ID: 1071499976

View in Genome Browser
Species Human (GRCh38)
Location 10:86196355-86196377
Sequence AAGAAAAACGAGAAATGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071499967_1071499976 15 Left 1071499967 10:86196317-86196339 CCTTGTACCCAGCATTGTCCTGG 0: 1
1: 0
2: 2
3: 49
4: 348
Right 1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG No data
1071499970_1071499976 8 Left 1071499970 10:86196324-86196346 CCCAGCATTGTCCTGGGTACTGC 0: 1
1: 0
2: 1
3: 51
4: 334
Right 1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG No data
1071499974_1071499976 -3 Left 1071499974 10:86196335-86196357 CCTGGGTACTGCGGAGGAGTAAG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG No data
1071499971_1071499976 7 Left 1071499971 10:86196325-86196347 CCAGCATTGTCCTGGGTACTGCG 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071499976 Original CRISPR AAGAAAAACGAGAAATGGTC TGG Intronic
No off target data available for this crispr