ID: 1071499624

View in Genome Browser
Species Human (GRCh38)
Location 10:86194076-86194098
Sequence CAGAGAAAGGAGAAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071499624_1071499627 -5 Left 1071499624 10:86194076-86194098 CCAGAACACTTCTCCTTTCTCTG 0: 1
1: 1
2: 1
3: 39
4: 368
Right 1071499627 10:86194094-86194116 CTCTGCCTTATTTTGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071499624 Original CRISPR CAGAGAAAGGAGAAGTGTTC TGG (reversed) Intronic
901190857 1:7408976-7408998 CTGGGACAGGAGGAGTGTTCTGG - Intronic
901944824 1:12693215-12693237 AAGCGAAAGGAGAGGTGTTCGGG + Intergenic
905206423 1:36345211-36345233 CGGAGAACGGAGTTGTGTTCTGG - Intronic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
906297454 1:44657966-44657988 CAGAGAAGGCAGAGGTGTTGAGG - Intronic
907845945 1:58206956-58206978 CTGAGAGAGCAGAAGTGTGCAGG - Intronic
908130405 1:61069439-61069461 CAGATAAAGGATAATTTTTCAGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913039110 1:115005806-115005828 CTGAGACAGGAGAATCGTTCAGG - Intergenic
913239795 1:116820064-116820086 CACAGCAAGGAGAGGTGTACTGG - Intergenic
914213231 1:145600981-145601003 GTGAGAAAGTAGAAGTGTCCTGG + Intergenic
914465169 1:147921422-147921444 GTGAGAAAGTAGAAGTGTCCTGG + Intergenic
914760536 1:150594958-150594980 AAGAGAAAGGATAAGTGTTAGGG + Intergenic
914907938 1:151761978-151762000 GGGAGAAAGGGGAAGTGTTGTGG - Intronic
915606076 1:156951825-156951847 AAGAGTCAGGAGATGTGTTCTGG + Intronic
916864366 1:168839290-168839312 AAGAGAAGGAAGCAGTGTTCAGG - Intergenic
916880099 1:169012431-169012453 CAGTGAAAAGAGATGTGTTTAGG - Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
922193563 1:223340472-223340494 AAGAGACAGGAAAAGTGTCCTGG + Intronic
923084952 1:230696111-230696133 CAAAGAAAGGAGAGATGTTCTGG - Intergenic
923960994 1:239083980-239084002 TAGAGAAATGCAAAGTGTTCTGG - Intergenic
1062846746 10:713113-713135 CAGAAAGAGGAGAAGTGTAAAGG + Intergenic
1063257094 10:4340398-4340420 CAGAGCAAGGACAAATGTTCTGG - Intergenic
1063759831 10:9061029-9061051 CACAGAAAAGATAAGTGTTTTGG + Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1063870901 10:10416702-10416724 CAGAGACAACAGAAATGTTCTGG + Intergenic
1064071132 10:12229058-12229080 CACAGAAAGGAGAAGCGTAGAGG - Intronic
1064704132 10:18053308-18053330 CAGAGAAAGGAAAATTGTCAAGG + Intergenic
1065558073 10:26936554-26936576 CAGGGAAAGAAGAAGGGATCAGG + Intergenic
1067203114 10:44191981-44192003 CAGAGAACAGAGAAATGTTAGGG + Intergenic
1068220297 10:54036014-54036036 CAGAGAAAGGAAGAGAGTTAAGG - Intronic
1068247028 10:54386191-54386213 CAGTGAAAGAAGAATTGTTTTGG + Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1069784626 10:70979847-70979869 CAGGGGCAGGAGAAGTGTTAGGG - Intergenic
1069788600 10:71005322-71005344 CTGAGGAAGGAGCACTGTTCTGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1073030193 10:100519705-100519727 CCGAGAAAGGAGCAGTGCTCCGG + Intronic
1073356490 10:102859119-102859141 AAAAGAAAGGAGAAATGTGCAGG - Intronic
1073525791 10:104180871-104180893 GAGAGGCAGGAGAAGAGTTCAGG - Intronic
1074319690 10:112390372-112390394 AAGAGAAAGTAGCAGTGTTAGGG + Intronic
1075395956 10:122127225-122127247 CAAAGAAAGGAGAACTGTGAAGG - Intronic
1077669516 11:4144984-4145006 TACAGAAGGGAAAAGTGTTCAGG - Intergenic
1078738707 11:14046254-14046276 TAGAGAAAGGAGTAGGGTTGGGG - Intronic
1078744032 11:14094256-14094278 CAAAGAAAGGAGACGGGTTGAGG - Intronic
1079526132 11:21390550-21390572 TAGAGAAATGGGAAGTGTTTGGG - Intronic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1080287753 11:30635916-30635938 CAGTGAAAACAGAAGTCTTCGGG - Intergenic
1081243854 11:40739404-40739426 CAGAGAATGGAAGAGTATTCAGG - Intronic
1081365690 11:42232296-42232318 CATAGAAAGCAGAAGGGATCTGG - Intergenic
1082923048 11:58516652-58516674 CAGAGAAAATATTAGTGTTCTGG - Intergenic
1083223378 11:61267946-61267968 CAGAGAGGGGAGTAGTGTTGGGG - Intronic
1083254160 11:61486192-61486214 CTGAGAAAAGGGAAGTGTTTGGG - Intronic
1083600462 11:63944319-63944341 CAGGGAAAGGAGGGGTGTTGGGG + Intronic
1083949800 11:65947639-65947661 CAGAGAAAGGGGCAGATTTCTGG + Exonic
1084717459 11:70882999-70883021 CAGAGAGAGAAGCAGTGTTATGG + Intronic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085757748 11:79215660-79215682 CATAGAAAGTAGAGGAGTTCTGG - Intronic
1086663603 11:89452671-89452693 CAAAGAAATGATAAGTGTTTTGG - Intronic
1086886613 11:92213470-92213492 CTCAGAAAGGAAAAGAGTTCTGG + Intergenic
1087269532 11:96097426-96097448 GGGAGAAAGGAGAAGTATTAGGG + Intronic
1089078312 11:115756633-115756655 CAGAGAAAGGATAAGCATTCGGG - Intergenic
1089086211 11:115819028-115819050 CAGAGAAAGGCAAAGTTTGCTGG + Intergenic
1089633803 11:119799583-119799605 CACAGGAAGGAAAGGTGTTCTGG - Intergenic
1090471804 11:126987602-126987624 CAGAGAAAGGAGCATTGATATGG + Intronic
1090632256 11:128660050-128660072 CTGAGAAAAGAGAAGTGCTCAGG - Intergenic
1090717921 11:129446678-129446700 CTGAGAAAGGACAAATGCTCAGG - Intronic
1092149220 12:6235760-6235782 CAGGGGAATGACAAGTGTTCTGG + Intronic
1092751596 12:11724301-11724323 CAGAGAAAGGAGTATGGTTTGGG + Intronic
1093235478 12:16604864-16604886 CAGAAAAAGGAGAAAAGTTTTGG - Intronic
1093724888 12:22493116-22493138 AAGAGAATAGCGAAGTGTTCAGG - Intronic
1095370813 12:41465181-41465203 TAGAGAAAGGAGTAGAGTTAGGG - Intronic
1095502296 12:42853682-42853704 CAGAGAAAGGAGAACTTCTCAGG - Intergenic
1096436528 12:51595348-51595370 AAGACAAAGGAGAAGGTTTCTGG + Intronic
1096881005 12:54670518-54670540 CAGAGAAAATACAAGTGTTTTGG + Intergenic
1097415752 12:59314349-59314371 CAAAGAAATGACAAGTGTTTGGG + Intergenic
1100700014 12:97137458-97137480 CATAGAAAAGAGAAGAGTTAGGG - Intergenic
1101026990 12:100618710-100618732 CAGAGAATGGAGAATAGTACCGG - Intronic
1101359225 12:104010293-104010315 CTGAGATAAGAGTAGTGTTCAGG - Intronic
1101995848 12:109524406-109524428 CAGAGAAGGGGAAAGTGTTAGGG - Intronic
1102790687 12:115642743-115642765 AAGAGGAAAGAGAAGTGTGCAGG - Intergenic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1104222541 12:126798901-126798923 CAGAAAGAGGAGGAGTGTTATGG + Intergenic
1104272489 12:127294533-127294555 CATAGAAATGTTAAGTGTTCAGG - Intergenic
1104529904 12:129559947-129559969 CAGTGAAAAGAGTACTGTTCAGG + Intronic
1104572793 12:129939996-129940018 CTGATAAATGAGAAGTCTTCTGG + Intergenic
1105402097 13:20105045-20105067 CAGACAAGGGAGAAGTGCACGGG + Intergenic
1105910070 13:24855969-24855991 CCAAGAAGGGATAAGTGTTCAGG - Intronic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1108537918 13:51405350-51405372 GAAAGAAAGAGGAAGTGTTCAGG + Intronic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1111489915 13:88958927-88958949 ATGAGAAAGGAGAAGAGTTTAGG - Intergenic
1112415320 13:99199775-99199797 CAAAGAAATGACAAGTGTTTTGG - Intergenic
1112591324 13:100765654-100765676 CAGACAAAGGAAAGGTTTTCAGG + Intergenic
1112845012 13:103631470-103631492 AAGAGAAAGAAAAAGAGTTCAGG - Intergenic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1114572924 14:23687172-23687194 CAGAGAGAGGAGAATGGATCTGG + Intergenic
1115661837 14:35502971-35502993 CAAAGAAAGCATAAATGTTCAGG + Intergenic
1116318996 14:43435635-43435657 GAGAGAAAGGGGAAGTGGTAGGG + Intergenic
1116505688 14:45677467-45677489 CTAAGAAAGGAGAAGTGCTCTGG + Intergenic
1117134899 14:52725617-52725639 AAGATAAAGGAGAAATGATCAGG - Intronic
1117389457 14:55249227-55249249 CAGAGAAAGAAAAAGTTATCTGG - Intergenic
1118443403 14:65831441-65831463 TGGAGACAGGAGCAGTGTTCAGG - Intergenic
1119231073 14:72980287-72980309 CTGTAAAAGGAGAAGTGTGCAGG + Intronic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1121458632 14:94055857-94055879 CAAAGAAATGGGCAGTGTTCAGG - Intronic
1121561568 14:94880093-94880115 CTGAGAAATGAAAAGTGTTGGGG + Intergenic
1122277976 14:100605004-100605026 CAGGGAAAAGAGAAGTGTCTAGG - Intergenic
1125229698 15:37439314-37439336 CAGAGAAAGTTCAAGTGTTTAGG + Intergenic
1125695142 15:41629997-41630019 GAGAGAAAGTAGAAATCTTCAGG - Intronic
1126014205 15:44334200-44334222 CCCAGAAAGGAGAAGTTCTCTGG - Intronic
1127524531 15:59779272-59779294 CAGAGAAATGACAAGTGGCCTGG + Intergenic
1130286770 15:82562207-82562229 CAGACAAAGGAAAAGTGCTGAGG - Intronic
1130966092 15:88699125-88699147 CAGAGTAAAGTGGAGTGTTCTGG - Intergenic
1131317575 15:91353544-91353566 GAGAGAAAGGAAAGGTGTTTGGG - Intergenic
1131444119 15:92481718-92481740 GATAGCAAGGAGAACTGTTCTGG + Intronic
1133161752 16:3916447-3916469 CAGAGAAAGGACATGGGCTCTGG + Intergenic
1133180842 16:4053458-4053480 CAGAGGAAGGGCAAGTGCTCTGG - Intronic
1136160197 16:28414945-28414967 GAGGGAGAGGAGGAGTGTTCAGG + Intergenic
1136202891 16:28700345-28700367 GAGGGAGAGGAGGAGTGTTCAGG - Intronic
1141844560 16:86598631-86598653 CAGAGAATGGAGTTATGTTCAGG - Intergenic
1141888061 16:86906641-86906663 CAGGAAAAGGAGAAGTCTCCTGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1143588949 17:7868436-7868458 TGCAGAAAGGAGGAGTGTTCTGG + Intronic
1143617544 17:8062632-8062654 CACAGAAAGGAAAAATGGTCTGG + Intergenic
1143730599 17:8880676-8880698 CAGAGAAGGGAGCAGAGATCAGG + Exonic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1144355907 17:14445998-14446020 AAGAGAAAGTAGAACTCTTCAGG - Intergenic
1144437717 17:15256294-15256316 CAGAGAGAGGTGAAGTGTCATGG + Intronic
1145178670 17:20725285-20725307 CAGAGGAAGTAGCAGTGTCCTGG - Intergenic
1147575453 17:41596350-41596372 CAGAGAACAGAGAAGAGTCCAGG + Intergenic
1147699646 17:42384937-42384959 CAGAGAAAGGAGAGGTTATGAGG - Intronic
1148357123 17:46982896-46982918 CGGAAAAAGGAGAAGGCTTCAGG + Intronic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149159327 17:53671981-53672003 TAGAGAAAGAAGAAGTGTGGTGG + Intergenic
1149838311 17:59934857-59934879 CAGAGGAAGTAGCAGTGTCCTGG - Intronic
1150081001 17:62238429-62238451 CAGGGGAAGTAGCAGTGTTCTGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151489711 17:74425518-74425540 AAGAGATAAGAGAAGTGTACTGG + Intronic
1203156698 17_GL000205v2_random:10771-10793 CAGACACAGCAGGAGTGTTCTGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153679095 18:7483723-7483745 CAGATTGAGTAGAAGTGTTCAGG + Intergenic
1154383264 18:13871219-13871241 CAGATAAAGGAGGAGACTTCTGG - Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156217163 18:35011321-35011343 CAGAGAAAGGGAAATTGTTTGGG + Intronic
1156798968 18:41085177-41085199 CAGAGAAAGATGATGTGTTTTGG + Intergenic
1156812717 18:41272445-41272467 CATAGAAATGACAAGTGTTTTGG + Intergenic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1157913586 18:51642120-51642142 CAGAGAGAGGAAAAGTCCTCAGG - Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158791145 18:60782001-60782023 CAGAGATATGAGATGAGTTCTGG + Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159507389 18:69354772-69354794 GAGAGTAAGGAGGAGTGTCCCGG - Intergenic
1159767551 18:72508854-72508876 CAGAGAAAGTAAGACTGTTCTGG - Intergenic
1164489294 19:28692069-28692091 CAGAGAAAGAAAAAGCTTTCTGG + Intergenic
1164518050 19:28953260-28953282 CAGAGGAGGGAGAATTGTTAAGG + Intergenic
1165236385 19:34425244-34425266 CCGAGAAAGGATAAGGATTCAGG - Intronic
1166622305 19:44312541-44312563 CAGGGAATGGAGAAGAGTACTGG - Intergenic
1167929570 19:52853280-52853302 CAGGGAAAGGAGATGTCTTATGG + Intronic
925516690 2:4690931-4690953 CAGAGAAAGAAAAAGTTTTTTGG - Intergenic
926758183 2:16252596-16252618 CAGAGAAATGAGAACTATTTGGG - Intergenic
927141033 2:20130951-20130973 CAGGGAAAGGTAAAGTGTCCTGG - Intergenic
927445779 2:23160379-23160401 CATAGAAACCAGATGTGTTCTGG + Intergenic
928193048 2:29191581-29191603 CAGAGAAAGGAAGAGTTGTCTGG + Intergenic
930160141 2:48146426-48146448 GAGAGAAAGGACAAGTGTACTGG - Intergenic
932176241 2:69605385-69605407 CAGAGCAAGGAGAATGGTTAGGG - Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
933342774 2:81043658-81043680 CAGAGAAGGGAGAACTCTTTTGG - Intergenic
934578257 2:95416848-95416870 GAGGGAAAGAAGGAGTGTTCAGG - Intergenic
934601180 2:95659855-95659877 GAGGGAAAGAAGGAGTGTTCAGG + Intergenic
935375214 2:102388558-102388580 CTAAGAAAGGAGAGGTGATCCGG - Intronic
935472779 2:103479802-103479824 CTGGGGAAGGAGAAGAGTTCAGG + Intergenic
936534555 2:113302022-113302044 GAGGGAAAGAAGGAGTGTTCAGG + Intergenic
936699296 2:114991290-114991312 AAGAGAAAGGTAGAGTGTTCAGG + Intronic
936820946 2:116520419-116520441 CAAAGCAAGGAAACGTGTTCAGG + Intergenic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937253256 2:120537279-120537301 CAGAGACAGGAGAAATGTTGGGG + Intergenic
937752395 2:125492281-125492303 CAAAGAAATGACAAGTGTTTGGG - Intergenic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
938624179 2:133090748-133090770 CAGAGAATGTAGAAGTCTTAGGG - Intronic
939207760 2:139129561-139129583 AAGAGAAAGCAGAATTATTCTGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
942419385 2:175792395-175792417 CAGACCAAGGACTAGTGTTCTGG - Intergenic
942487993 2:176459314-176459336 GAGAGGCAGGAGAAGTGTTGAGG + Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942899377 2:181095759-181095781 CAGAGAAAGGGGAAGCTGTCAGG - Intergenic
943719710 2:191191073-191191095 CAGAAAAAAGGGAAGTCTTCAGG + Intergenic
945672043 2:212813992-212814014 CAAAGAAAGGAAAAGGGTACAGG - Intergenic
945884521 2:215361169-215361191 AAGTGAAAGCAGAAGTGTTTGGG + Exonic
946538230 2:220655418-220655440 CAGAGAAAAGAGAATAATTCTGG + Intergenic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
947262203 2:228235970-228235992 CAGAGAAAAGAAAAGTTATCTGG - Intergenic
947351970 2:229255800-229255822 CATAGAAACTAGAAGTGTTGGGG - Intronic
948686076 2:239670492-239670514 CAGAGGGAAGAGAAGTGTCCTGG - Intergenic
948889170 2:240898448-240898470 CAGAGAAACCAGACGTGTCCTGG + Intergenic
1169592286 20:7158148-7158170 TATAGAAAGGAGAATAGTTCAGG + Intergenic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1170045531 20:12081239-12081261 AAGATTAAGGAGAAGTATTCTGG - Intergenic
1170061935 20:12268430-12268452 CTTAGAGAGGAGAAATGTTCAGG + Intergenic
1171030073 20:21669176-21669198 CAGAGAAAGGAGGGGTGTGGTGG - Intergenic
1172518626 20:35553300-35553322 CAGATAAAGGGAAAGTGATCTGG + Intronic
1173323945 20:42015968-42015990 TGGAGAAAAGAGAAGTGTTCAGG + Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1177495107 21:21878821-21878843 CAGGAACAGGAGAAGTTTTCTGG - Intergenic
1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG + Intergenic
1177983065 21:27939042-27939064 CAGAGAAAGAAGCATTGTTATGG - Intergenic
1179535273 21:42047429-42047451 CAGAGAAAGGACAAGAGTCGTGG - Intergenic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG + Intergenic
1181916328 22:26283574-26283596 CAGAGAAAAAAGCAGTTTTCAGG + Intronic
1181983019 22:26779661-26779683 CAAAGAAAGGTGAAGACTTCGGG - Intergenic
1183104317 22:35605625-35605647 GAGAGAAAGGAGGGGAGTTCAGG - Intergenic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1184368653 22:44068729-44068751 CTGAGACAGGAGAAGTGATTGGG - Intronic
1184543639 22:45149537-45149559 CAAAGAAAGGAGTAATGTTCAGG - Intergenic
1184575848 22:45365135-45365157 GATAGAAAGGAGAAGAGATCCGG - Intronic
1184709265 22:46238814-46238836 CAGAGACCGGAGAACTGTGCAGG + Exonic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
950817903 3:15726409-15726431 CAGAGAAAGTACTAGTGGTCTGG + Intronic
951698123 3:25467140-25467162 CAGAGAAATTAGAAGTATCCAGG + Intronic
952159864 3:30682689-30682711 CCCAGAAAGGACAAGTGTTTGGG + Intronic
952252834 3:31671347-31671369 CAGGGGAAGGAAGAGTGTTCTGG + Intronic
952808046 3:37375645-37375667 CAGAGAAAGAAAAAGGTTTCTGG - Intergenic
953078214 3:39591254-39591276 CAGAAATAGGAGAAGTCTTATGG - Intergenic
953412799 3:42699703-42699725 CAGAGAGCAGAGAAGGGTTCGGG + Intronic
954286240 3:49621374-49621396 CAGTGTAAGGAGTGGTGTTCTGG + Intronic
955240216 3:57171111-57171133 CAGAGAGAGGAGAACTGTTCTGG + Intergenic
955346763 3:58167410-58167432 CAGAGAAAGAATTATTGTTCTGG - Intronic
955609293 3:60739966-60739988 CAAAGAAAAGAGAAATGTTCAGG + Intronic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
956326016 3:68054040-68054062 CAGAGAAATCACAAGTTTTCTGG + Intronic
959520631 3:107319541-107319563 CAAAGAAATGAGAAATGTGCTGG + Intergenic
960776372 3:121260651-121260673 CATAGAAAGATGAAGTATTCAGG - Intronic
960815134 3:121664248-121664270 CAGATTAAGCAGAAGCGTTCAGG + Exonic
961792774 3:129388408-129388430 CACAGAAGGAAGAAGTGTGCAGG + Intergenic
962633425 3:137302993-137303015 CAGATAAAGGCAAAGTGATCAGG - Intergenic
962764727 3:138550710-138550732 AAGAGAAAGGCAAAATGTTCTGG + Intronic
964381380 3:156101362-156101384 CAGAGAAGGGAGATGTGTGTAGG + Intronic
965414246 3:168372517-168372539 CTGAGAAATGAGGAGTGTTTTGG + Intergenic
965706396 3:171512175-171512197 ATGAGACAGGAGAAGTGTTCAGG - Intergenic
966261800 3:177987238-177987260 AAAAGAAAGGAGAAGGTTTCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967345558 3:188451648-188451670 AAGGGAAAGGAGAAGAGCTCTGG + Intronic
967532894 3:190569427-190569449 CATAGAAATGAAGAGTGTTCAGG - Intronic
968210407 3:196844050-196844072 CAGTGAAATGAAAGGTGTTCGGG - Intergenic
971537884 4:27777383-27777405 CAGAGAATGGAAGAGTGTTAGGG - Intergenic
971572018 4:28225014-28225036 CAGAGAAAGAGCAAGTATTCTGG - Intergenic
971635405 4:29050318-29050340 CGTAGTAAGGACAAGTGTTCTGG + Intergenic
971663415 4:29450251-29450273 GAGAGAAATGAAAAGTGGTCTGG - Intergenic
971828199 4:31655494-31655516 CAGAGGAAAGACAAGTATTCAGG - Intergenic
974115800 4:57577933-57577955 CAGGCAAAGGAGCAGGGTTCTGG - Intergenic
974917063 4:68191176-68191198 CAGAGAAATTTGAAGTGTCCTGG + Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976437752 4:85038004-85038026 CAAATAAAGCAGAAGTGTTCAGG - Intergenic
977923960 4:102678136-102678158 CACAGAAAGGAAAAATATTCTGG - Intronic
978817068 4:112918969-112918991 CATAGAAAGCAGAAGTAATCAGG - Intronic
980290389 4:130843205-130843227 TTGAGAAAGAAAAAGTGTTCTGG - Intergenic
980425291 4:132619835-132619857 CACAGGAAGGCGAGGTGTTCTGG - Intergenic
981008147 4:139896854-139896876 CAGGGAAAGGGGCAGTGTTTTGG + Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982475644 4:155847068-155847090 TTAAGAAAGGAGAAGTGTTCAGG + Intronic
983964905 4:173798335-173798357 CAAAGAAAGGATAAATGTTTAGG - Intergenic
983976232 4:173937488-173937510 CAAAGAAAGGACATGTGTTAAGG - Intergenic
984065187 4:175038730-175038752 AAGAGAAAGGAGAAATGTGAGGG + Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
985236415 4:187880284-187880306 GAGAGAGAGGAGAAGGGTTGGGG + Intergenic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
986803496 5:11285451-11285473 AAGACAAGGGAGAAGAGTTCTGG + Intronic
986871428 5:12051510-12051532 CAGGGAAAGGTGATGTGGTCTGG - Intergenic
988617487 5:32789413-32789435 CAGAGAAATGTGATGTTTTCAGG - Exonic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991556365 5:67899259-67899281 CAGTTAGAGGAGGAGTGTTCAGG - Intergenic
991660941 5:68950066-68950088 CAGAGAATACATAAGTGTTCTGG + Intergenic
992351034 5:75929262-75929284 CAGAGAAAGGACAGGTGTGAGGG - Intergenic
993037478 5:82773590-82773612 CAAGGAATGGAGAAGTGGTCTGG + Intergenic
993070688 5:83159451-83159473 TAGTGAAAGGAGAAATGTTTAGG + Intronic
993447452 5:88031028-88031050 GAGAGTAAGTAGAAGTGTTCAGG - Intergenic
993830319 5:92748881-92748903 CAGATAAAGGTGAAGTATTCTGG - Intergenic
994404075 5:99320926-99320948 CTGAGAAAAGAGAATAGTTCTGG + Intergenic
995013823 5:107288061-107288083 CAAAGGAAGGAGAAGGGTTGTGG - Intergenic
995420195 5:111956188-111956210 CAGAGACAGGAGAATTCTTCAGG + Intronic
996062675 5:119049356-119049378 CAGAGAAAGTAGATATGTTTGGG - Intronic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
996695649 5:126392113-126392135 AAGAGAAAAGGGAAGTGTTTTGG - Intronic
997484101 5:134214218-134214240 AATAGAAATGAGAAGAGTTCTGG - Intronic
998769135 5:145521804-145521826 CAGAGAGAGGAGGATTGATCTGG - Intronic
998805418 5:145913580-145913602 CAGAAAAAGGAGAAAATTTCCGG - Intergenic
998875958 5:146599604-146599626 AAGAGAAATGAGGTGTGTTCAGG - Intronic
999073690 5:148774751-148774773 CAGATAAAGGATAACTGCTCTGG + Intergenic
1000141885 5:158412860-158412882 CAGAGAAAGTAGAAGTAATTGGG - Intergenic
1001727687 5:173920554-173920576 AAATAAAAGGAGAAGTGTTCAGG + Intronic
1004364350 6:14999348-14999370 CAGAGGAAGGAAAAGCATTCAGG - Intergenic
1004390109 6:15202849-15202871 AAGAGAAATGAGAAGGGGTCAGG + Intergenic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1004740114 6:18451564-18451586 CAGAGTGACGAGAAGTGTCCAGG + Intronic
1005987476 6:30883943-30883965 CAGAGAAGGGAGCAGAGCTCAGG - Intronic
1006210772 6:32392792-32392814 TAGAGAAATGAGAAATGATCAGG + Intergenic
1006223142 6:32512229-32512251 CATAGAAAGGAATAATGTTCGGG - Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1007229270 6:40337114-40337136 CAGAGAACGGTGCAGTCTTCAGG + Intergenic
1007513137 6:42390108-42390130 CAGAGAAAGAAAAAGTGTCGGGG + Intronic
1009360594 6:62806769-62806791 CAGACAAAGCAAAAGTTTTCAGG + Intergenic
1010244126 6:73647255-73647277 TATAGAAAGGAGAAGTGTGAAGG + Intronic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1012190600 6:96275713-96275735 AAGAGAAAGGGAATGTGTTCTGG - Intergenic
1012415817 6:99012206-99012228 CAGAGGAAGAAGAAGTGATATGG + Intergenic
1013641262 6:112084489-112084511 GAGATAAAGGGGAAGTATTCTGG + Intronic
1014204711 6:118645180-118645202 ACGTGAAGGGAGAAGTGTTCAGG - Intronic
1015190308 6:130465015-130465037 GAGAGAAAGGAGAAGGTTCCAGG + Intergenic
1015276570 6:131388544-131388566 CAGAGAAAACAGAAGTCCTCGGG + Intergenic
1017072368 6:150586862-150586884 CGCGGAAAGGAGAAGTGTTCTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020950462 7:14669546-14669568 CAGAGAAAGAAGAAATGTTGGGG - Intronic
1022391458 7:29947842-29947864 CAGAGAAAGAGGACGTGTTCTGG - Intronic
1022542578 7:31152520-31152542 CATACAAAGGTGAAATGTTCTGG - Intergenic
1022600890 7:31758531-31758553 CACAGAAATAAAAAGTGTTCAGG + Intronic
1023556597 7:41429923-41429945 CCGAGAAAAGAGAAGCGTTGGGG + Intergenic
1023664762 7:42511579-42511601 TACAGAAAGGAGAAATTTTCTGG - Intergenic
1023934014 7:44726234-44726256 CAGAGAAAGGTGAACAGTTTGGG - Intergenic
1024973061 7:55088166-55088188 CATGGAAAGGAGCAGTGGTCTGG + Intronic
1025094003 7:56083862-56083884 CGGGGAAGTGAGAAGTGTTCTGG + Intronic
1028962107 7:96761034-96761056 AAGTGAAGGGAGAAGTATTCAGG - Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1031126261 7:117776581-117776603 CTGAGAAAGGAGAGTGGTTCAGG - Intronic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1033152153 7:138924882-138924904 CAGAGAAAGGAAAGGGGTTGGGG + Intronic
1033653278 7:143357842-143357864 CAGAGAAGGGAGAATTGTAGGGG + Intronic
1035722989 8:1806359-1806381 AAGAGGAGGCAGAAGTGTTCAGG + Intergenic
1035977831 8:4332797-4332819 TGGAGACAGGAGAAGTTTTCAGG + Intronic
1036632607 8:10525858-10525880 GAGAGAAAGGACAAGTGGTTTGG - Intronic
1037142497 8:15536054-15536076 CACTGGAAGGAGAAGTGTTGTGG - Intronic
1037598659 8:20374916-20374938 CACAGAAAGGTGAAGTGTCTGGG - Intergenic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038407578 8:27333544-27333566 CAGAGAAAGTAGAAGCCTCCAGG - Intronic
1040066966 8:43153543-43153565 CAAAGAAATGACAAGTGTTTTGG - Intronic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1040737449 8:50526167-50526189 CAGAGAACACAGAAGAGTTCAGG - Intronic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1041282567 8:56226040-56226062 AAGAGAAAGGAGAGGACTTCTGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041347292 8:56912731-56912753 CAGAGAAAGTAGAAGTGCCCAGG - Intergenic
1041490673 8:58429230-58429252 CAGAGAGGGGAGGAGTGTTACGG + Intronic
1042574379 8:70201722-70201744 CAGGGAAAGAAGAAGTGTAATGG - Intronic
1042691285 8:71502163-71502185 CAGAGGGAAGAGAAGTGATCTGG - Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044290650 8:90465038-90465060 CAGAGAGGGGAGAAGAGTTGGGG + Intergenic
1044710136 8:95049203-95049225 CAAAAAAAGAAGAAGAGTTCAGG - Intronic
1046137359 8:110045967-110045989 CAGAGAAAAAAGAATGGTTCTGG + Intergenic
1046888890 8:119400144-119400166 CAGAGAAAGAAAAAGCTTTCTGG + Intergenic
1046929547 8:119828351-119828373 CAGAGAAAGGGGTCCTGTTCTGG + Intronic
1047059518 8:121208990-121209012 CAGAGAAGCGAAAAGAGTTCAGG + Intergenic
1047574296 8:126136020-126136042 GAAACAAAGGAGAAGTGTTGGGG + Intergenic
1048321873 8:133406393-133406415 CAGAGAAAAGAGATGTTTTCTGG + Intergenic
1049187512 8:141265372-141265394 AAGAGAAGGGAGGAGTGTGCAGG + Intronic
1049204884 8:141359085-141359107 AGGAGAAAGGAGAAGTCTTTGGG + Intronic
1050256999 9:3804416-3804438 GAGAGAAAGGAGAAGTTGTTTGG - Intergenic
1051397798 9:16644948-16644970 CAGAGAAAGTTGAAGAGTTAGGG - Intronic
1051489049 9:17640677-17640699 CCGAGAAATGAGAAGTGTTATGG - Intronic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1051743037 9:20269509-20269531 GAGTGAAAGGAGGAGTGTTCTGG + Intergenic
1053027078 9:34739001-34739023 TAGAGGAAATAGAAGTGTTCTGG - Intergenic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1055024966 9:71709792-71709814 GAGAGAAAGCAGAAGAGTTGTGG + Intronic
1055552951 9:77447754-77447776 GAGAGCATGGAGCAGTGTTCAGG + Intronic
1055843325 9:80531706-80531728 CACAGAAAGAAAAAGTGGTCTGG - Intergenic
1056062518 9:82898266-82898288 TAGGGAAAGGAGAATTGTACAGG - Intergenic
1056226304 9:84498704-84498726 CAGAGAAAACAGCAGAGTTCAGG + Intergenic
1058375924 9:104321353-104321375 TAGAGAAAGGGGAAATGGTCAGG + Intergenic
1058756908 9:108091141-108091163 AAGAGAACAGAGGAGTGTTCTGG - Intergenic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059531775 9:115042177-115042199 GAGAGAGAGGAGGAGTGTTGTGG - Intronic
1060060130 9:120452552-120452574 TATAGAAGGGAGATGTGTTCTGG - Intronic
1060591615 9:124820571-124820593 CAGAGAAAGAAGAGGTGTATCGG + Intergenic
1060732065 9:126044982-126045004 CTGAGAAGGGGGAAATGTTCTGG - Intergenic
1062111797 9:134785908-134785930 GAGAGAAAGGACATGCGTTCTGG - Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1185626685 X:1487597-1487619 CAGAGACAGGTGCAGAGTTCAGG - Intronic
1186157868 X:6744403-6744425 CAAAGATAGAAGAAGTGTTACGG + Intergenic
1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG + Intergenic
1188019773 X:25144451-25144473 CAGAGAAGGGCGAAGGATTCGGG + Intergenic
1188142473 X:26568746-26568768 CAAAGAAATGATAAGTGTTTGGG - Intergenic
1188236659 X:27739915-27739937 CAGAGAAAGGAGAATAAATCTGG + Intronic
1188364390 X:29296764-29296786 CAGGGCAAGGAGAATTTTTCTGG - Intronic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1190427367 X:50345818-50345840 CAGAGAAAAGTGATGTGCTCAGG - Intronic
1191045452 X:56130843-56130865 CAGAGAAATGCGAAATGTACTGG + Intergenic
1191874941 X:65787071-65787093 CAGAGAAAGGACCAGGTTTCAGG + Intergenic
1192284965 X:69725876-69725898 GAGAGAAAGGAGATGTATTGAGG + Intronic
1192414515 X:70966738-70966760 CAAAGAAATGACAAATGTTCAGG + Intergenic
1193451964 X:81682217-81682239 AAGTGAAAGCAGAAGTGTTTGGG - Intergenic
1193818664 X:86134872-86134894 CAAAGAAAAAAGAAGTGATCAGG + Intergenic
1194592731 X:95819344-95819366 TAAAGAAAGGAAAAGTTTTCTGG + Intergenic
1195327656 X:103771105-103771127 CAGAGAAATGAGATGGTTTCCGG - Intergenic
1195468098 X:105203228-105203250 GAGAGAGAGGAGAATTGCTCAGG - Intronic
1195751133 X:108162856-108162878 CAGAAAAAGGAGATTTGTTGGGG - Intronic
1196679341 X:118455137-118455159 GTGAGGAAGGAGAAGTGTTAGGG + Intergenic
1196898918 X:120364225-120364247 GAGAGAAAAGAAAATTGTTCAGG + Intronic
1198077530 X:133208466-133208488 CAAAAAAAGGAGTTGTGTTCAGG - Intergenic
1198216873 X:134563570-134563592 CAGAGAAAGTGCAAGTGGTCTGG - Intergenic
1200743870 Y:6885102-6885124 CAGAGAAAGGAGAATGCTTACGG + Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic