ID: 1071491521

View in Genome Browser
Species Human (GRCh38)
Location 10:86139637-86139659
Sequence GAGTCACTCCAGCTGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071491521_1071491526 21 Left 1071491521 10:86139637-86139659 CCTGTTTCCAGCTGGAGTGACTC 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1071491526 10:86139681-86139703 GCCCACATCCTGACTGGATCAGG No data
1071491521_1071491525 15 Left 1071491521 10:86139637-86139659 CCTGTTTCCAGCTGGAGTGACTC 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1071491525 10:86139675-86139697 TCAGAAGCCCACATCCTGACTGG No data
1071491521_1071491528 22 Left 1071491521 10:86139637-86139659 CCTGTTTCCAGCTGGAGTGACTC 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1071491528 10:86139682-86139704 CCCACATCCTGACTGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071491521 Original CRISPR GAGTCACTCCAGCTGGAAAC AGG (reversed) Intronic
900695638 1:4008134-4008156 GAGCCACTGGGGCTGGAAACAGG - Intergenic
901559191 1:10056669-10056691 GAGATAACCCAGCTGGAAACAGG + Intronic
901898148 1:12332902-12332924 GAGACACTCAAGATGGAAAAAGG - Intronic
904279415 1:29408447-29408469 GAGTCACTCTGACTGGAGACTGG + Intergenic
905302224 1:36993198-36993220 GAAGCACTCCAGCTGGAGTCAGG + Intronic
907380147 1:54080499-54080521 GAGTCAATTCAGCTGGTAAAGGG - Intronic
907963726 1:59308637-59308659 GAGTCACTGGAGCTGGAAGGGGG + Intronic
909779263 1:79521994-79522016 CATTCATTCCAGCTGGCAACAGG + Intergenic
912951727 1:114124882-114124904 GAGTTGCTTCATCTGGAAACTGG + Intronic
913298927 1:117350039-117350061 GAGTCACTCTGGCTGTAAAATGG - Intergenic
913591432 1:120331522-120331544 TAGTCCCTCCAGCTGAAAAGCGG - Intergenic
913651928 1:120923580-120923602 TAGTCCCTCCAGCTGAAAAGTGG + Intergenic
914169175 1:145205484-145205506 TAGTCCCTCCAGCTGAAAAGCGG - Intergenic
914524296 1:148449449-148449471 TAGTCCCTCCAGCTGAAAAGCGG - Intergenic
914599380 1:149186425-149186447 TAGTCCCTCCAGCTGAAAAGCGG + Intergenic
915201183 1:154230335-154230357 GAGTCACTCCAGCTAAATGCAGG + Intronic
917041259 1:170808652-170808674 AAGCCACTCCTGCTGCAAACTGG - Intergenic
920138542 1:203790459-203790481 GAGTCACTACAGTGGGCAACAGG - Intergenic
920316508 1:205079337-205079359 CAGTCTCTCCATCTGGAAAATGG + Intergenic
922218594 1:223540644-223540666 GAATCACACCAGCTGGGCACAGG + Intronic
924480799 1:244432187-244432209 GAGTCACTCTATCTGCAAAACGG + Intronic
1063133600 10:3198365-3198387 GAGTGACTTCAGCAGCAAACAGG + Intergenic
1070951581 10:80435552-80435574 GGCTCACTGCAGCTGCAAACTGG + Exonic
1071491521 10:86139637-86139659 GAGTCACTCCAGCTGGAAACAGG - Intronic
1073476316 10:103756299-103756321 GGGTCACTCCAACTGGACCCAGG - Intronic
1074703617 10:116112799-116112821 GAGCCCCTCCAGGTGGAAATGGG - Intronic
1075831956 10:125419412-125419434 GACTCACTCCAGGAGGAGACAGG + Intergenic
1076739550 10:132476571-132476593 GACACAGTCCAGCTGGAGACAGG - Intergenic
1077606683 11:3617121-3617143 GAGTCACACCAGGTGCAAAGCGG - Intergenic
1079135373 11:17773475-17773497 CAGTCCCTACCGCTGGAAACGGG - Intronic
1081651262 11:44825608-44825630 GACAGACTCGAGCTGGAAACAGG + Intronic
1082874486 11:57973887-57973909 CTGTCACTCCAGCTGGAATGCGG - Intergenic
1083274397 11:61588479-61588501 GAGTCACGCCAGCTCCAACCAGG + Intergenic
1084292401 11:68182606-68182628 GAGCCACTGCAGCAGAAAACTGG + Intronic
1084969796 11:72764851-72764873 GAGAAACTCCCCCTGGAAACAGG + Intronic
1092565420 12:9660037-9660059 AACTCACTCCAGCTGGAAATAGG + Intergenic
1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG + Exonic
1103500286 12:121396491-121396513 GAGTTAATGCAGCTGGAAAGTGG - Intronic
1104272809 12:127297431-127297453 GAGCCTCTACAGCTGGATACAGG - Intergenic
1104753460 12:131254437-131254459 GCCTCACTCCAGGTGGAACCTGG + Intergenic
1105654751 13:22424108-22424130 GAGTCACTCAAGTTAGAAATTGG + Intergenic
1106118531 13:26838132-26838154 GTTTCACTTTAGCTGGAAACTGG + Intergenic
1106475033 13:30091094-30091116 AACTCACTCCAGCCGGAAACTGG + Intergenic
1107726546 13:43305189-43305211 GAGGCTCTCCAGCAGGAGACTGG - Intronic
1107837041 13:44420730-44420752 GATTCACTCCAGCTGGGAAGGGG - Intergenic
1108078830 13:46711202-46711224 CAGTCATTCCTGCTGGAAATCGG + Intronic
1113549529 13:111181797-111181819 GAAACATTCCAGGTGGAAACAGG + Intronic
1114307606 14:21437721-21437743 GAGTCAGCCCAGCTGGAATATGG + Intronic
1114477903 14:23010540-23010562 GAGACATTTCACCTGGAAACCGG - Intergenic
1114817641 14:25979312-25979334 CATTCACTCCACCTGGAAAGGGG + Intergenic
1118214023 14:63791247-63791269 GAATCACTCTGGCTGGACACTGG - Intergenic
1118758908 14:68865883-68865905 GAGTGACCCCAGCTGGAGGCAGG - Intergenic
1119951815 14:78752930-78752952 GAGTCAATGCAGCTGGCACCTGG - Intronic
1121818402 14:96945517-96945539 CAGTCACTCCAGCTTGGAAGGGG - Intergenic
1124398927 15:29331520-29331542 GAGTCCCTCCTGCTCGAAACTGG - Intronic
1125520643 15:40346168-40346190 GAGACCCTCCAGATGGAAAGGGG + Intergenic
1129776442 15:78239774-78239796 CAGGCATTCCAGCTGGCAACTGG - Intronic
1129894728 15:79094807-79094829 CAGTCCCCACAGCTGGAAACCGG + Intergenic
1132405481 15:101539724-101539746 AAGCCACTCCAGCTGGAAGCAGG - Intergenic
1133546806 16:6815415-6815437 GAGTGACTCCATCTTGAAAAGGG - Intronic
1133635901 16:7664997-7665019 GAATGACTCCAGGAGGAAACGGG - Intronic
1134351486 16:13441768-13441790 AAGTCACCCCAGCTTAAAACTGG + Intergenic
1138194888 16:55044717-55044739 CAGTCCCTGCAGCTGGAATCTGG - Intergenic
1143047407 17:4093064-4093086 GAGTCATTCAGGCTGGAATCAGG + Intronic
1143272621 17:5687008-5687030 GAGTCCCCCCAGCTGTAAAATGG - Intergenic
1143376294 17:6469501-6469523 TAGTCACTCAAGTGGGAAACAGG + Intronic
1144088227 17:11829996-11830018 AAGTCCCTCCAGAGGGAAACAGG - Intronic
1146531322 17:33609916-33609938 GAGTCTCTCTAGCTGGCCACAGG + Intronic
1147767056 17:42844290-42844312 GACCCATTCCAGGTGGAAACTGG + Intergenic
1152208189 17:78987796-78987818 GAGCCACTCCATCTTGAACCAGG + Intergenic
1154311922 18:13273625-13273647 GACTCACTCCAGCTGGTGGCTGG - Intronic
1157673332 18:49549288-49549310 CAGTCACTCCAGCCAAAAACTGG - Intergenic
1157896868 18:51477838-51477860 GAGACACTCTAGCTCAAAACTGG + Intergenic
1158232599 18:55274991-55275013 GCGTCACTCCAGGTGAAAACTGG - Intronic
1163173589 19:15549541-15549563 GAGCCACTGCACCTGTAAACCGG - Intronic
1164206235 19:23061014-23061036 GAGTCACACCAGCTAGGTACTGG + Intergenic
1164219465 19:23180211-23180233 GAGTCAATTCAGGTGGAAAAAGG + Intergenic
1164314410 19:24074279-24074301 GAGTCACTTCAGCTCGATGCTGG - Intronic
1165073581 19:33269021-33269043 GGGTCACTCCAGCAGGACCCAGG - Intergenic
1166044593 19:40222617-40222639 TAGTCACTCCAGTTGAAGACGGG - Exonic
1168089038 19:54069986-54070008 GAGTGACTCCATCTTGAACCGGG - Exonic
1168607017 19:57768283-57768305 GAGTGACTCCATCTTGAAAATGG - Intergenic
925328760 2:3042479-3042501 GAGTCGCACCAGCTGGAAAGGGG - Intergenic
926213907 2:10891723-10891745 GAGTCAGTGCAGATGGAAACAGG + Intergenic
927626390 2:24724250-24724272 CAGTCATTTCTGCTGGAAACAGG - Intronic
929314412 2:40460434-40460456 AAGTCATTCCAGCTGCAAATAGG + Intronic
929486217 2:42357273-42357295 GAGTCACTGCAGATTGAAACTGG - Intronic
930326048 2:49919502-49919524 GAATCTTTCCAGATGGAAACTGG + Intronic
932076828 2:68672148-68672170 GAGTCACTCCATCTTGAATAGGG - Intergenic
933771389 2:85746632-85746654 TGGTGGCTCCAGCTGGAAACGGG + Intergenic
937347267 2:121133702-121133724 GAGTCCATCCAGCTGGAGCCAGG - Intergenic
943033698 2:182715666-182715688 GAGTCATACAAGCTAGAAACTGG - Intergenic
943370482 2:187010145-187010167 GAGTCACTCCATTTTGATACTGG + Intergenic
946591285 2:221250834-221250856 GAGTCCATCAACCTGGAAACAGG - Intergenic
947773079 2:232686385-232686407 GAATTACTCCAGCTGCAAAGCGG - Intergenic
948116127 2:235495089-235495111 GAGTCTCTCCTGCGGGAAAGTGG + Intronic
948738628 2:240027310-240027332 GAGTCAATTCAGGTGGAAACAGG + Intergenic
1169711964 20:8574665-8574687 GAGTCAATCCCACTGGAAACTGG + Intronic
1170389683 20:15858633-15858655 ATGTCACACCAGCGGGAAACAGG - Intronic
1171336711 20:24392049-24392071 GAGCCCCTCCAGGAGGAAACAGG - Intergenic
1173578469 20:44129174-44129196 GCTTCACTCCAGCTGGAGGCTGG - Intronic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
1176049852 20:63112966-63112988 CAGTCCCTCCATCTGGAAAATGG - Intergenic
1176602874 21:8809130-8809152 GACTGACTCCAGCTGAAATCTGG - Intergenic
1178229597 21:30766339-30766361 GTGCCATACCAGCTGGAAACTGG - Intergenic
1178730121 21:35094130-35094152 GAGTCACTCCAGCCTGAGATTGG - Intronic
1179400720 21:41080657-41080679 GAGTGACTCCATCTGGAATAGGG + Intergenic
1179840498 21:44069717-44069739 GAGTCATTGGAGCTGCAAACGGG + Intronic
1180345159 22:11700687-11700709 GACTGACTCCAGCTGAAATCTGG - Intergenic
1180352615 22:11816916-11816938 GACTGACTCCAGCTGAAATCTGG + Intergenic
1183935883 22:41261959-41261981 GAGTTTCTTCAGCTGGAAAATGG - Intronic
1185159080 22:49212037-49212059 GAGTCTCTGCAGATGGATACAGG - Intergenic
949673578 3:6426863-6426885 GAGTCACTCCATCTTGAATAGGG - Intergenic
949681193 3:6516397-6516419 GAGTAACAACAGATGGAAACAGG + Intergenic
951483755 3:23189312-23189334 GACTCATTCCAGCAGGAGACTGG + Intergenic
957369047 3:79267270-79267292 GAGTCATTCAAGCTGGACCCAGG - Intronic
959236988 3:103737114-103737136 AAGCCAGTCCAGCTGGAAGCAGG + Intergenic
962166966 3:133059350-133059372 AAGTCACTCCAGCAAGAACCAGG - Intronic
964378050 3:156069137-156069159 CATTCACTCCCCCTGGAAACGGG - Intronic
965670534 3:171143226-171143248 GAGACACAGCAGCTGGAAATTGG - Intronic
965825392 3:172724156-172724178 GAGTGACTCCAGTTTGAAAAAGG + Intergenic
967367078 3:188699352-188699374 GAGTTACTGCAGCTGGGAAAAGG - Intronic
967535832 3:190601815-190601837 GAGACACCCCAGCTGGCAGCTGG - Intronic
968319022 3:197749584-197749606 GAGTCCCTCCTGCTGCAGACAGG - Intronic
969689561 4:8696693-8696715 CAGCCTCTCCAGCTGGAAAGTGG + Intergenic
969944804 4:10772198-10772220 GCCTCACTCCAGCTGTAACCTGG + Intergenic
970221128 4:13812247-13812269 GAGTGACTCCATCTTGAAAGGGG + Intergenic
970318781 4:14855313-14855335 GAGTTGCTCCAGCTGGAAGATGG - Intergenic
973381168 4:49321966-49321988 GACTGACTCCAGCTGAAATCTGG - Intergenic
974508587 4:62807972-62807994 GAGTCACGTCAGCTGGTACCAGG + Intergenic
974878138 4:67722248-67722270 GAGTCACTCCATCTTGAATGGGG - Intergenic
976169461 4:82287965-82287987 GAGCTATTCAAGCTGGAAACTGG + Intergenic
978239793 4:106501891-106501913 AAGTCTCCCCAGATGGAAACAGG + Intergenic
980686113 4:136231358-136231380 GACTCAATTCAGCTGGTAACAGG - Intergenic
982802169 4:159719045-159719067 AAGTCACTTCTGCTGGAAGCAGG + Intergenic
986314102 5:6574627-6574649 AAGCCACTGCAGCTGGAGACAGG + Intergenic
989984194 5:50677335-50677357 TAGTCCCTCCAGCTGAAAAGCGG + Intronic
990504709 5:56432912-56432934 GAGTCTCCCCAACTGGCAACTGG + Intergenic
991425102 5:66482528-66482550 CTGTCTCTCCAGCTGGATACTGG + Intergenic
994624144 5:102196656-102196678 GTGACACTGCAGCTGGACACGGG - Intergenic
995110350 5:108421908-108421930 GAGTGACTCCATCTTGAATCGGG - Intergenic
998168031 5:139855645-139855667 CAGTCACTCAAGCTGGGGACAGG - Intronic
999265059 5:150261435-150261457 CAGTCACTCCACCAGGAGACAGG - Intronic
1002208572 5:177581703-177581725 CATTCACTGGAGCTGGAAACAGG + Intergenic
1003618997 6:7680884-7680906 GAGTGACTCCATCTTGAAAGGGG - Intergenic
1005195652 6:23280889-23280911 GAGCCAAACCAGCTGTAAACAGG + Intergenic
1005419268 6:25631995-25632017 AAGTTCCTCCATCTGGAAACCGG + Intergenic
1006597605 6:35204821-35204843 GATTAATTCCAGCTGGAAGCAGG - Intergenic
1006601004 6:35226041-35226063 GATTACTTCCAGCTGGAAACTGG - Intronic
1010029860 6:71262398-71262420 GTGACAGTCCAGCTGGAAACTGG + Intergenic
1011559082 6:88597001-88597023 CAGCCATTCCATCTGGAAACAGG + Intergenic
1013667171 6:112360707-112360729 GGGTCAGCCCAGCTGGAAAAAGG + Intergenic
1014169389 6:118262033-118262055 GAGACACACCAGCTGTAAAGAGG + Intronic
1018130824 6:160731198-160731220 GAGTCTCTACATCTGGAAGCAGG - Exonic
1018750768 6:166802646-166802668 CAGTTTCTCCAGCTGCAAACTGG - Intronic
1018835679 6:167481773-167481795 GAGTGACTCCATCTTGAAAAGGG - Intergenic
1021860803 7:24904165-24904187 GAGTCACTGCACCTGGCCACTGG + Intronic
1022827668 7:34032841-34032863 GAATCAGTCCTGCTGGAAAATGG - Intronic
1023633486 7:42185710-42185732 GAGTCTCTCCAGCCTGCAACTGG + Intronic
1024116137 7:46195628-46195650 GAGTGACTCCAACTGAAGACAGG - Intergenic
1024513131 7:50218806-50218828 GGGTGACTCCTGGTGGAAACAGG + Intergenic
1025785424 7:64639449-64639471 GAGTCACATCAGCTGGATTCTGG - Intergenic
1026945462 7:74313273-74313295 GAGCCACTCCAGCTGGAGGCTGG - Intronic
1027576749 7:79940666-79940688 TAGTCTCTCCAGAAGGAAACCGG - Intergenic
1027590862 7:80117260-80117282 GAATCTCTCCACCTGAAAACTGG - Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1030224388 7:107132652-107132674 CAGTCACTCCAGCTAGACACTGG - Intronic
1031141672 7:117949648-117949670 GAGTCACTCCTTCAGGACACTGG - Intergenic
1031141899 7:117951730-117951752 GAGTCACTCCTTCAGGACACTGG - Intergenic
1033264153 7:139870035-139870057 GAGCATCTTCAGCTGGAAACTGG - Intronic
1034335288 7:150319141-150319163 GAGTCACTCGACTTGGAACCGGG - Intronic
1035565327 8:637170-637192 GTGTCAGCCCTGCTGGAAACAGG + Intronic
1037283052 8:17265152-17265174 GAGTCACTCATGGTGGAAAATGG + Intronic
1038238450 8:25784939-25784961 GAATCATTCCACCTGGGAACTGG - Intergenic
1040358750 8:46644873-46644895 GAATCACACCAGCTGGGTACTGG - Intergenic
1044949754 8:97424245-97424267 GAGTCACTGCAGTTGGAAGAGGG - Intergenic
1047218675 8:122900557-122900579 AAGTCACTGCAACTAGAAACTGG - Intronic
1047223430 8:122937299-122937321 CAGTCATTCAGGCTGGAAACCGG - Intronic
1049351016 8:142164832-142164854 AGGTCACCGCAGCTGGAAACTGG - Intergenic
1053250926 9:36573303-36573325 GAGTCACGGAAACTGGAAACGGG - Intronic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1056821640 9:89846154-89846176 GAGGCACTGCAGCTGGGACCAGG + Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1059618607 9:115978204-115978226 GAGGCAATCCAACTGGAAACAGG - Intergenic
1059871317 9:118581224-118581246 CAGTCACTCAAGATGGAAAGCGG + Intergenic
1060189987 9:121586447-121586469 CAGTCTCTCCAACTGGAAGCAGG - Intronic
1060367781 9:123035926-123035948 CAGTCATGCCAGCTGGAAAGAGG - Intronic
1061078481 9:128355840-128355862 GGGTCTCTCCAGAAGGAAACGGG - Intronic
1187384889 X:18839454-18839476 GTGTCCCTCCAGCTAGGAACAGG + Intergenic
1190305611 X:49079932-49079954 GACTCACCCCAGCTGGAAAAAGG + Intronic
1192146107 X:68683968-68683990 GAGTTTCTCCAACTGTAAACTGG + Intronic
1200259376 X:154604202-154604224 GAGTCATTCCACCTGGAATCTGG + Intergenic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic
1200870573 Y:8093780-8093802 GACTCACATCAGCTGGATACTGG + Intergenic
1200889958 Y:8312966-8312988 GACTCACATCAGCTGGATACTGG - Intergenic
1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202465578 Y:25151318-25151340 GAGTCACTTCACCTGGCTACTGG - Intergenic