ID: 1071488993

View in Genome Browser
Species Human (GRCh38)
Location 10:86123251-86123273
Sequence CCTAGGGAACAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071488983_1071488993 11 Left 1071488983 10:86123217-86123239 CCACCTTGTCCTAAAGGCAAAGC No data
Right 1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG No data
1071488984_1071488993 8 Left 1071488984 10:86123220-86123242 CCTTGTCCTAAAGGCAAAGCTAC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG No data
1071488981_1071488993 22 Left 1071488981 10:86123206-86123228 CCTACTCAAGACCACCTTGTCCT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG No data
1071488985_1071488993 2 Left 1071488985 10:86123226-86123248 CCTAAAGGCAAAGCTACAATCCA 0: 1
1: 0
2: 1
3: 16
4: 224
Right 1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071488993 Original CRISPR CCTAGGGAACAGAGGGCAGA GGG Intronic
No off target data available for this crispr