ID: 1071490597

View in Genome Browser
Species Human (GRCh38)
Location 10:86133996-86134018
Sequence CAGAGGAAACAAAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071490590_1071490597 15 Left 1071490590 10:86133958-86133980 CCAGTGGAACAAAAGACTAGAAG 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG No data
1071490589_1071490597 24 Left 1071490589 10:86133949-86133971 CCACTCTTTCCAGTGGAACAAAA 0: 1
1: 0
2: 6
3: 25
4: 230
Right 1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071490597 Original CRISPR CAGAGGAAACAAAAGGAAAG AGG Intronic
No off target data available for this crispr