ID: 1071494946

View in Genome Browser
Species Human (GRCh38)
Location 10:86161787-86161809
Sequence ATGGAACTGGATCACTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071494938_1071494946 16 Left 1071494938 10:86161748-86161770 CCTGAGCCACAGGCTTGCAAGCA 0: 1
1: 0
2: 1
3: 25
4: 171
Right 1071494946 10:86161787-86161809 ATGGAACTGGATCACTGAAATGG No data
1071494941_1071494946 10 Left 1071494941 10:86161754-86161776 CCACAGGCTTGCAAGCAGGTGGT 0: 1
1: 0
2: 0
3: 42
4: 968
Right 1071494946 10:86161787-86161809 ATGGAACTGGATCACTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071494946 Original CRISPR ATGGAACTGGATCACTGAAA TGG Intronic
No off target data available for this crispr