ID: 1071491385

View in Genome Browser
Species Human (GRCh38)
Location 10:86138953-86138975
Sequence TGACGTCTCTTTACAAAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071491385_1071491388 -7 Left 1071491385 10:86138953-86138975 CCACCTTTTGTAAAGAGACGTCA 0: 1
1: 0
2: 2
3: 6
4: 64
Right 1071491388 10:86138969-86138991 GACGTCAAGGCCCAGCCGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1071491385_1071491395 22 Left 1071491385 10:86138953-86138975 CCACCTTTTGTAAAGAGACGTCA 0: 1
1: 0
2: 2
3: 6
4: 64
Right 1071491395 10:86138998-86139020 CCAGAAAGCTTTGAAGCCCACGG 0: 1
1: 0
2: 1
3: 12
4: 207
1071491385_1071491389 -2 Left 1071491385 10:86138953-86138975 CCACCTTTTGTAAAGAGACGTCA 0: 1
1: 0
2: 2
3: 6
4: 64
Right 1071491389 10:86138974-86138996 CAAGGCCCAGCCGCGAGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071491385 Original CRISPR TGACGTCTCTTTACAAAAGG TGG (reversed) Exonic
900342417 1:2195182-2195204 CACCGTTTCTTTACAAAAGGCGG + Intronic
900912983 1:5615250-5615272 TTACCTCTCTCTGCAAAAGGTGG + Intergenic
903166358 1:21523417-21523439 TCACGAGTCTTTACAGAAGGAGG - Intronic
908742573 1:67343538-67343560 TTAGGCCCCTTTACAAAAGGGGG + Intronic
911655511 1:100438618-100438640 TTATGTCTCATTTCAAAAGGAGG - Intronic
919224255 1:194674315-194674337 TAACAACTCTTTACAAATGGAGG - Intergenic
920869078 1:209778302-209778324 TGACCTCACTTTACAAGAAGAGG - Intronic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1065513026 10:26498206-26498228 TGAAGTTTTTTTACAAAAGCAGG + Intronic
1067266197 10:44747737-44747759 TGAAGTGACTTTACCAAAGGAGG - Intergenic
1071491385 10:86138953-86138975 TGACGTCTCTTTACAAAAGGTGG - Exonic
1071901805 10:90128632-90128654 TGTTGTCTCTTTGGAAAAGGTGG + Intergenic
1072984411 10:100127501-100127523 TTATATCTCTTTAAAAAAGGAGG - Intergenic
1073677264 10:105662251-105662273 TTAGGACTCTTTAAAAAAGGAGG - Intergenic
1074935224 10:118171830-118171852 TGAAGTCTCTTAAAAAATGGAGG - Intergenic
1076584968 10:131540747-131540769 ACACGTCTCTTTATCAAAGGTGG - Intergenic
1078675371 11:13407688-13407710 TGACATCTCTTCCCAAAAAGTGG + Intronic
1088937859 11:114421878-114421900 TTTCGGCTCTCTACAAAAGGAGG + Intronic
1090529821 11:127578898-127578920 AGATGTCACTTTAGAAAAGGAGG + Intergenic
1090626936 11:128616109-128616131 TGCTGTCTCTGTACAAAAGCAGG - Intergenic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1095569307 12:43664947-43664969 TGAAGTCTATTTACAATTGGTGG - Intergenic
1095664025 12:44773616-44773638 GGACTTCTCTTAATAAAAGGAGG - Intronic
1098520022 12:71424922-71424944 TGTTTTCTCTTTACAAAAAGAGG + Intronic
1099362355 12:81720492-81720514 TGAGATCTCTTTACCAAAAGGGG - Intronic
1105625540 13:22109329-22109351 TGACGTCTGTTTAGGAAAGTAGG + Intergenic
1106647130 13:31648295-31648317 TGGAGTCTCTTTAAAAAAGCTGG - Intergenic
1117503850 14:56381156-56381178 TAAGTTATCTTTACAAAAGGGGG - Intergenic
1117872186 14:60212748-60212770 AGACGTCACTTTACAGAAGCAGG - Intergenic
1125390476 15:39186930-39186952 TGAAGACTATTTACAAAAGTGGG - Intergenic
1127149601 15:56059886-56059908 TGCTGTCTGATTACAAAAGGTGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131795499 15:96011934-96011956 TAACGTCTTTTTAAAAAAGTAGG - Intergenic
1138142185 16:54578374-54578396 TGAGGCCTCTTAACAAAAGGTGG + Intergenic
1141950770 16:87338109-87338131 TGACCTCGCTTTACATAAAGAGG + Intronic
1142005637 16:87688386-87688408 TAACGTCTCTTTACAAACGGAGG + Intronic
1143736706 17:8916351-8916373 TGACGCCTTTTTTCAAAAGCTGG + Intronic
1150429825 17:65106055-65106077 TGACGTCTCTGCACAAAGGAGGG - Intergenic
929060611 2:37920882-37920904 TGACGTTTCTTTAAAAATTGTGG - Intergenic
930200630 2:48549324-48549346 TGACCTTTACTTACAAAAGGAGG - Intronic
932795756 2:74694402-74694424 TGAACTCTTTTTACAAAATGAGG + Intergenic
933426120 2:82114035-82114057 CCACTTCTCTGTACAAAAGGTGG - Intergenic
935585271 2:104795328-104795350 TGAATCCTCTTTTCAAAAGGAGG + Intergenic
941784840 2:169485930-169485952 TGAGGTTTATTTACAAAAGAGGG - Intronic
946902647 2:224386977-224386999 AGACTTCTCTTTAAAAAAAGTGG - Intronic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
1169349954 20:4860463-4860485 TGACGTTTCTACACATAAGGCGG + Intronic
1181540306 22:23569431-23569453 GCACGTCTCTTTACAAAAGGAGG - Intergenic
1184433548 22:44456020-44456042 TGACTTATCTTTACAAAAATAGG + Intergenic
955553122 3:60106299-60106321 TGACTTCTCTTTACTAAATCAGG - Intronic
957645944 3:82926741-82926763 TGATATCTATTTAGAAAAGGTGG - Intergenic
962761034 3:138514464-138514486 TGAATTCTCTTTACAAACGTAGG - Intronic
976206640 4:82628729-82628751 TGGAATCTTTTTACAAAAGGAGG - Intergenic
986094205 5:4539413-4539435 TGACTTCTCTTTCCACAAAGAGG - Intergenic
986186754 5:5449379-5449401 TGACTTCACTTTACAAAAAAAGG + Intronic
987250485 5:16095664-16095686 GGATGGCTCTTTACAAGAGGTGG - Intronic
992109561 5:73480204-73480226 TGACTTTTCCTTACAAAAGAAGG + Intergenic
1003026605 6:2560528-2560550 TGATTACTCTTTACAAAAGAAGG - Intergenic
1016302551 6:142648283-142648305 TGAGGTCTCTTCTCAGAAGGTGG + Intergenic
1016303422 6:142656940-142656962 TGACATCTTTTCACAAAAGCCGG + Intergenic
1018311042 6:162508902-162508924 TAAAGTTTCTTTACAAAAAGAGG + Intronic
1022419784 7:30209630-30209652 TCACATCACTTTACAAAAGGGGG + Intergenic
1033825356 7:145183154-145183176 TGAGGTCACTTAACAAAAAGTGG + Intergenic
1037059734 8:14492766-14492788 GGACGTCTCTTCACTAAAAGTGG + Intronic
1039182650 8:34883265-34883287 TGAGGTCTCTTTTCAACAGAAGG + Intergenic
1040423877 8:47264766-47264788 TGTCGTTTCTTTATAAAATGGGG + Intronic
1046098902 8:109592234-109592256 TAATTACTCTTTACAAAAGGTGG + Intronic
1051467716 9:17399636-17399658 TATCATCTGTTTACAAAAGGTGG - Intronic
1053259230 9:36647312-36647334 TGACATCTCTTTCAAAAAGGTGG + Intronic
1055394835 9:75863055-75863077 TGATGTATCATTACAAAAGAAGG - Intergenic
1186581269 X:10821594-10821616 TTAGGTATCTTTACGAAAGGAGG - Intronic
1188414587 X:29916727-29916749 TGAAGTCTCTTTCTAAAAGGTGG - Intronic
1193673081 X:84413702-84413724 TGAAGTCTCTTCAGAAAAAGAGG - Intronic