ID: 1071492862

View in Genome Browser
Species Human (GRCh38)
Location 10:86147905-86147927
Sequence GAGTAAGCCCAGTGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071492862_1071492874 30 Left 1071492862 10:86147905-86147927 CCCAGAGCCCACTGGGCTTACTC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1071492874 10:86147958-86147980 GCCTCACCTGTTCCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071492862 Original CRISPR GAGTAAGCCCAGTGGGCTCT GGG (reversed) Intronic
900164446 1:1239184-1239206 GAGTAAGCCCAGGGCGTTCCTGG - Intergenic
900527218 1:3135192-3135214 GAGTCAGCCCAGTCGGCCCCAGG + Intronic
901797006 1:11685467-11685489 GAGCAGGCCCAGTGGGTGCTGGG - Intronic
902630290 1:17700819-17700841 CTGCAAACCCAGTGGGCTCTGGG - Intergenic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
903660174 1:24972299-24972321 GAGAGAGCTCAGAGGGCTCTGGG - Intergenic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
904960204 1:34326715-34326737 GAGTAAGCCCAGGATGCTCAAGG - Intergenic
905231113 1:36515425-36515447 GAGTAAGCCCTTGGAGCTCTGGG + Intergenic
905526695 1:38645392-38645414 GAATAATTTCAGTGGGCTCTGGG - Intergenic
908697036 1:66855179-66855201 GAGTAATTTCAGTGGGTTCTGGG - Intronic
909832928 1:80216307-80216329 GAGTCAGCCAAGTGGTCTATTGG - Intergenic
910631667 1:89361999-89362021 GAATAATTTCAGTGGGCTCTGGG - Intergenic
912470168 1:109901294-109901316 GAGGAAGCCCAGGTTGCTCTGGG - Intergenic
912546923 1:110457553-110457575 GAGGCAGCCTCGTGGGCTCTGGG + Intergenic
918407424 1:184224528-184224550 AAGTAAGCCCAGGGTGCTGTGGG - Intergenic
919501677 1:198345223-198345245 CACAAAGCCCAGTGGTCTCTGGG - Intergenic
921415877 1:214886372-214886394 GAGTAAGCTCAGTGGGAGCAGGG + Intergenic
922819572 1:228474789-228474811 GAATAAGCCCAGCAGGCTCTGGG + Intergenic
923220828 1:231891567-231891589 GAATAATTCCAGTGGGCTCTGGG + Intronic
923685393 1:236149793-236149815 GAGCTAGCTCAGTGGGCTCATGG + Intronic
1069808040 10:71138151-71138173 AAGGAGGCACAGTGGGCTCTGGG + Intergenic
1070238695 10:74656264-74656286 GAGGAAGCCCTGTGGGCCCTGGG - Intronic
1071492862 10:86147905-86147927 GAGTAAGCCCAGTGGGCTCTGGG - Intronic
1072709048 10:97703741-97703763 GAATAATTCCAGTGGGCTCTGGG + Intergenic
1073184845 10:101609703-101609725 GAGGGAGGCCAGTGGGGTCTGGG - Intergenic
1073535341 10:104271571-104271593 AAGTCAGCCCATTGGGCTCCAGG + Intronic
1073542621 10:104325804-104325826 GAGTAAGGCCTGTGGGCCCCAGG + Intronic
1075416148 10:122265845-122265867 GAATAATTTCAGTGGGCTCTGGG + Intergenic
1078442484 11:11379035-11379057 GAGGAGTCCCAGTGGGATCTGGG - Intronic
1078532672 11:12149091-12149113 GTGAAAGCCCAGTGGTCTTTAGG - Intronic
1079296944 11:19242097-19242119 GCCTAAGCTCCGTGGGCTCTGGG + Intergenic
1079314617 11:19397118-19397140 GAGAAAACCCAGAGGGCTATGGG + Intronic
1079455915 11:20636231-20636253 GAGAAGGCCCTCTGGGCTCTGGG + Intronic
1080027152 11:27626938-27626960 CAGTAACCCCTGTGGGCTCTTGG - Intergenic
1083268727 11:61559790-61559812 GAGTGTGCCCACTGGACTCTGGG - Intronic
1083540085 11:63506395-63506417 GAGTCAGCCCAGTGGGGGCAGGG + Exonic
1083948721 11:65941759-65941781 GAGTAAGCCATGTGGATTCTGGG + Intergenic
1084101220 11:66951001-66951023 GAGTAAGGGCAATGGGCTCATGG - Intronic
1085488081 11:76885643-76885665 GAGTAATTTCAGTGGGCGCTGGG + Intronic
1088031258 11:105253775-105253797 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1088124728 11:106410600-106410622 CAGTAATCACAGTGGGCTGTTGG - Intergenic
1089007581 11:115105389-115105411 GATTCAGCCCAGGGGGCTCAAGG + Intergenic
1089574534 11:119432093-119432115 GAATAATTGCAGTGGGCTCTGGG + Intergenic
1089647106 11:119887585-119887607 GAGTCAGCCAGGTTGGCTCTGGG - Intergenic
1090485332 11:127107591-127107613 GAGTAAACACAGTCGGCTCATGG + Intergenic
1091077051 11:132629035-132629057 GAATAATTTCAGTGGGCTCTGGG - Intronic
1094568151 12:31618388-31618410 GAGTGAGACCAGTGGGCTGGGGG + Intergenic
1096099634 12:48961975-48961997 GAGTCACCACACTGGGCTCTAGG - Intergenic
1096439313 12:51626165-51626187 GAATAATTCCAGTGGGCTTTAGG + Intronic
1096966150 12:55629678-55629700 GAGTAATTTCAGTGAGCTCTGGG + Intergenic
1102938226 12:116915171-116915193 GCCTTAGCCCTGTGGGCTCTGGG - Intronic
1102939068 12:116922723-116922745 GAGTAAGTCCAGTAGACTTTGGG + Intronic
1103742365 12:123099468-123099490 GACGAAGCCCTGGGGGCTCTGGG + Intronic
1104708649 12:130968846-130968868 GAGAAAGTCCAGGGTGCTCTTGG + Intronic
1106247665 13:27962946-27962968 GAGTAAGACAAGTGGGATTTGGG - Exonic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1113584876 13:111458309-111458331 GAGTGATTTCAGTGGGCTCTGGG - Intergenic
1119664862 14:76478222-76478244 GGGGAAGCCCAGTGTGCTCTGGG + Intronic
1122721235 14:103723775-103723797 AACTAAGCACAGTGGGCACTTGG + Intronic
1123138771 14:106055147-106055169 GAGGAAGCCCAGTGGAACCTGGG - Intergenic
1125085372 15:35723642-35723664 GACTAAGCCCACTGGGTCCTGGG - Intergenic
1127587258 15:60390383-60390405 CAGAAAGCCCAGTGGGTTTTAGG - Intronic
1129045783 15:72732908-72732930 GAATAATTTCAGTGGGCTCTGGG + Intronic
1129797022 15:78385442-78385464 GAGTAACATCAGTTGGCTCTGGG - Intergenic
1132784200 16:1645694-1645716 GAGTGAGACCAGTGGCTTCTGGG - Intronic
1132825772 16:1904533-1904555 GAGTAATTCCGGTGGGCTCTGGG - Intergenic
1133477726 16:6139529-6139551 GCCTGAGACCAGTGGGCTCTTGG - Intronic
1134119197 16:11571706-11571728 GAGTGGGCCCTGTGGTCTCTGGG + Intronic
1134532049 16:14990695-14990717 GAGTAAGCCCAGGGGGGAGTGGG - Intronic
1139863974 16:70049964-70049986 GAGTAAGCCCAGGGGGGAGTGGG + Intergenic
1140876518 16:79157864-79157886 GAGTAAGTTCAGCAGGCTCTGGG + Intronic
1141033022 16:80606236-80606258 GAGTAAGGCCCATGGCCTCTGGG - Intronic
1141765346 16:86054631-86054653 CAGTCAGCCCAGTGGTATCTAGG + Intergenic
1142016287 16:87749833-87749855 GTGTAATCCCAGTGTGCTTTGGG - Intronic
1143131040 17:4677054-4677076 GAGGAAGCCCAGCTGTCTCTGGG - Intronic
1144298252 17:13899623-13899645 GAATAAGTTCAATGGGCTCTGGG - Intergenic
1145942058 17:28747758-28747780 GAGCCAGCCCAGTTGGGTCTAGG + Intronic
1149367527 17:55960698-55960720 GAATAATTTCAGTGGGCTCTGGG + Intergenic
1151891947 17:76956287-76956309 GATTCAGCCTAGTGGGCCCTGGG - Intergenic
1157331685 18:46708645-46708667 GAGTAATTTCAGTGGGTTCTGGG - Intronic
1157966891 18:52218436-52218458 GAGTAAGCCCAGTAAGTCCTGGG - Intergenic
1163748558 19:19062180-19062202 GAGAAAGCCCAGTGGGGACCTGG + Intergenic
1166958018 19:46478754-46478776 AAGAAAGTCCAGGGGGCTCTGGG + Intergenic
926646377 2:15294167-15294189 AAGTAAGCCTAGGGTGCTCTGGG + Intronic
926805535 2:16707257-16707279 GAATAATTTCAGTGGGCTCTGGG + Intergenic
927320995 2:21745567-21745589 GATTCTTCCCAGTGGGCTCTTGG + Intergenic
929602144 2:43211041-43211063 GAGCAGTCCCAGTGGGCTCAGGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
931801737 2:65765421-65765443 GAATAATTTCAGTGGGCTCTGGG - Intergenic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
932893815 2:75619373-75619395 GAATAATTACAGTGGGCTCTGGG - Intergenic
933837335 2:86256526-86256548 GAATAATCTCAGTAGGCTCTGGG - Intronic
934901082 2:98160524-98160546 GAGGAAACCCAGTCGGCTCTTGG - Intronic
935019471 2:99215922-99215944 GAATAAGTTCAGTGGGCTCTGGG - Intronic
935040361 2:99420422-99420444 GAGTAATTCTGGTGGGCTCTGGG - Intronic
936228648 2:110680343-110680365 GGCTCAGCCCAGTGGGCTCAGGG + Intergenic
936621826 2:114108096-114108118 AGGTAAGGTCAGTGGGCTCTAGG - Intergenic
936923124 2:117709420-117709442 GAATAATTCCAGTGGGCTCTGGG - Intergenic
937289988 2:120776348-120776370 AGGGAGGCCCAGTGGGCTCTGGG + Intronic
945047505 2:205794874-205794896 GAGGACGCCCAGTGAGCTCATGG - Exonic
946168212 2:217878171-217878193 GGGCAAGCCCAGTGGCCTCCGGG + Intronic
946639092 2:221764153-221764175 TAGTAACCCCACTGGGCTATGGG + Intergenic
946899639 2:224359649-224359671 GAATAATTCCAGTGAGCTCTGGG - Intergenic
1168910414 20:1442563-1442585 GAGGAGGCCTATTGGGCTCTTGG - Exonic
1170636112 20:18106076-18106098 GAGTAATTTCAGTGGGCTCTAGG + Intergenic
1170810505 20:19670312-19670334 CATTGAACCCAGTGGGCTCTAGG - Intronic
1170819567 20:19744904-19744926 GAGTAATTTCAGTGGGCTCTGGG + Intergenic
1174500515 20:50980924-50980946 GAGTGAGCCCTCTGGGGTCTGGG + Intergenic
1175168110 20:57060803-57060825 GTCTGGGCCCAGTGGGCTCTGGG - Intergenic
1176698792 21:10017148-10017170 GAATAATTTCAGTGGGCTCTGGG + Intergenic
1177290451 21:19104212-19104234 GAGAAAGAACAGTGGGCTCAGGG - Intergenic
1179637801 21:42724595-42724617 GACTCAGCACAGTGGGCTCACGG - Intronic
1181163899 22:20973510-20973532 GAGAATGGCCAGTGGGTTCTGGG + Exonic
1181590854 22:23884027-23884049 GAGTGGGCCCAAGGGGCTCTGGG + Intronic
1182094114 22:27614625-27614647 GTGGGAGCCCAGCGGGCTCTAGG + Intergenic
1182705870 22:32279976-32279998 GAGTAAGGCAATTGGGCACTTGG - Intergenic
1183362162 22:37388317-37388339 GAGGAAGCACAGGGGGCTGTGGG - Intronic
1183422279 22:37718771-37718793 GTGTGAGCCCATTGGGATCTGGG + Intronic
1184369761 22:44074896-44074918 GGAGGAGCCCAGTGGGCTCTGGG + Intronic
1184394202 22:44223046-44223068 GAGTAAGGCAATTGGGCACTTGG - Intergenic
1184687205 22:46102083-46102105 GGGCAAGCCCCGTGGGCTCTGGG - Intronic
1184909096 22:47514094-47514116 GAGGCTGCCCAGGGGGCTCTGGG - Intergenic
950644137 3:14367208-14367230 GAGTGAGCCCCGTGGGCATTTGG + Intergenic
952945329 3:38475077-38475099 GAGGAGGCCCTGTGGCCTCTGGG + Intronic
953392455 3:42541324-42541346 CAGTAACCCCAGTAGGCTATGGG + Intergenic
954192554 3:48974212-48974234 AAGTATGGCCTGTGGGCTCTAGG + Intronic
959252662 3:103967046-103967068 GAACAAGCCCAGTGGGCCCAGGG + Intergenic
961029026 3:123585761-123585783 GGATAAGCCCATTGGGCTGTCGG + Intergenic
962251426 3:133838344-133838366 GAGGGAGCCCACTGGGCCCTTGG + Intronic
964474239 3:157084309-157084331 AACTAAGCCCAGTGGGTCCTGGG + Intergenic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969176574 4:5403320-5403342 GAGTAATTTCAGTGTGCTCTGGG - Intronic
970960890 4:21870092-21870114 TAAGAAGCCCAGTGGACTCTAGG + Intronic
974305959 4:60140431-60140453 GAGTAATGTTAGTGGGCTCTTGG - Intergenic
974459024 4:62164028-62164050 CAGTGGGCCCAGTGGGTTCTGGG + Intergenic
975410087 4:74038880-74038902 GAGTAACCCCCGTGCACTCTGGG + Intergenic
976014817 4:80539482-80539504 GAATAATGCCAATGGGCTCTGGG + Intronic
979637735 4:122977207-122977229 GAACAAGCCCAGTGGGCCCGAGG - Intronic
980342004 4:131562751-131562773 GAGTAAGCCCAGTGAAGTTTTGG + Intergenic
980371260 4:131876493-131876515 GAATAATTTCAGTGGGCTCTGGG + Intergenic
982553268 4:156829426-156829448 GATTTAGCCAAGTGGGCACTCGG - Intronic
983485514 4:168327818-168327840 GAGTAATTTCAGTGGGTTCTGGG + Intergenic
984047650 4:174821217-174821239 GAGAAAGTCCAGTGGCTTCTTGG + Intronic
984196238 4:176660961-176660983 GATTGAGCCCAGTGGGGTCATGG - Intergenic
984875290 4:184362463-184362485 AAATCAGCCCAGTGGGCTCAGGG + Intergenic
985009564 4:185568633-185568655 CAGACAGCCCAGTGGGCTCCAGG + Intergenic
985403290 4:189613121-189613143 GAGTAACCACAGTGGGCTCCTGG - Intergenic
985530842 5:433190-433212 GAGGATGCCCCGTGGGCTCTGGG + Intronic
985544895 5:504603-504625 GGGTGAGCCCAGAGGGCTCGGGG + Intronic
986310773 5:6549492-6549514 GAGAAAGCCCACTGGGCTATAGG - Intergenic
989114737 5:37941467-37941489 GAGTGAGCACCGTGGGCCCTGGG + Intergenic
989955531 5:50354898-50354920 GAGTAATTCTAGTGGGCCCTGGG - Intergenic
990604670 5:57396546-57396568 GAATAATTTCAGTGGGCTCTGGG - Intergenic
992826529 5:80554762-80554784 GAATAACTTCAGTGGGCTCTGGG + Intergenic
994235600 5:97358572-97358594 GAGAATACCAAGTGGGCTCTTGG - Intergenic
997360646 5:133292471-133292493 GAGTCAGCCCACTGGCCTCCTGG + Intronic
999140694 5:149359546-149359568 GAGTAAGCAGAGTGTGCTGTGGG + Intronic
1001977108 5:176009164-176009186 GAGTAATTTCAGTGAGCTCTGGG - Intronic
1002183443 5:177443022-177443044 GAGTCAGCCCTGGGGGCTCCTGG - Intergenic
1002240319 5:177834616-177834638 GAGTAATTTCAGTGAGCTCTGGG + Intergenic
1002335053 5:178471780-178471802 AAATAATTCCAGTGGGCTCTGGG - Intronic
1002426635 5:179180660-179180682 GAATAATTCCAGTGGGCTCTGGG - Intronic
1002703092 5:181141059-181141081 GAGTAATTTCTGTGGGCTCTGGG - Intergenic
1006604409 6:35245764-35245786 GAATGAGCCCAGTGGGCAATGGG + Intronic
1006727990 6:36213908-36213930 GTGCAGGCCCAGTGGGCTCCAGG - Exonic
1007719022 6:43874505-43874527 GAGGGAGCACAGTGGGCTATGGG - Intergenic
1007751530 6:44074476-44074498 AGGTAAGCCCAGGTGGCTCTTGG - Intergenic
1008133567 6:47746092-47746114 GTGTAAGCACAGTGGCCTGTGGG - Intergenic
1010694171 6:78949483-78949505 GAATAATTCCAGTGGGCCCTGGG - Intronic
1010761806 6:79732702-79732724 GAATAATTTCAGTGGGCTCTAGG - Intergenic
1012165969 6:95952689-95952711 GAGTAGGCACAGTGGGTTCAAGG - Intergenic
1013320457 6:108982946-108982968 GAGTAATCCCAGTGGGTTACCGG + Intergenic
1015450990 6:133365687-133365709 GAGTAATTTCAGTGGGCTGTGGG + Intronic
1016857973 6:148690748-148690770 GAGTAAACCCAGTTGAATCTGGG + Intergenic
1020763010 7:12290732-12290754 GAGTCAGTCCAGTGGCCTTTTGG - Intergenic
1021152837 7:17173157-17173179 GAATAATTTCAGTGGGCTCTAGG - Intergenic
1021526518 7:21594637-21594659 GAGTCAGCCAAGTGGGCCTTTGG + Intronic
1023284922 7:38609026-38609048 GTAAAAGCCCAGTGGGCTCTTGG + Intronic
1024544543 7:50506107-50506129 GAATAATTTCAGTGGGCTCTGGG + Intronic
1026487764 7:70836090-70836112 AAGTGTGCCCAGTGGGCTCTAGG - Intergenic
1029382143 7:100221258-100221280 GGGAAAGCCCAGTGGCCTCATGG - Exonic
1029402296 7:100353703-100353725 GGGAAAGCCCAGTGGCCTCATGG - Intronic
1031305654 7:120123276-120123298 GAGTAAGCTCACTTGGCACTGGG - Intergenic
1031565022 7:123285336-123285358 GAGTAATTTCAGTGGGTTCTGGG + Intergenic
1032430676 7:131858809-131858831 GAACAAGCCCACTGGCCTCTTGG + Intergenic
1033889032 7:145985534-145985556 GAGTAAGCTAAGTGGAATCTGGG + Intergenic
1034441834 7:151089581-151089603 GAGGAAGTGCAGTGGGCACTTGG + Intronic
1036988652 8:13566753-13566775 GCGCAAGCGCAGTGGGCGCTGGG + Intergenic
1037405771 8:18540979-18541001 GAGGAAGTCCTGTGGGCTTTTGG - Intronic
1038044387 8:23753869-23753891 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1039446576 8:37637760-37637782 GACTAAGACCAGGGGGCTCCCGG - Intergenic
1039828606 8:41195260-41195282 AAGCAAGCCCAGGTGGCTCTGGG + Intergenic
1041020259 8:53631767-53631789 GAGTAATTTCAGTGGACTCTGGG + Intergenic
1043311016 8:78859506-78859528 GTGTCTGCCCAGTGGGGTCTCGG + Intergenic
1043756024 8:84005355-84005377 GAATGAGCCCAGTGGGCACGGGG - Intergenic
1048403767 8:134097368-134097390 AAGTAAGCCATGTGGGCTTTTGG + Intergenic
1048902363 8:139051008-139051030 GAGAAAGCACAGTGGGCCCAGGG - Intergenic
1048959148 8:139561586-139561608 TATAAAGCCCAGTGGTCTCTGGG - Intergenic
1053635893 9:40003356-40003378 GAATAATTTCAGTGGGCTCTGGG + Intergenic
1053770091 9:41461281-41461303 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1054316771 9:63600459-63600481 GAATAATTTCAGTGGGCTCTGGG + Intergenic
1054548764 9:66372772-66372794 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1055875725 9:80939513-80939535 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1056468166 9:86879242-86879264 GAGTAATTTCAATGGGCTCTGGG + Intergenic
1057228620 9:93305465-93305487 GATCCAGACCAGTGGGCTCTGGG - Intronic
1058862872 9:109134340-109134362 GAGGAAGCCCAATGTGCTATGGG + Exonic
1059796399 9:117701820-117701842 GAATAACCTCAGTGGGCTCTGGG + Intergenic
1060473941 9:123971161-123971183 GACTGAGCCGAGAGGGCTCTGGG - Intergenic
1062711972 9:137979997-137980019 CAGGAAGCCCTCTGGGCTCTTGG + Intronic
1187850350 X:23585582-23585604 GTGGAAGCCTAGTGGGATCTTGG + Intergenic
1189376890 X:40473584-40473606 GAATAATTTCAGTGGGCTCTGGG - Intergenic
1190242547 X:48668676-48668698 AAGTAAGTCCAGGGGGCCCTGGG + Intergenic
1193358509 X:80551786-80551808 GAGAAAGCCAAGTGGGGCCTAGG + Intergenic
1196776262 X:119340715-119340737 GAGTAAGCACAAAGTGCTCTGGG + Intergenic
1198228709 X:134669862-134669884 GAGTCAGGCCAGTCTGCTCTTGG + Intronic
1198636750 X:138710522-138710544 GTGCATGCCCGGTGGGCTCTGGG - Intronic
1200796551 Y:7346192-7346214 GAGGAGCCCCAGAGGGCTCTGGG - Intergenic