ID: 1071491803

View in Genome Browser
Species Human (GRCh38)
Location 10:86141230-86141252
Sequence CCAAGGGTGTTGACAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071491803_1071491814 19 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491814 10:86141272-86141294 CAGTCTCCATCAGTCTGTTCAGG No data
1071491803_1071491815 20 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491815 10:86141273-86141295 AGTCTCCATCAGTCTGTTCAGGG No data
1071491803_1071491818 27 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491818 10:86141280-86141302 ATCAGTCTGTTCAGGGCCATGGG No data
1071491803_1071491809 -9 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491809 10:86141244-86141266 CACCCTTGGGGTTCCCAGAGAGG No data
1071491803_1071491817 26 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491817 10:86141279-86141301 CATCAGTCTGTTCAGGGCCATGG No data
1071491803_1071491819 28 Left 1071491803 10:86141230-86141252 CCCCAGGCTGTCAACACCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1071491819 10:86141281-86141303 TCAGTCTGTTCAGGGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071491803 Original CRISPR CCAAGGGTGTTGACAGCCTG GGG (reversed) Intronic
900427843 1:2588551-2588573 CCAAGGCTGTTGGCATCCAGGGG + Exonic
901630027 1:10643490-10643512 CCCAGGGTTTGGACAGCCAGGGG - Intronic
902123457 1:14187945-14187967 CCAGGGATGTTGCCAGCCTATGG + Intergenic
903016974 1:20367476-20367498 CCAAGGGAGCTGTCAGCCTGTGG - Intergenic
905063571 1:35160454-35160476 ACAAGGGTGTTGCCTGGCTGAGG - Intergenic
905965547 1:42092464-42092486 CCATGGGTGGAAACAGCCTGAGG - Intergenic
909104796 1:71394092-71394114 CCCAGGTTGTTGAGGGCCTGTGG - Intergenic
909853474 1:80498956-80498978 ACTAGGGTTTTGACAGCTTGTGG + Intergenic
911754621 1:101538901-101538923 CCCATGGTCTTGACAGCCTATGG + Intergenic
915517067 1:156419899-156419921 CCATAGCTGTGGACAGCCTGTGG + Intronic
918458704 1:184754466-184754488 GTAAGGGTGCTGGCAGCCTGGGG - Intronic
920680595 1:208069575-208069597 CCCAGGGGCTTGGCAGCCTGGGG + Intronic
921065025 1:211616625-211616647 CCAAGTGTTTTGTCATCCTGGGG - Intergenic
922229590 1:223674137-223674159 TCAAGGGTGTTGAGTGCCTGTGG + Intergenic
923469527 1:234278255-234278277 CCAAGGCTGGTGACCACCTGAGG + Intronic
1067195398 10:44113722-44113744 GTCAGGGTGCTGACAGCCTGGGG - Intergenic
1067800207 10:49353499-49353521 CCGGGGGTGTAGACAGCCTCTGG + Intergenic
1069906282 10:71734448-71734470 GCGAGGGTCTTGATAGCCTGAGG + Intronic
1071491803 10:86141230-86141252 CCAAGGGTGTTGACAGCCTGGGG - Intronic
1072426410 10:95334422-95334444 CCATGGGTGTGCACAGGCTGTGG - Intronic
1075201541 10:120408672-120408694 CCAAGGGTGTTCTCTGGCTGGGG + Intergenic
1075287791 10:121202187-121202209 CCAAGGGTGATGAAAAGCTGAGG - Intergenic
1076428685 10:130386246-130386268 CCAACGTTGGTGAAAGCCTGTGG + Intergenic
1077317484 11:1925887-1925909 CCAAGGGTGCTGGCAGCCCTGGG - Intronic
1085233651 11:74994194-74994216 CCAGGGGTATTACCAGCCTGAGG - Intronic
1085237811 11:75028872-75028894 CCATGCGTGTAAACAGCCTGAGG - Intergenic
1087424054 11:97967391-97967413 TCAAGGGTGTTGGCACCCTGAGG + Intergenic
1088994338 11:114983517-114983539 GCAAGGGTGAAGACAGCTTGTGG - Intergenic
1089687844 11:120168483-120168505 CCCAGGGTGTTCCCGGCCTGAGG - Intronic
1090232618 11:125119496-125119518 CCAAGGGTGATGATAATCTGGGG + Intergenic
1092427590 12:8387011-8387033 GGAAGGTTGTTGTCAGCCTGGGG - Intergenic
1092428855 12:8393989-8394011 GGAAGGTTGTTGTCAGCCTGGGG - Intergenic
1093629131 12:21387409-21387431 CCAAGGGTGTACACAGCAGGAGG - Intronic
1097285148 12:57871305-57871327 CCCAGGTTGTTGAGAGGCTGAGG + Intergenic
1099574442 12:84362343-84362365 CCAAGGGTGCTGAGAGGCTCAGG - Intergenic
1100224613 12:92543482-92543504 CCTAGAGTGTTGACAACCTTGGG + Intergenic
1100685490 12:96982877-96982899 CCAAGGTTGTTGTCAGCTTTGGG - Intergenic
1102457930 12:113082337-113082359 CCACGGGTCTTGAGAGCCAGAGG - Intronic
1104294633 12:127500717-127500739 ACAAGGGTGGCGACAGCCCGAGG - Intergenic
1105247420 13:18666007-18666029 CCAGGGGTGTAGGCAGCCTCAGG + Intergenic
1106641283 13:31586998-31587020 CAAAGGATGTTGACAGCCTCAGG + Intergenic
1113138237 13:107117480-107117502 ACAAATGTGTTGAGAGCCTGAGG - Intergenic
1113711027 13:112465751-112465773 CCAAGGCTGTTTCCAGCCTCTGG - Intergenic
1119544646 14:75462799-75462821 TCATGGGTGTAGACAGCATGGGG + Intronic
1121437528 14:93929052-93929074 GCAAGGATGTGGACGGCCTGGGG + Exonic
1122118035 14:99537333-99537355 CCAGGCATGTTAACAGCCTGTGG - Intronic
1122248912 14:100424555-100424577 CCAAGGGGTTTAACTGCCTGTGG + Intronic
1125233479 15:37484276-37484298 CCTAGGCTGTAGACAGCATGGGG + Intergenic
1126864602 15:52923130-52923152 TAGAGGGTGTGGACAGCCTGGGG + Intergenic
1127509292 15:59624353-59624375 CCAAGGGGGTGGATGGCCTGAGG - Intronic
1128541056 15:68533503-68533525 CCAATGTTGTTGACAGACTGTGG + Intergenic
1129148445 15:73670962-73670984 CCTAGAGTGGTGACAGCCAGAGG - Intergenic
1129599644 15:76991095-76991117 GCCATGGTGTTGCCAGCCTGGGG - Intergenic
1129910290 15:79221115-79221137 CCCAGGTTCCTGACAGCCTGGGG + Intergenic
1131283914 15:91042243-91042265 CCAAGGGAGATCACAGACTGTGG + Intergenic
1132507310 16:317559-317581 CCATGGTTGCTGTCAGCCTGAGG - Intronic
1133043238 16:3072008-3072030 CCAAGGGCCTTGAAAGCATGTGG + Intronic
1133370654 16:5243367-5243389 GGAAGGTTGTTGTCAGCCTGGGG + Intergenic
1133552455 16:6870219-6870241 CCAAGAGAGTTAGCAGCCTGGGG + Intronic
1135630538 16:24032839-24032861 CCATGGCTGTTGACACCCAGAGG + Intronic
1136612822 16:31377667-31377689 CCAAGGGGTATGAGAGCCTGGGG - Intronic
1137276972 16:46941613-46941635 ACAAGGGTGATGCCAGTCTGAGG + Intergenic
1139670760 16:68491313-68491335 CCCAGGGAGTCCACAGCCTGAGG - Intergenic
1139731165 16:68946578-68946600 CCAAGGCTGTAGTAAGCCTGGGG - Intronic
1142641134 17:1286539-1286561 CTGTGGGTGTTGTCAGCCTGTGG + Intronic
1142699711 17:1651474-1651496 GCATGGGTGGTGACATCCTGGGG + Exonic
1142769789 17:2088327-2088349 CCAGGGATGTGGACATCCTGAGG + Intronic
1145787345 17:27602878-27602900 CCAGAGATGTTGACAGCCTGTGG + Intronic
1146922317 17:36722052-36722074 CCAGAGATGTTGTCAGCCTGGGG + Intergenic
1147846736 17:43409809-43409831 GCAACAGTGTTGACAGACTGAGG + Intergenic
1151530247 17:74699646-74699668 CCAGGGCTGTTGCCACCCTGGGG - Intronic
1152608431 17:81304303-81304325 CCAAGGATGATCTCAGCCTGTGG + Intergenic
1161004146 19:1926056-1926078 CCAAGGGAGAAGACGGCCTGGGG - Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161721400 19:5904620-5904642 CAAAGGATGTGGCCAGCCTGGGG + Intergenic
1161733992 19:5979015-5979037 CCTAGGGTGGTGACAGCCTGGGG - Intergenic
1161865951 19:6832347-6832369 CCAAGGATGAAGACAGCCTTGGG - Intronic
1162929783 19:13952158-13952180 CCAAGGGCCTGGACCGCCTGTGG + Intronic
1163220481 19:15914745-15914767 CCAAAGGTGCTCACAGCCTCAGG - Exonic
1163623349 19:18373789-18373811 CTCAGTGTGATGACAGCCTGGGG + Intergenic
1163754669 19:19099525-19099547 CCAAGTGTGTGGACAGACTCAGG + Intronic
927387740 2:22555500-22555522 ACAAGGGTGTTCTCAGCCTGTGG - Intergenic
928041948 2:27887254-27887276 CCAAGGATGTGGGCAGCCTCTGG + Intronic
928612117 2:33000840-33000862 CCAAGGTTGTTGACAGGAGGGGG + Intronic
930661300 2:54056364-54056386 CAAGGGATGTTGACAACCTGTGG - Intronic
933557691 2:83851152-83851174 GCTAGGGTGTTGCCAGCCAGAGG - Intergenic
935431380 2:102979773-102979795 ACATGGCTGTTGATAGCCTGAGG + Intergenic
935802594 2:106713945-106713967 CCAAGGCTGTTGAGAGCTTTGGG - Intergenic
935831822 2:107008363-107008385 CCAAGGGTGTCTACTGGCTGAGG - Intergenic
936451429 2:112636525-112636547 CCAAGGGTGTTCAAAGCCCAGGG + Intergenic
936517698 2:113192768-113192790 CCAAGGGTGTGGAGAGCATGAGG - Intronic
937118319 2:119425244-119425266 CCAGGTGTGTTGACAGACTTCGG - Intergenic
939508321 2:143075942-143075964 CCTAGGCTGTAGACAGCATGAGG - Intergenic
940678303 2:156752329-156752351 ACAAGGGTGATGCCAGCCTGAGG - Intergenic
940989568 2:160084152-160084174 TCAAGTGTGTTGATACCCTGAGG + Intergenic
943062894 2:183057153-183057175 CCAAAGGTCTTGGCAGCCAGAGG - Intergenic
943575289 2:189624796-189624818 CCAAGGGAGTAGGCAGCATGGGG + Intergenic
944177708 2:196851366-196851388 ACAAGGGTGGTGGCAGCCCGAGG - Intronic
946443580 2:219718345-219718367 ACAAGGGTGGTGTCAGTCTGAGG - Intergenic
946556140 2:220859849-220859871 GCAAGGGTGATGCCAGTCTGAGG + Intergenic
948683452 2:239654324-239654346 CCACTGGTGTGGACAGTCTGGGG + Intergenic
1169754294 20:9026804-9026826 CCAAGAGTGGAAACAGCCTGAGG - Intergenic
1170632080 20:18074379-18074401 CCAAGTGTGTTTACAGACTGAGG - Intergenic
1170881935 20:20304629-20304651 CCAAGGGAGTTGGCAGGCGGGGG - Intronic
1173790520 20:45824914-45824936 CCAAGGGCGCTGACAGAGTGGGG - Intronic
1173879627 20:46402187-46402209 CCAGGAGAGTTGACAACCTGAGG + Intronic
1174395994 20:50247202-50247224 CCAGGGGTCAGGACAGCCTGGGG + Intergenic
1175924601 20:62465647-62465669 GCCAGGGTGGTGACAGCATGTGG - Intronic
1182079277 22:27517793-27517815 CCATGGGTGTTTACAGGTTGGGG + Intergenic
1183538987 22:38418807-38418829 CCTAGGGTTTTGCCATCCTGGGG + Intergenic
949549749 3:5103067-5103089 GCAAGGGTGATGCCAGTCTGAGG + Intergenic
949985485 3:9537502-9537524 CCAAGGTTATTAACAGGCTGTGG - Intronic
951615904 3:24543703-24543725 TCAAGGGTGATGCCAGTCTGAGG + Intergenic
953002586 3:38949267-38949289 CCAAGTGTGCTCACAGCCTCAGG + Intronic
954385722 3:50242849-50242871 CCAAGGCTGCTGACAGCCTCAGG + Intronic
954809821 3:53241017-53241039 CCAAAGGTGTTGAAAGGCGGAGG - Intronic
954870349 3:53763166-53763188 CAAAGGGTGATGCCAGCCAGTGG + Intronic
958164913 3:89868259-89868281 TCAAGGGTTTTGATAGCTTGGGG - Intergenic
962434944 3:135357548-135357570 CCCAGGTTGTTGACAGCATGTGG + Intergenic
962974911 3:140437501-140437523 CCAAGGAGGCTGAGAGCCTGAGG - Intronic
963078383 3:141368757-141368779 CCCAGGGAGTTGACAGCGTCTGG + Intronic
965636587 3:170788276-170788298 CCAAGGATGTGGGCAGCCTCTGG + Intronic
968065104 3:195754139-195754161 TCAAGGGTGTAGACAGCCAAAGG - Intronic
968513431 4:1005141-1005163 CCAGGGGTGTGGCCAGCCTGTGG + Intergenic
970004650 4:11399232-11399254 CCAAGGGCTTTTACTGCCTGCGG - Exonic
971734963 4:30436285-30436307 CCAGGGTTTTTGACAGCCTTTGG + Intergenic
975554345 4:75645848-75645870 CCCAGGCTGGTGACAGCCAGTGG + Intronic
976561587 4:86507973-86507995 CCAAGGGTGATGACAGTCCAAGG - Intronic
978677285 4:111334432-111334454 AAAAGGGACTTGACAGCCTGTGG + Intergenic
982227553 4:153180347-153180369 ACAAGGTTCTCGACAGCCTGGGG + Intronic
991030735 5:62079781-62079803 CCAGGTGTGTTGACAGACTTTGG - Intergenic
991501288 5:67279798-67279820 CCAGGAGTGTTCACAGCGTGAGG - Intergenic
993646975 5:90474342-90474364 CCCTGTGTGTGGACAGCCTGTGG - Exonic
995416925 5:111922886-111922908 TCAAGGGTGTTGGCACTCTGAGG + Intronic
995797037 5:115952295-115952317 ACAAGGGTGATGCCAGTCTGAGG - Intergenic
996384369 5:122895475-122895497 CCAAGGGTGTAGGCAACCTTGGG + Intronic
999723871 5:154418905-154418927 ACAAGAGTGTTGACAGTTTGAGG + Exonic
1001201287 5:169719553-169719575 CCAAGGGTGTAGTCGGCCTCAGG + Intronic
1002996873 6:2294728-2294750 CCACAGGAGTTGCCAGCCTGTGG + Intergenic
1003343089 6:5240548-5240570 CCAAGGGTTTTGCCAAGCTGGGG + Intronic
1005597672 6:27394721-27394743 CCCAGGTTGTTGAATGCCTGTGG - Intronic
1005603800 6:27454880-27454902 TCGAGGGTGTTGACAACCAGGGG + Intronic
1006375296 6:33668493-33668515 CCTGGGGTGGTGACAGCCAGCGG - Exonic
1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG + Intronic
1006937800 6:37730495-37730517 CCAATGGTGGTGCCAGGCTGTGG + Intergenic
1007320117 6:41022105-41022127 CCAACTGTGGTGAAAGCCTGTGG + Intergenic
1009604748 6:65852629-65852651 CATGGGGTGTTGACAGCTTGAGG - Intergenic
1013196801 6:107851194-107851216 CCAAGCCTGTTGACAGACTTGGG + Intergenic
1016844401 6:148556707-148556729 CCAAGGGTGCTGAGAGGCAGTGG - Intergenic
1017875995 6:158524662-158524684 CCATGGGTGCTGACTGCCTAGGG + Intergenic
1018173605 6:161161120-161161142 CCAGGGTTGTTGAAAGCTTGGGG - Intronic
1018682527 6:166275710-166275732 CCAAGGATTTACACAGCCTGGGG + Intergenic
1018946972 6:168354541-168354563 CCAAGGCTGGGGAGAGCCTGTGG - Intergenic
1018996397 6:168713696-168713718 CCAATGGTGTGGACAGCCAGAGG - Intergenic
1019536791 7:1533563-1533585 CCAAGACTTTTGACTGCCTGTGG + Intronic
1021918788 7:25462716-25462738 CCAAGGGTGTGGACCGCATTTGG - Intergenic
1026853270 7:73737816-73737838 TCAAAGGTGTGGAGAGCCTGGGG + Intronic
1029345498 7:99975800-99975822 CTGAGGGAGTTGACAGCCTTGGG + Intronic
1029558887 7:101289544-101289566 CTGAGGGAGTTGACAGCCTTGGG + Intergenic
1030606747 7:111645815-111645837 CCAATTGTGTTGACAGGCTTTGG + Intergenic
1031546648 7:123058925-123058947 CCATGGATGTGGAAAGCCTGGGG - Intergenic
1031660521 7:124418643-124418665 GCAAGTGTGGTGACAACCTGGGG + Intergenic
1032406614 7:131660482-131660504 CCCAGGGTTTTGGAAGCCTGAGG + Intergenic
1033899258 7:146116066-146116088 AGAAGGGTTTTGACAGCCAGAGG + Intergenic
1035057679 7:156046798-156046820 CCAGGGGTGGTGACAGCATGTGG + Intergenic
1035080526 7:156212313-156212335 ACAATGGTGATGACAGCCAGGGG + Intergenic
1036412978 8:8519704-8519726 ACAAGGGTGTTGAATACCTGAGG + Intergenic
1036829580 8:12011565-12011587 CGAAGGTTATTGTCAGCCTGGGG - Intergenic
1038374820 8:27029466-27029488 CCAAGGGAATTGACACCCTCTGG - Intergenic
1038731721 8:30134037-30134059 ACAAGGGTGATGTCAGTCTGTGG - Intronic
1039873887 8:41569112-41569134 CCAGGGGGGTGGCCAGCCTGCGG - Intergenic
1040760233 8:50832925-50832947 CCAGGGGTGATGTTAGCCTGGGG - Intergenic
1042250796 8:66754186-66754208 ACAAGGGTCTTGGCAGCATGGGG + Intronic
1043873083 8:85456725-85456747 CCATGGGGGTTCACAGCCAGTGG + Intergenic
1044002879 8:86906788-86906810 CCAAGTATGTTGACAGCCACTGG - Intronic
1045159388 8:99520958-99520980 CCAAGGGGATTGTCAGCCTGGGG - Exonic
1045799485 8:106085800-106085822 CCAAAGGTGTTAACAGTATGTGG + Intergenic
1048631708 8:136249869-136249891 CCAAGGATGTTGGCAGCTTGAGG + Intergenic
1049932672 9:471497-471519 CCAAGGAAGATGACAGACTGAGG - Intronic
1051128194 9:13829368-13829390 CCAAGATTCTTGTCAGCCTGCGG + Intergenic
1056408448 9:86299677-86299699 CCAATGATTTTGGCAGCCTGTGG - Intronic
1057181460 9:93033017-93033039 CCGAGTGTGTTCCCAGCCTGGGG - Intronic
1057185112 9:93053128-93053150 CAGAGGGTCCTGACAGCCTGGGG - Intergenic
1057529444 9:95831269-95831291 CCAAAGCTGCTGACACCCTGTGG + Intergenic
1057954982 9:99400341-99400363 CTAAGGGTATTTACAGCTTGAGG + Intergenic
1058748680 9:108017354-108017376 CCAACAGTATTGACACCCTGAGG - Intergenic
1058950259 9:109896558-109896580 CCCAGTTTGTTGGCAGCCTGAGG + Intronic
1059868558 9:118545342-118545364 CAAAGGGTGCAGCCAGCCTGGGG - Intergenic
1060324558 9:122600668-122600690 ACAAGGGTGGTGACAGTCTGAGG - Intergenic
1060877683 9:127094978-127095000 CCAAGGGTCTGGACAGGCTGGGG + Intronic
1060909950 9:127341586-127341608 GAAAGGGTGTTGGCAGCATGGGG + Intronic
1061992200 9:134165363-134165385 CCGAGGGTCTGCACAGCCTGGGG + Intergenic
1062209586 9:135356488-135356510 CCAAGGGTCTTGAACGCCAGGGG + Intergenic
1189246426 X:39566877-39566899 CCAAGGATGGTGACATTCTGAGG - Intergenic
1192232034 X:69272032-69272054 CCAAGGGTGTGGGCAGCCCCTGG + Intergenic
1192233887 X:69284213-69284235 CCAAGGCTGCTGAGAGGCTGAGG + Intergenic
1194766408 X:97848064-97848086 CCAGAGGTGTTAAAAGCCTGGGG - Intergenic
1196798185 X:119519192-119519214 ACAAGGGTGATGCCAGTCTGAGG + Intergenic
1199992990 X:152999848-152999870 CCAAGGGTGCTCATAGCCAGGGG - Intergenic