 5:117738923-117738945 GAGAGGTGGCTGGTGGTCCTTGG + Intergenic
996044981 5:118861962-118861984 GCCTGGGGGCTGGGGATCCCTGG - Intronic
996553820 5:124757678-124757700 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
996575489 5:124973006-124973028 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
996661501 5:126009055-126009077 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
998351634 5:141505659-141505681 GCAGAGGGGTTGGGGGTCCTGGG + Intronic
999251238 5:150183615-150183637 GCCAGGAGGCTGGTGTTGCTGGG - Exonic
999379468 5:151110102-151110124 ACCGTGGGGCTGGGGCTCCTAGG + Intronic
1001293964 5:170485781-170485803 GGGCTGGGGCTGGGGGTCCTTGG - Intronic
1002474501 5:179456329-179456351 GCCAGGTGGGAGGGGGTCCCTGG - Intergenic
1002649464 5:180681056-180681078 GACAGGGGGCTGGAGGTGCTCGG + Intergenic
1002931337 6:1637162-1637184 GCCAGGTGTCTGGGGGAGCTGGG + Intronic
1003074421 6:2971181-2971203 GCCTGGGCGCCCGGGGTCCTCGG + Intronic
1003196548 6:3920024-3920046 GCCAGGTGGGAGGGGGTCCCGGG - Intergenic
1004485232 6:16060230-16060252 GCCAGGTGGGAGGGGGTCCTTGG + Intergenic
1004515118 6:16315998-16316020 GCCTGGGGGTTGGGGATCCCTGG - Intronic
1005473283 6:26182904-26182926 GCTAGGGGGCTGGGGAGCGTGGG + Intergenic
1005578040 6:27208319-27208341 GCCAGGTGGGAGGGGGTCCCTGG - Intergenic
1006021435 6:31120313-31120335 GGTAGGAGGCTGGGGGCCCTGGG - Exonic
1006136605 6:31899887-31899909 GCCAGGAGGCTGGGGCCCCTGGG - Exonic
1006191843 6:32214141-32214163 GCCAGAGGGCTGGGGGTAGCAGG + Exonic
1006295325 6:33167584-33167606 GGCAGGGGGCAGAGGGTCCAAGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006375734 6:33670830-33670852 GCCCAGGGGCTGGGGGTCCGTGG + Intronic
1006449521 6:34098172-34098194 GCCAGGTGCATGGGGGCCCTGGG + Intronic
1006580208 6:35072723-35072745 GCCAGGAGGGAGAGGGTCCTGGG + Intronic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1007111087 6:39313890-39313912 ACCAGAGGGTTGGGGGACCTCGG - Intronic
1007239019 6:40411777-40411799 GGCAGGGTGCTGGGGGTGGTGGG - Intronic
1007400326 6:41599318-41599340 GCCAGGTGCCAGGGGGCCCTGGG - Exonic
1007702164 6:43771704-43771726 ACCAGTGGGCAGGGGGTGCTCGG + Intronic
1007782035 6:44259945-44259967 GCCAGGGAGCCAGGAGTCCTGGG - Intronic
1007832375 6:44648235-44648257 GCCACGGAGCTGGGGTTCCTTGG - Intergenic
1007842259 6:44726411-44726433 GCCAGGGGGGTGGGAGTACAGGG + Intergenic
1008149555 6:47934105-47934127 GCCAGGTGGGAGGGGGTCCCAGG + Intronic
1009907492 6:69887947-69887969 GCCAGGTGAGAGGGGGTCCTTGG - Intronic
1009907796 6:69890833-69890855 GCCAGGTGGGAGGGGGTCCTTGG - Intronic
1012400027 6:98835147-98835169 CCCAGGGGGCTGGTGGACCACGG - Exonic
1014219383 6:118785047-118785069 GACAGGGGCCTGGTTGTCCTAGG - Intergenic
1016433164 6:144008481-144008503 GCCGGGGAGCTGGGGGTCGGCGG + Intronic
1017609348 6:156168041-156168063 GCCTGGGTGCTTGGGGGCCTAGG - Intergenic
1017898812 6:158703376-158703398 GGCAGGGTGGTGGGGGCCCTTGG + Intronic
1018070629 6:160161462-160161484 GCCGGGGGTCTGGCGGTCCAGGG + Intergenic
1018160906 6:161041403-161041425 GCCTGTGGGCTGAGGGTCCTGGG - Intronic
1018239612 6:161760447-161760469 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
1018359695 6:163054877-163054899 GCCAGGGGGGAGGCGGTCCTTGG - Intronic
1018957706 6:168421492-168421514 GCCAGGGCGCTGGGGGGACTAGG - Intergenic
1019275155 7:172334-172356 GCCAGGATGGTGGGGGTCCCGGG - Intergenic
1019281037 7:200330-200352 GCCCCAGGGCTGGGGGACCTTGG + Intronic
1019499762 7:1359005-1359027 CCCAGAGGGGTGGGGGTCCCTGG + Intergenic
1019611712 7:1940093-1940115 GCCATGGGGCCGGAGGTCCCTGG - Intronic
1020136568 7:5591471-5591493 GCCAGGGGCGTGCGGGTTCTGGG + Intergenic
1020224890 7:6272405-6272427 GGCCGGGGGCTGGGGGTCGAGGG - Intronic
1020279721 7:6644088-6644110 CCCAGGGGCCATGGGGTCCTAGG - Intronic
1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG + Intronic
1020676641 7:11191961-11191983 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1020677321 7:11197504-11197526 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1021330952 7:19339202-19339224 GCCAGGTGGGAGGGGGTCCCTGG + Intergenic
1021941797 7:25685863-25685885 GTCAGGGGACTGGGGGCCCTGGG - Intergenic
1022096475 7:27144627-27144649 GCCTGGGGTCTGGGGATCCGTGG + Intronic
1022113097 7:27243309-27243331 CTGAGGGGGCCGGGGGTCCTGGG - Exonic
1023805348 7:43869256-43869278 GCCTGGGGGCCGGGGGGCCGGGG - Intronic
1023914947 7:44581908-44581930 GGCAGGGGGCCTGGCGTCCTCGG + Intronic
1023921161 7:44631076-44631098 GCCCGGGGGTTGGGGATCCCTGG + Intronic
1023931985 7:44711726-44711748 GCCAGGGGCCTGGGTGGACTTGG - Intergenic
1023935668 7:44738116-44738138 GCCAGGGGCCTGCTGGTCATGGG + Intergenic
1024085009 7:45885366-45885388 GCCAGGGGGCAGTGGGGCTTGGG + Intergenic
1024210119 7:47195943-47195965 GCCTGGGGTCTGGGAATCCTTGG - Intergenic
1024342607 7:48282590-48282612 GCTAGGGGGCAGGGAGTCCGGGG - Intronic
1024673965 7:51621594-51621616 GCCAGGGGCCTGCTGCTCCTTGG - Intergenic
1025777112 7:64569468-64569490 GCCAGGGGCCCTGGGGGCCTCGG + Intergenic
1026603609 7:71797246-71797268 GGCAGGGAGCTGGGGGTGCAGGG + Intronic
1026959455 7:74399141-74399163 GCGAGGAGGCTGGCGGGCCTTGG + Intronic
1027225435 7:76240810-76240832 GCCAAGAGGCTGGGGACCCTGGG + Intronic
1028524458 7:91768086-91768108 GCCAGGTGGGAGGGGGTCCCTGG - Intronic
1029391267 7:100276109-100276131 GCCTGGGGGCTGGGGTTGCCTGG + Intergenic
1029473398 7:100768533-100768555 GCCAGGAGGATGGTGGCCCTGGG + Intronic
1030245912 7:107384327-107384349 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
1030260259 7:107556671-107556693 GCCACTGGTCTGTGGGTCCTTGG + Intronic
1030304165 7:108002638-108002660 GCCCGGGGGATGAGGGTCCGCGG + Intronic
1031494089 7:122425061-122425083 GCCTGGGGCCTGGGGGTTCGAGG - Intronic
1032001419 7:128267857-128267879 GCCAGGGGTCGGGGGGTGCTGGG + Intergenic
1032017590 7:128389665-128389687 GCCAGGGGACTGGGAGGCCTGGG - Intergenic
1032079902 7:128853662-128853684 GCCAGGAGGCTGGGGCTCTGAGG + Intronic
1032481898 7:132253952-132253974 ATCACTGGGCTGGGGGTCCTAGG + Intronic
1032708988 7:134446436-134446458 GCCATGGGCCTGGGGCTCTTGGG - Intronic
1033444111 7:141405268-141405290 GCCAGGTGGCTGGCTGTCTTTGG - Intronic
1033579073 7:142715387-142715409 GCCAAGGAGCTGGGGGCCCATGG - Intergenic
1034433885 7:151053984-151054006 GCCTGGAGGCCGGGGGTCCCGGG + Exonic
1034470459 7:151251897-151251919 GCCGGGGAGCTGGGGGGGCTCGG + Intronic
1035024564 7:155817386-155817408 GCCTGGAGGCTGGGGTGCCTCGG + Intergenic
1035028667 7:155843683-155843705 GCCAGGGCTGTGGGGTTCCTGGG + Intergenic
1035151277 7:156874536-156874558 GACAGTGTGCTGGCGGTCCTCGG - Intronic
1035160248 7:156944757-156944779 TCCAGGGAGCTGGGGGTGTTTGG - Intergenic
1035171405 7:157019343-157019365 GCCCGGGGTGGGGGGGTCCTAGG - Intergenic
1036985658 8:13526768-13526790 GCCAGGGGGTTGGGGGACAGGGG + Intergenic
1039791838 8:40882544-40882566 GCCAGGGGGCTGGGGTGGCCAGG - Intronic
1040847783 8:51862674-51862696 GCCAGGGGCCTGAGGACCCTGGG - Intronic
1042543516 8:69930646-69930668 GCCATGGGACCTGGGGTCCTCGG + Intergenic
1042873985 8:73424058-73424080 GCCAGGGGGCTGGTGGGGGTGGG - Intronic
1044821103 8:96156504-96156526 GCCCCAGGGCTGGGGGTCCAGGG + Intronic
1046819619 8:118621418-118621440 GCCCCGGGGCTGGGGATGCTTGG - Intronic
1047201316 8:122770155-122770177 GCCTGGTGGCTGGGGGTCCCTGG - Intergenic
1047507030 8:125488154-125488176 CCCTGGGGCCTGGGGGGCCTGGG - Intergenic
1047526975 8:125641811-125641833 TCCTGGGGGCTGGGGGTGCGTGG + Intergenic
1047543987 8:125797683-125797705 GCCAGGGGGCTGAGGCAGCTTGG - Intergenic
1048375490 8:133818956-133818978 GGCAGGGGGCGGGGGGTGCAGGG + Intergenic
1048971467 8:139647255-139647277 GCCAGGAGCCTGGGGGTGGTTGG + Intronic
1049168399 8:141141395-141141417 ACCAGGGGGCTGGAGGTGGTGGG + Intronic
1049245043 8:141557876-141557898 GCGAGGGCCCTGGGGATCCTGGG + Intergenic
1049423478 8:142526942-142526964 GGCTGGGTGCTGGGGGTCCCTGG + Intronic
1049621384 8:143599776-143599798 GCCCGGAGGCTGGGGGGCATCGG + Exonic
1049720868 8:144114920-144114942 GGCAGGGGCCGGGGGGGCCTTGG + Intronic
1049765335 8:144352755-144352777 GCCAGGGTGCAGGGCCTCCTAGG - Intronic
1049780529 8:144426662-144426684 GCCAGAACGGTGGGGGTCCTGGG - Intronic
1049961552 9:742432-742454 GCCAGGGGTCTGGGGGACTCTGG + Intronic
1053072063 9:35107560-35107582 GGCAGGGGCCTGGGGGTCCAGGG + Exonic
1053669329 9:40345447-40345469 GCCACGGGGGTGGGGGAGCTAGG + Intergenic
1053707158 9:40767739-40767761 GAGTGGGGGCTGGGGGTCCTGGG - Intergenic
1053919131 9:42971688-42971710 GCCACGGGGGTGGGGGAGCTAGG + Intergenic
1054417071 9:64888507-64888529 GAGTGGGGGCTGGGGGTCCTGGG - Intergenic
1054489688 9:65763540-65763562 GGCAGGGGGCGGGGGGGCGTGGG - Intergenic
1054515287 9:66030844-66030866 GCCACGGGGGTGGGGGAGCTAGG - Intergenic
1054771263 9:69086420-69086442 GCCAGGTGGGAGGGGGTCCCTGG + Intronic
1054978561 9:71176903-71176925 GCCCAGGGGTTGGGGATCCTTGG - Intronic
1056267628 9:84915222-84915244 GTCAGGGGGTTGGGGACCCTTGG + Intronic
1056310145 9:85332676-85332698 GCAATGGGGATGGGAGTCCTGGG - Intergenic
1056446374 9:86669998-86670020 GCCAGTGGGCTCAGGGTCCTGGG + Intergenic
1056732415 9:89177944-89177966 CCCTGGGGGCTGGGGGTTCTGGG - Intronic
1056750667 9:89348734-89348756 GCCATGGGGCAGGGTCTCCTGGG - Intronic
1057152472 9:92808049-92808071 GCCAGGGGCCGCGGGGACCTGGG - Intergenic
1057191588 9:93091182-93091204 GCCAGGTGGCTGGGAGCCCATGG - Intergenic
1059450484 9:114368446-114368468 CGCAGAGGCCTGGGGGTCCTCGG + Exonic
1059452144 9:114377117-114377139 GGCAGTGGGCTGGGGGCCATCGG + Exonic
1060208695 9:121697888-121697910 GCCCGGAAGCTGGGTGTCCTTGG + Intronic
1060480090 9:124012572-124012594 GACTGGGTGCTGGGGATCCTCGG + Intronic
1060550489 9:124482629-124482651 GGGACGGGGCTGGGGCTCCTCGG + Exonic
1060838415 9:126775748-126775770 ACCAGGGGGCTGGGGGCCTCTGG - Intergenic
1060934029 9:127505666-127505688 GGAGGGGGCCTGGGGGTCCTGGG + Exonic
1061043657 9:128153173-128153195 TGCAGTGGGCTGGGGGTCTTGGG + Intronic
1061185842 9:129052690-129052712 GCCAGCTGGCAGGGGGACCTGGG + Intronic
1061218727 9:129236749-129236771 TCCTGGGGGCTAGGGGTCCTGGG + Intergenic
1061401438 9:130370507-130370529 CCCAGGGGGGTGGGGGTGTTGGG - Intronic
1061869959 9:133515291-133515313 GCCATGGTGCTGGTGGTGCTGGG + Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1061919953 9:133777329-133777351 GCCTGGGTGCTGAGGGTTCTGGG - Intronic
1062009308 9:134258698-134258720 GTCAGGGGGCTGGGGGCTCAGGG - Intergenic
1062118922 9:134823448-134823470 CCGGGGGGCCTGGGGGTCCTGGG - Exonic
1062268745 9:135699361-135699383 GCCAAGGGGTTGGGGGCCCAAGG - Intronic
1062269422 9:135701872-135701894 CTCAGGGGGCTCTGGGTCCTTGG - Intergenic
1062401296 9:136373818-136373840 GGCCGGGGGCTGGGGGTCCTGGG + Intergenic
1062616192 9:137397053-137397075 GCCCTGGGGCCGCGGGTCCTGGG - Intronic
1062728640 9:138095932-138095954 GCCAGGGGGTTGGGGGGGCGGGG + Intronic
1203794556 EBV:169691-169713 GCGGGGGGGCTGGGGGGCCGCGG - Intergenic
1203794757 EBV:170229-170251 GCGGGGGGGCTGGGGGGCCGCGG - Intergenic
1203794948 EBV:170752-170774 GCGGGGGGGCTGGGGGGCCGCGG - Intergenic
1203795149 EBV:171290-171312 GCGGGGGGGCTGGGGGGCCGCGG - Intergenic
1185650791 X:1646455-1646477 GCCACTGGGCTGGGGTTACTGGG + Intergenic
1185983838 X:4808373-4808395 ACCAGAGGGCTGGGGACCCTTGG + Intergenic
1189074989 X:37905738-37905760 GCCCGGGGTCATGGGGTCCTGGG + Intronic
1189152870 X:38725943-38725965 GCCAGGTGGAAGGGGGTCCCTGG + Intergenic
1189335523 X:40168642-40168664 GCCAAGGGGCTGGGGCTCCCCGG + Intronic
1189909133 X:45792456-45792478 GCCTGGGGGTTGGGGATCCCTGG - Intergenic
1190114848 X:47619735-47619757 GACTTGGGGCAGGGGGTCCTAGG + Exonic
1190116046 X:47626923-47626945 GGCTGGGGGCTGGGGGCCTTGGG - Exonic
1190303121 X:49067727-49067749 GGCACGGGTGTGGGGGTCCTTGG - Exonic
1190725554 X:53188297-53188319 ACCAGGAGGCGGGGGGTCATTGG - Intergenic
1192152255 X:68719524-68719546 GCCAGGAGGCTGGAGGGGCTTGG + Intronic
1192251430 X:69417025-69417047 GAGAGGGGGCGGGGGGTGCTGGG - Intergenic
1193247323 X:79244271-79244293 GCCAGTGGGCTTGGGGTGCATGG + Intergenic
1193277000 X:79601444-79601466 GCCAGGGGGCTGCCGGCACTAGG + Intergenic
1194240195 X:91435734-91435756 CCCAGGGGGCTGCGGGTCACCGG - Exonic
1196085737 X:111681088-111681110 GCCAGGGGGCGGCGGGGCCCCGG - Intronic
1196094130 X:111780527-111780549 TACATGGGGCGGGGGGTCCTGGG - Intronic
1197107330 X:122731969-122731991 GGCAGCAGGCTGGAGGTCCTGGG + Intergenic
1199233594 X:145467167-145467189 GCAAGGTGGATGAGGGTCCTTGG + Intergenic
1199772691 X:150984295-150984317 GCCCGGGGGCTCGGGGGCCCGGG - Intronic
1199815344 X:151392337-151392359 GCCAGGGGACATGGGATCCTAGG + Intergenic
1200070561 X:153527046-153527068 GCCATGGGGCTGTGGGCCCTGGG - Intronic
1200074281 X:153543546-153543568 GCCAGGGAGGTGGGGGTCAGAGG + Intronic
1200093252 X:153645438-153645460 GCCAGGGTCCTGGGAGTCCCCGG + Intronic
1200416444 Y:2916656-2916678 GCCAGGGGGTAGGGAGTCCCTGG + Intronic
1201065854 Y:10093144-10093166 GCCAGGAGGCCGGCGGTACTCGG - Intergenic
1201151904 Y:11099290-11099312 GCCACGGAGAGGGGGGTCCTGGG - Intergenic
1201158028 Y:11150369-11150391 GCCACTGGGCTGGGGCTCATGGG - Intergenic