ID: 1071490328

View in Genome Browser
Species Human (GRCh38)
Location 10:86131876-86131898
Sequence GTTGGTAAACAGATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071490328_1071490338 22 Left 1071490328 10:86131876-86131898 CCACCCTCCATCTGTTTACCAAC 0: 1
1: 0
2: 1
3: 24
4: 259
Right 1071490338 10:86131921-86131943 TGTGATTAAGAAAGATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071490328 Original CRISPR GTTGGTAAACAGATGGAGGG TGG (reversed) Intronic
900038529 1:436011-436033 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
900059964 1:670990-671012 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900322521 1:2092203-2092225 GTAGGAAAACAGGGGGAGGGCGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
904731837 1:32598728-32598750 TTTGGTAAACAGTTGTAGTGAGG - Intronic
904939612 1:34156282-34156304 GTAGGTAGACAGATTGAGGCTGG + Intronic
905326855 1:37159211-37159233 GTTGGCAAAGGGGTGGAGGGTGG - Intergenic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
906302701 1:44695098-44695120 GCTTGTAGACAAATGGAGGGAGG - Intronic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
907230855 1:52996863-52996885 GTTGCAAAAAAGATGGAGGAGGG - Intronic
907594224 1:55704785-55704807 GGTGGTAAGCAGAGGCAGGGAGG + Intergenic
907820195 1:57959974-57959996 GTTGGTGAACAGTTGGTGAGTGG - Intronic
907841799 1:58165363-58165385 TATGGCAAACAGATGGAGAGAGG - Intronic
911398943 1:97350104-97350126 GCTGGGAAACAGATAGAGGTAGG + Intronic
911737747 1:101355974-101355996 GGTGGTGAAGAGCTGGAGGGAGG + Intergenic
912755774 1:112323913-112323935 GATGATAGACAGATGGAGGGAGG + Intergenic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
912955367 1:114151893-114151915 GGTGGTACAGAGATGGAGGTTGG - Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
918922992 1:190739296-190739318 GTTGGTAAGAATATGGAGGGTGG + Intergenic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
920526148 1:206668042-206668064 TTTGGCAACCAGATGGAGAGTGG + Intronic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
922934140 1:229410847-229410869 GATCCTAAACAGATGGTGGGGGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063542740 10:6950670-6950692 GTTGGGGAAGAGATGGATGGAGG + Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064442159 10:15363828-15363850 GTTGGGGAATAGAGGGAGGGAGG - Intronic
1066461286 10:35614603-35614625 TTTAGTAAACAGCTGGAAGGAGG - Intergenic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067908078 10:50315114-50315136 TTTGGTAAACAGCTGTAGGCTGG - Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071617709 10:87091829-87091851 GTTGGTAAAAGGGTGGAGAGAGG + Intronic
1072864490 10:99043186-99043208 GTTCTTAAACAGCTGGAGGCCGG + Intronic
1076825097 10:132963249-132963271 GTTGACGGACAGATGGAGGGAGG - Intergenic
1076825105 10:132963279-132963301 GTTGATAGACAGATGGATGGAGG - Intergenic
1076825110 10:132963309-132963331 TTTGATGGACAGATGGAGGGAGG - Intergenic
1076825118 10:132963339-132963361 GTTGATAGACAGATGGATGAAGG - Intergenic
1076825122 10:132963369-132963391 GTTGATGGACAGATGGAGGGAGG - Intergenic
1076964734 11:71925-71947 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159547 11:1106443-1106465 GATGGTAGACAGATGGTGGGTGG - Intergenic
1078497393 11:11832881-11832903 CTTGGTAAACATATTGAAGGAGG - Intergenic
1079640951 11:22804775-22804797 ATTGGTAGGCTGATGGAGGGTGG + Intronic
1081061076 11:38478425-38478447 GTTTGAAAACGGATGGAGTGAGG - Intergenic
1083653875 11:64219828-64219850 GTTGGTCTGCATATGGAGGGAGG + Intronic
1084530107 11:69722166-69722188 GTTGGTGGACAGATGGAAGATGG + Intergenic
1085354423 11:75822787-75822809 GTTGCTGAACATGTGGAGGGTGG - Intronic
1085770345 11:79319986-79320008 GGTGAGAAACACATGGAGGGAGG - Intronic
1086228806 11:84544099-84544121 TTCAGTTAACAGATGGAGGGTGG - Intronic
1089795524 11:120977517-120977539 GTTGAAAAACAGATGGAGCGGGG - Intronic
1091025141 11:132135289-132135311 GGTGCTAGAAAGATGGAGGGTGG - Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092160225 12:6311754-6311776 CTTGGGAAAAAGCTGGAGGGAGG - Intronic
1092683314 12:11013821-11013843 GGTGGGAAACAGATTGAGGCTGG - Intronic
1092956219 12:13552620-13552642 TCTGGTAAACAGCTGGTGGGAGG - Exonic
1093466656 12:19456465-19456487 GTTGGTAAAAAGCTGGAAGATGG - Intronic
1094700820 12:32869099-32869121 GTTGGTAGGCAGGAGGAGGGAGG - Intronic
1095354741 12:41258326-41258348 TTTGGTAAATAGAAGGAGGGAGG + Intronic
1095469200 12:42518612-42518634 GTTGGAAGACAGATGCAAGGGGG - Intronic
1096244602 12:49977177-49977199 GTTGGTAATGAGAGGGAGGAGGG + Intronic
1097803298 12:63938607-63938629 GTGGTTAAACAGCTGGAAGGTGG + Intronic
1100780695 12:98023102-98023124 GTTGGCAAACAGAGAGAGGTTGG - Intergenic
1101232309 12:102754035-102754057 GGTGGTGAATAGATGGAGAGTGG - Intergenic
1102657224 12:114492173-114492195 GCTGAAAAACAAATGGAGGGAGG + Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1104260849 12:127180733-127180755 TTTGGAAAACAGAGGCAGGGGGG - Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1107540349 13:41383843-41383865 GTTGTGAAAAAGATGGAGGAGGG + Intergenic
1108339015 13:49477981-49478003 GTAGGTATACAGATGTAGAGTGG + Intronic
1109460109 13:62645210-62645232 TTTGGAAAACAGATGGATGTTGG + Intergenic
1112600794 13:100854018-100854040 GTTGGAAAAAAGATTGATGGGGG + Intergenic
1113434301 13:110277776-110277798 GTGGGTCAAAAGATAGAGGGAGG - Intronic
1114404196 14:22439808-22439830 GTAGGTAAACAGATGCCGGGAGG + Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1118749185 14:68794214-68794236 GAAGGTAAAGAGGTGGAGGGAGG + Intronic
1119552462 14:75524941-75524963 TTTGGTAAATAGAGGGATGGAGG + Intronic
1124197752 15:27647693-27647715 GGTGGGAGACAGAGGGAGGGTGG - Intergenic
1125449588 15:39794595-39794617 GCTGGAAAGCAGATGGAAGGTGG - Intergenic
1126220087 15:46203605-46203627 GTTTTTAATCAGATGGAGGCTGG + Intergenic
1126860435 15:52877621-52877643 GTAGGAAAAAAGACGGAGGGAGG - Intergenic
1127639787 15:60905546-60905568 GTTGCTAAACAGATGAAAGTAGG + Intronic
1127737476 15:61857656-61857678 GGTGGTAAACAGAAGGGAGGTGG + Intronic
1127885668 15:63197869-63197891 GTAGGGAAAGAGAGGGAGGGCGG + Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1131868038 15:96732610-96732632 GTAGGCAAACAGGTGGTGGGTGG - Intergenic
1132443385 15:101891605-101891627 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1138532825 16:57644015-57644037 GTTTGGAAACCGTTGGAGGGAGG + Intronic
1140264116 16:73405806-73405828 TTTGGTAAACAGATGACTGGAGG + Intergenic
1141017012 16:80460164-80460186 GGTGCTTAACAGAGGGAGGGAGG - Intergenic
1141110261 16:81265979-81266001 GATAGTAGACAGATGGATGGTGG - Intronic
1141248042 16:82329182-82329204 GTTGGGAAAATGATGGTGGGAGG - Intergenic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1142028097 16:87825066-87825088 GGTGGGAAACAGAAGGAAGGAGG - Intergenic
1143197617 17:5088231-5088253 GATGGTAATTAGATGGACGGTGG - Intronic
1145744931 17:27310697-27310719 GTTAGCAAACATATGGAGAGAGG + Intronic
1146179201 17:30686592-30686614 GTTGGTAAAGAAATTGAGGAGGG - Intergenic
1148679784 17:49466906-49466928 GGTGGTAAACAGGTGGTGGGTGG + Intronic
1149314099 17:55422204-55422226 GTTGGAGAAGAGATCGAGGGAGG + Intergenic
1149508946 17:57221182-57221204 GTTGGAGAAGAGAGGGAGGGAGG + Intergenic
1149639679 17:58194730-58194752 GGTGGTAAAGAGAAGGAGAGGGG - Intronic
1151191343 17:72400246-72400268 GGTGGAGAACAGGTGGAGGGAGG - Intergenic
1151917588 17:77129858-77129880 GGTCATAAACAGCTGGAGGGAGG - Intronic
1153263332 18:3245264-3245286 ATTGGTCAAAAGATTGAGGGAGG + Intergenic
1153757962 18:8302385-8302407 GTTGGGCAAGAGAAGGAGGGAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156580663 18:38371212-38371234 GTAGGAAAAGAGGTGGAGGGAGG - Intergenic
1158346481 18:56521512-56521534 GTTGCTGAACACAGGGAGGGAGG - Intergenic
1160151908 18:76401761-76401783 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160151928 18:76401824-76401846 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160641539 19:141556-141578 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1161287677 19:3477303-3477325 GATGATAGACAGATGGTGGGTGG + Intronic
1161873279 19:6887092-6887114 GTTGGTGAATAGAGGGAGGGAGG + Intergenic
1162039052 19:7958305-7958327 TGTGGGAAGCAGATGGAGGGGGG + Intergenic
1162430707 19:10626366-10626388 GTTGGAGAACAGATGGGAGGGGG - Intronic
1162914453 19:13866346-13866368 GTAGGGAAAGAGATGGGGGGAGG - Intronic
1162979423 19:14228978-14229000 GTTGGTAAAGAAATTGAGGAGGG + Intergenic
1163604599 19:18267065-18267087 GTTGGTAAAGAAAACGAGGGCGG - Exonic
1165429964 19:35766952-35766974 GTTGGTGAGCCGAGGGAGGGAGG + Exonic
1165924687 19:39320067-39320089 GGAGGTGGACAGATGGAGGGGGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
1167560685 19:50225217-50225239 GTTTGTAAACATATGGAGAAAGG - Intronic
926153493 2:10437160-10437182 GCTGTTAAGCAGCTGGAGGGTGG - Intergenic
926682613 2:15675376-15675398 GTTAGAAAACAGGTGGAGGGAGG + Intergenic
927128520 2:20036226-20036248 GCTGGCACACAGAGGGAGGGTGG - Intronic
928950236 2:36807424-36807446 TCTGGCCAACAGATGGAGGGAGG - Intronic
929955248 2:46453176-46453198 ATTGGTTTACAAATGGAGGGTGG - Intronic
930257063 2:49104843-49104865 GGTGGGAAAGAGATGGGGGGAGG + Intronic
930489407 2:52049363-52049385 GTTGGTAAAGAGATAGAGCTGGG + Intergenic
930868642 2:56147876-56147898 GTTGGTGACCAGATGAAGGTGGG + Intergenic
931183981 2:59931757-59931779 GTTGGGGAAGAGATGGAGAGTGG + Intergenic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
934556135 2:95287986-95288008 GCTGGTGAACAGATGGAAAGGGG + Intronic
934592066 2:95562529-95562551 GTTGGGAAACAGATGTTGTGTGG - Intergenic
935267337 2:101406272-101406294 GTTGGTGGAGAGAAGGAGGGAGG + Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
940029479 2:149246320-149246342 GCTGGGCAAGAGATGGAGGGAGG + Intergenic
940391939 2:153142352-153142374 GATGATAAACACATGGAGGAAGG + Intergenic
941853280 2:170205767-170205789 TTTGGTCAGCAGATGGAGGATGG - Intronic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
943612787 2:190053924-190053946 GTTACTAAACTGATGGAGGGTGG + Intronic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944313557 2:198261852-198261874 GTTTGTACCCAGATGGAGAGAGG + Intronic
945044630 2:205770950-205770972 AGTGGTAAACTGATGGAGAGGGG - Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1169800998 20:9511572-9511594 GTTGACAAACTGATGTAGGGTGG - Intergenic
1170512402 20:17091749-17091771 GTTTGGAAAGAAATGGAGGGAGG + Intergenic
1170813221 20:19691548-19691570 GGTAGCAAACAGATGGAGGTAGG + Intronic
1171501470 20:25596877-25596899 GTTGGTAGACAGATGGTAGATGG - Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1175221185 20:57417415-57417437 GTTGGGGAATGGATGGAGGGAGG + Intergenic
1178631841 21:34268285-34268307 ATAGGTAATGAGATGGAGGGGGG - Intergenic
1181995482 22:26877644-26877666 GTTGGTAAAGACATGGAGCAAGG - Intergenic
1182325711 22:29511222-29511244 GTTGGTCAACAGCTGGTGGCTGG + Exonic
1182814183 22:33144875-33144897 ATTGCTAAACAGATGGCAGGAGG + Intergenic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1184350109 22:43937707-43937729 GTGGGTGGACAGGTGGAGGGAGG - Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950358114 3:12428690-12428712 GCTGGTGACCAGTTGGAGGGTGG + Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
951022864 3:17799565-17799587 GCTGGTAAAATGGTGGAGGGAGG - Intronic
951335638 3:21418369-21418391 ATTGGTAAATATATGGAGTGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
951881758 3:27486381-27486403 GCTGGCAAACAGCTGGAGGATGG + Intergenic
952917025 3:38254402-38254424 GTTGGGAAAGAGATGGATGTTGG + Exonic
954890980 3:53927798-53927820 GTTGGTTTACCGATGGAGGGAGG - Intergenic
956157414 3:66312795-66312817 GTGGGCAAGCAGATGCAGGGTGG - Intronic
956388233 3:68743777-68743799 GTTAGTAAAGGGGTGGAGGGTGG + Intronic
960607199 3:119518788-119518810 GCTGTTAAACTGATGGGGGGAGG - Intronic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
960737720 3:120798916-120798938 GTTGGTCAACAGAGGGAATGTGG - Intergenic
963559534 3:146845615-146845637 GTTTGTAAAAATATAGAGGGAGG - Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964305613 3:155336363-155336385 GTTGCTGAACACGTGGAGGGTGG - Intergenic
965473922 3:169130627-169130649 GATGCTAAAGAGATGAAGGGTGG + Intronic
966356376 3:179083897-179083919 TTTGTTAAGCAGAGGGAGGGTGG - Intergenic
966429956 3:179820876-179820898 GTAGGGAAAGAGATGGAGGGTGG + Intronic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
967746584 3:193062538-193062560 GGTGCTAAATAGATGGTGGGTGG - Intergenic
968427673 4:534320-534342 GCTGGTGGCCAGATGGAGGGCGG + Intronic
968547633 4:1206891-1206913 GGTGGGAGACACATGGAGGGTGG + Intronic
974195121 4:58564358-58564380 GTGGGTCAAGATATGGAGGGTGG - Intergenic
976836581 4:89381220-89381242 GAAGGTAAAGAGGTGGAGGGAGG - Intergenic
977385584 4:96335260-96335282 GTTGGCAAAGAGATGGAGAAAGG - Intergenic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
981964933 4:150588830-150588852 GGGAGTAAACAGCTGGAGGGTGG + Intronic
982174567 4:152693495-152693517 TTTGGTTAACAGAAAGAGGGGGG + Intronic
984635081 4:182101594-182101616 GTTGGTTACCAGAGGCAGGGGGG + Intergenic
984850306 4:184146867-184146889 GTTAGTAACCAGATGGAGGAGGG - Intronic
985930525 5:3053544-3053566 GTTGTTAAATAGATGTAGGTGGG - Intergenic
986214070 5:5701701-5701723 TTTGGTGGACGGATGGAGGGAGG + Intergenic
986309185 5:6539109-6539131 GTTGTTAAATGAATGGAGGGAGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
988366681 5:30309647-30309669 GCTGGTTAACAGACAGAGGGTGG + Intergenic
988819024 5:34862473-34862495 GTTGTTCAACAGTTGGAGGATGG + Intronic
990156613 5:52885157-52885179 GTTGCTGAACAGGTGGAAGGAGG - Intronic
990285912 5:54300450-54300472 AGTTGTAATCAGATGGAGGGTGG - Intronic
990704405 5:58512016-58512038 GTTGGTAAACAGATTGGGAATGG - Intergenic
991056878 5:62330491-62330513 GTTGGTAAACAGATGCTTGAAGG - Intronic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
994534864 5:101016903-101016925 ATTGTTTAACAGATGGTGGGTGG - Intergenic
997737799 5:136227279-136227301 GTTTGTAAACAGATGGACCTGGG + Intronic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999932390 5:156447648-156447670 GTTGGGAAGTTGATGGAGGGTGG + Intronic
1001679094 5:173543266-173543288 GCCTGTAAACAGATGGCGGGCGG - Intergenic
1002735318 5:181382932-181382954 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1002749203 6:91193-91215 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1003286893 6:4742258-4742280 CTTGGGAAACTGATGGTGGGAGG + Intronic
1003885948 6:10521436-10521458 GCTGGGAAACTGGTGGAGGGAGG + Intronic
1004009124 6:11664709-11664731 GGTGGAAAACAGATGAATGGTGG + Intergenic
1005658393 6:27967230-27967252 CTTGGTAAATGGATGCAGGGTGG + Intergenic
1005965749 6:30725241-30725263 GTTGCAAAAAAGATGGAGGAGGG - Exonic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1007800274 6:44386503-44386525 GTGGGTAAACAGCTCAAGGGCGG + Intergenic
1013124815 6:107172660-107172682 GTTGTTAAACAGATGGTTTGTGG + Intronic
1013183961 6:107741298-107741320 GGTGCTAAGCAGATGGAGGGAGG - Intronic
1013260262 6:108434606-108434628 GTTGGGAAAACAATGGAGGGGGG - Intronic
1013396167 6:109742444-109742466 TTTGGTAGACAGATTGAGTGAGG + Intronic
1014326345 6:120000278-120000300 GTTTGCAAACAGTTGGAAGGAGG - Intergenic
1015478484 6:133680403-133680425 GTTTGGAAAAAGATGAAGGGAGG + Intergenic
1016475190 6:144419500-144419522 GTTTAAAAACAGATAGAGGGAGG + Intronic
1016505007 6:144769449-144769471 TTTGGCAAACAGATGGAGGGAGG - Intronic
1016927617 6:149367619-149367641 GTTGGCAAAAAGAAGGAAGGTGG + Intronic
1017038146 6:150285566-150285588 GCTGCTGAACACATGGAGGGTGG + Intergenic
1018455381 6:163947178-163947200 GCTGTGAATCAGATGGAGGGAGG - Intergenic
1019239584 6:170655246-170655268 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1019327065 7:443723-443745 GATGGTGAATAGATGGATGGTGG + Intergenic
1019804588 7:3113934-3113956 ATTGTGAAACAGATGGAGTGTGG + Intergenic
1020889455 7:13860720-13860742 GTTTGTAAACCACTGGAGGGGGG - Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022728167 7:32999159-32999181 GCTGGTAATCAGCTGGAGGAGGG + Intronic
1023845113 7:44116144-44116166 GTTGGTGACCAGCTGGAGCGTGG + Exonic
1025045486 7:55688861-55688883 GCTGGTAATCAGCTGGAGGAGGG - Intergenic
1026814689 7:73501372-73501394 GTTGGACTACAGAAGGAGGGAGG - Intronic
1027546108 7:79529423-79529445 GCAGGTAAGCAGCTGGAGGGTGG + Intergenic
1027858970 7:83551033-83551055 GTTGGTAAACATGTGGATGAAGG + Intronic
1032068932 7:128791963-128791985 GGTGGCCTACAGATGGAGGGAGG - Intronic
1033136421 7:138788381-138788403 GTTAATAAACAGTTGGAAGGAGG - Intronic
1035508190 8:151361-151383 GTAGTCAAACAGAGGGAGGGAGG - Intergenic
1038593321 8:28861273-28861295 ATAGGGAACCAGATGGAGGGTGG - Intronic
1039558586 8:38495117-38495139 GTTGGTGAACAGATTGAAGCCGG + Intergenic
1046954223 8:120046740-120046762 GTTTGTCAACAGATGAAAGGAGG - Intronic
1047491322 8:125377076-125377098 TTTGGGAAACTGAGGGAGGGTGG - Intergenic
1047556451 8:125936725-125936747 TTAGGAAAACAGGTGGAGGGTGG + Intergenic
1047739492 8:127795099-127795121 GATGGTCAAAGGATGGAGGGAGG - Intergenic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1047813648 8:128438108-128438130 GTTGGTAGATAGATAGAGGGTGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1051178500 9:14385293-14385315 GTTTGTAAATAGATGGACTGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1053393065 9:37750166-37750188 TATGGCAAACAGATGGAGTGGGG + Intronic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057073212 9:92118377-92118399 GGTGGTAACCAGATGGTGGCTGG - Intergenic
1058669705 9:107350541-107350563 GGTGGTGGGCAGATGGAGGGTGG - Intergenic
1060552480 9:124492242-124492264 GTAGGGAAAGAGAGGGAGGGGGG - Intronic
1203600240 Un_KI270748v1:6309-6331 GTAGTCAAACAGAGGGAGGGAGG + Intergenic
1186118105 X:6326463-6326485 GTTAGTAAGTAGCTGGAGGGTGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1187425796 X:19176361-19176383 GTTGGGAGACAGATGGTGGTGGG - Intergenic
1189661426 X:43304009-43304031 TTAGGTAAACTGATGGAGTGGGG + Intergenic
1190473319 X:50804459-50804481 GTTGGGGGACAGACGGAGGGAGG - Intronic
1191068810 X:56379693-56379715 TTTGGTAAACAGATGCTTGGAGG - Intergenic
1191223610 X:58016810-58016832 TTTGGTGATCAGATGGAGGCAGG - Intergenic
1192734807 X:73840293-73840315 GTTGTTAAGCATATGGAGTGGGG + Intergenic
1196033524 X:111117534-111117556 GTTGGTAATCAGATGGTAGCTGG + Intronic
1196043475 X:111231237-111231259 GCTGGCAAACATATGGATGGTGG + Intergenic
1198539734 X:137624759-137624781 GTTGGTAAATAGATGGGGTTGGG - Intergenic
1201669169 Y:16497385-16497407 GTTGTTGTACAGATGGAAGGTGG - Intergenic