ID: 1071501954

View in Genome Browser
Species Human (GRCh38)
Location 10:86210597-86210619
Sequence AGTGCTCACCTCCACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071501954_1071501969 24 Left 1071501954 10:86210597-86210619 CCCTCCCCGTGGAGGTGAGCACT 0: 1
1: 0
2: 1
3: 17
4: 141
Right 1071501969 10:86210644-86210666 CCTGCAGCGTTGTAAGCGCCAGG No data
1071501954_1071501960 -4 Left 1071501954 10:86210597-86210619 CCCTCCCCGTGGAGGTGAGCACT 0: 1
1: 0
2: 1
3: 17
4: 141
Right 1071501960 10:86210616-86210638 CACTGCCGGCCCACCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071501954 Original CRISPR AGTGCTCACCTCCACGGGGA GGG (reversed) Intronic
900975101 1:6011835-6011857 AGTTCTCACCTCCACAGGCAAGG - Intronic
901221884 1:7588046-7588068 AGTGCCCACCTGCACGGTGGAGG - Intronic
902571955 1:17352670-17352692 AGTCCTCCCCTCCCAGGGGATGG - Intronic
902602662 1:17550789-17550811 AGAGCTCACCTCCCTGTGGAGGG - Intronic
905442769 1:38005532-38005554 CGCGCTCACTTCCTCGGGGAGGG - Intronic
907826836 1:58025937-58025959 TGTTCTCACCTCCACCTGGAGGG + Intronic
912362275 1:109104672-109104694 ACTGCTCAACTCCACTGAGAGGG - Intergenic
914936513 1:151985993-151986015 AGTGGTGACCTCCACAGGGAAGG + Intronic
915168494 1:153962211-153962233 AGTGCTCACCGTCACGTGCAAGG + Exonic
918925394 1:190779273-190779295 AGTGCTCACCTCCCCTGGAGTGG + Intergenic
920823945 1:209407115-209407137 AGTGGTCATCTCCAAGAGGAGGG + Intergenic
922811801 1:228420091-228420113 AATCCTCACCTCCAAGGTGATGG + Intergenic
1063217713 10:3939085-3939107 AATCCTCACCTCCAAGGTGATGG + Intergenic
1068836649 10:61562453-61562475 AGTGATCAACTGCACGGGAATGG + Intergenic
1071501954 10:86210597-86210619 AGTGCTCACCTCCACGGGGAGGG - Intronic
1073490838 10:103852315-103852337 TTTGCTCATCCCCACGGGGAGGG - Intronic
1074496324 10:113983021-113983043 AGTGCTGAGCTCCTCGGGGCAGG + Intergenic
1075489439 10:122853859-122853881 AGTAGTCACCCCCATGGGGAGGG - Intronic
1075987469 10:126800053-126800075 AATCCTCACCTCCAAGGTGATGG - Intergenic
1077088653 11:767654-767676 AGTCCTCACCTGCAAGGGGATGG + Exonic
1077099497 11:815846-815868 AGTGCTCACTACAACGGGGCAGG + Intergenic
1077824354 11:5788480-5788502 TGTGCACACCTTCACAGGGATGG - Exonic
1081969020 11:47185897-47185919 ACTGATCACCGCCAAGGGGAGGG + Intronic
1084615957 11:70236107-70236129 AGCTCTCACGTCCACTGGGAGGG + Intergenic
1088795261 11:113262007-113262029 ATTGCTCACCTCACCGGTGACGG + Intronic
1088918361 11:114243913-114243935 ATGGCTCAGATCCACGGGGAGGG + Intronic
1089164742 11:116466991-116467013 ATTCCTCACGTCCAAGGGGAGGG - Intergenic
1089323707 11:117643403-117643425 CATGCTAACCTCCAAGGGGAGGG - Intronic
1089699158 11:120234116-120234138 AGTGCAGACCTCCATGGAGAAGG + Intergenic
1089753172 11:120666309-120666331 AGTGGTCACATCAAAGGGGATGG + Intronic
1090508198 11:127342258-127342280 AGTTCTCTCCTTCACAGGGAAGG - Intergenic
1091469534 12:714853-714875 AGAACTCACCACCAAGGGGATGG + Intergenic
1096216681 12:49801649-49801671 AGTGCTCCCCACCAGCGGGAGGG - Intronic
1098158183 12:67621936-67621958 CCTGCTCACCTACACTGGGAGGG + Intergenic
1098371699 12:69767408-69767430 CCTGCTCAGCTCCAGGGGGATGG + Intronic
1098759814 12:74408990-74409012 AGTGTTAAATTCCACGGGGAAGG + Intergenic
1099926970 12:89030408-89030430 AGTCCTCACCTCCAGTGCGATGG + Intergenic
1102188895 12:110970955-110970977 ACTGCTCAACTCCAGTGGGAGGG + Intergenic
1103467687 12:121154940-121154962 GGTGCTCACCTGCAAAGGGAAGG - Exonic
1104211044 12:126688768-126688790 AGGGCTTACCTCCTCTGGGAAGG - Intergenic
1104462128 12:128964451-128964473 GCTGCTCACCCCCAAGGGGACGG - Intronic
1104675770 12:130710923-130710945 AATGCTCACCTACACGAGAAAGG - Intronic
1104746987 12:131216780-131216802 ACTGCTCCCCTCCACGGGGCTGG - Intergenic
1104785632 12:131446405-131446427 ACTGCTCCCCTCCACGGGGCTGG + Intergenic
1104986694 12:132601382-132601404 ATGGCTCACTTCCATGGGGACGG + Intergenic
1105457178 13:20552031-20552053 AGTGTTCAACTGCACGGGGCAGG - Intergenic
1109038889 13:57304430-57304452 AGCCCTAACCTCCAAGGGGATGG - Intergenic
1111659269 13:91189249-91189271 AATTATCACCTCCACTGGGATGG + Intergenic
1113697343 13:112355518-112355540 AATGCTCAGCCCCACGGTGATGG - Intergenic
1118093009 14:62503500-62503522 AGTCCACACATCCACAGGGAAGG + Intergenic
1119382822 14:74239759-74239781 AGTGCTCAGCCCCGCGGGGGTGG + Exonic
1122229586 14:100299051-100299073 AATCCTCACGTCCACTGGGAGGG + Intronic
1122838231 14:104441829-104441851 CGTGCTGAGCTTCACGGGGAAGG - Intergenic
1123942756 15:25224525-25224547 AGTGGTCACCTCCAGGGTCATGG + Intergenic
1125990873 15:44106557-44106579 AGTGGTCACCTCCTCTAGGAAGG + Intronic
1127192851 15:56550110-56550132 AGTGCTCACCTTCACTGGATGGG - Intergenic
1130513277 15:84606547-84606569 ACTGGTCACCTCCACCGGAAGGG - Intronic
1130861135 15:87890875-87890897 AGTGCTCATCTCTACTGGGGTGG + Intronic
1134376950 16:13685627-13685649 ACTGCACACATCCATGGGGATGG - Intergenic
1138583263 16:57955243-57955265 AGTGGCCACCTCCCCCGGGAAGG + Intronic
1138766593 16:59612927-59612949 AATCCTCACCTCCAAGGTGATGG + Intergenic
1139467847 16:67163839-67163861 AGCGCTTACGTCCACGGGGACGG - Exonic
1140026414 16:71294359-71294381 AGTGGTAACCTCCAGGGAGAAGG + Intergenic
1140215144 16:73001020-73001042 ATTGCTCACTCCCAAGGGGAGGG - Intronic
1142221421 16:88856811-88856833 GGTGCTCAGCGCCGCGGGGATGG - Exonic
1142831982 17:2555933-2555955 AGTGCTCACATCTACTAGGATGG - Intergenic
1143404401 17:6667668-6667690 AGTGCTCACCGCCACAGGGCTGG - Intergenic
1143647044 17:8237366-8237388 AGTCCTCACCTGCACGATGATGG + Exonic
1147565907 17:41536346-41536368 CGTACTCACCTCCAGGGAGAGGG - Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148586089 17:48781742-48781764 AGTGCTAACCCCCAAGGTGACGG + Intronic
1148818188 17:50345834-50345856 TGTGCTCCCCTCCACCTGGACGG - Intergenic
1148905920 17:50912036-50912058 AGTGCTCAACTCCACCAGAAGGG + Intergenic
1150248118 17:63691091-63691113 AGCACTCACCTCCTAGGGGAGGG - Exonic
1152570329 17:81118849-81118871 AGTGCCCACCTCCTCGGAGAAGG - Intronic
1154371280 18:13765384-13765406 AGTGCTCACCTGCCCTGGGCAGG - Intergenic
1157443320 18:47726435-47726457 AATGCCTACCTCCACGGGAATGG - Intergenic
1160445260 18:78922471-78922493 AGTTCTCAGCTCCACCAGGATGG - Intergenic
1162415881 19:10536941-10536963 AGTGGTCAACTCCACGGCCAGGG + Intergenic
1164704244 19:30308136-30308158 AATGCTCACCTCCACAGGTGAGG - Intronic
1166326560 19:42054425-42054447 AGCGCTCACCACCACGTGCACGG + Exonic
925978450 2:9157224-9157246 AGTTCTCAGCTCCCAGGGGAAGG - Intergenic
929003025 2:37366799-37366821 AGTGCTGACCTACACGGGTACGG - Intronic
931207700 2:60163953-60163975 AGTGCTGACCTACACTGCGAGGG - Intergenic
932780041 2:74554097-74554119 AGTGGCCAGCTCCACGGGGAGGG - Exonic
938373349 2:130787945-130787967 AATGCACACCTCCCCGGGGTGGG - Intergenic
938722477 2:134078906-134078928 AGGGCTCACCTCCACTGAGCAGG + Intergenic
946011213 2:216565131-216565153 AGAGCACACCTGCATGGGGAGGG + Intronic
948582980 2:239000453-239000475 AATCCTCACCTCCAGGGTGATGG - Intergenic
948886235 2:240886416-240886438 AGGGGCCACTTCCACGGGGACGG + Intronic
1168842674 20:919750-919772 AGGGATCACCTCCTCTGGGAAGG + Intergenic
1174684037 20:52436461-52436483 AGTCCTCTCATCCACTGGGAGGG - Intergenic
1174706553 20:52662193-52662215 AATGCTAACCTCCAGGGTGATGG - Intergenic
1176179209 20:63741666-63741688 CCTGCTCACCTCCACGCGGCTGG + Intronic
1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG + Intronic
1177540023 21:22480517-22480539 AGTACTAACCTCCAATGGGATGG + Intergenic
1179073479 21:38095015-38095037 AGTGCTCAGCTTAAGGGGGAAGG - Intronic
1179421203 21:41238252-41238274 GGGGCTCACCACCACTGGGAAGG - Intronic
1183335174 22:37242241-37242263 ACTGCTCTGCTCCACGGGGGAGG - Intronic
1183362613 22:37390539-37390561 AGAGCTCACCCCCATGGGGAGGG - Intronic
1183434323 22:37784569-37784591 AGTGGTTGCCTCCTCGGGGAGGG + Intergenic
1184008733 22:41730723-41730745 AGTGCTCCCCTCCAAGGTGGAGG - Intronic
1184753636 22:46503416-46503438 TGTCCTCACCACCATGGGGATGG - Intronic
1185378959 22:50497962-50497984 AGTTCTCCCCTCCACGTGCATGG + Intergenic
949847670 3:8388513-8388535 AATGCTCACCCCCACTGGGGAGG + Intergenic
952946225 3:38479348-38479370 GGTGGACACCTCCACAGGGAAGG - Intronic
954225213 3:49176842-49176864 TCTGCTCACCCCCACAGGGAGGG + Intergenic
954745720 3:52786485-52786507 TCTGCTCACCTCCAAGGGGTGGG - Intronic
956545070 3:70392280-70392302 AGTGCTTACTTCCTGGGGGATGG - Intergenic
964377373 3:156062121-156062143 ATTGCTCACAACCACGGGCAAGG - Intronic
967880657 3:194298985-194299007 AGTGCCCACCCCAACGGAGAAGG - Intergenic
969525842 4:7703632-7703654 ATTCCTCACCTCCTCGGGGAAGG - Intronic
969658479 4:8511326-8511348 AGTGCAGACCACCACGGAGAAGG - Intergenic
974160608 4:58133330-58133352 AATGCATACCTCCACGGGAATGG - Intergenic
975312514 4:72918373-72918395 ACTTCTAACCTCCAGGGGGATGG - Intergenic
976329407 4:83812315-83812337 AGTTCTTACCTCCAAGGTGATGG + Intergenic
981231945 4:142367005-142367027 ACTGCTCACCCCTACTGGGAAGG + Intronic
985757967 5:1730469-1730491 TGTGGTCACCTCCCCTGGGAGGG - Intergenic
993010745 5:82479397-82479419 AATGCTCACCTCCACTGACATGG - Intergenic
996332935 5:122351747-122351769 TGTGCTGACCTCATCGGGGAAGG + Intronic
997283444 5:132662595-132662617 ACTGCTCACCTCCAGAGGGGAGG - Intergenic
997821666 5:137071408-137071430 AGGGGTCACCTCCCCAGGGAAGG + Intronic
999673536 5:153977635-153977657 AGGGCTCCCCTCCATAGGGAAGG + Intergenic
1002365933 5:178710879-178710901 AATGCTAACCTCCAAGGTGATGG - Intergenic
1004170632 6:13293068-13293090 AGTGATCTCCTCCACGGGTGTGG + Intronic
1005947077 6:30602614-30602636 AGGGATCACCTCCCCGGGGAGGG + Exonic
1010321100 6:74511412-74511434 AGTGCTCATCTACAAGGGAATGG + Intergenic
1011213552 6:84980550-84980572 AGTGCTCACTTCTTCAGGGAAGG - Intergenic
1011749742 6:90443062-90443084 AGTGTTCACCTCTAGTGGGAGGG - Intergenic
1016691936 6:146948147-146948169 AGAACTCACCCCCAAGGGGAAGG - Intergenic
1020962919 7:14828471-14828493 AATCCTCACCTTCACGGGAAGGG + Intronic
1022516662 7:30979105-30979127 AGTCCTCACCTCCAGGGACAAGG - Exonic
1026948675 7:74332942-74332964 AGTCCCCACCTCCACAGGCAGGG + Intronic
1029543108 7:101196161-101196183 AGTGCCCACCTCCGGGGGGACGG - Intronic
1031787497 7:126052534-126052556 AGTGCTCACCACCACACAGAAGG + Intergenic
1032790739 7:135240739-135240761 AGGGGACATCTCCACGGGGAAGG + Intronic
1033666182 7:143443025-143443047 AGCGCTCACATCCACGGGGGGGG - Intergenic
1039374778 8:37022479-37022501 AGTGGTTACCTCCAAGGGGTTGG + Intergenic
1039531816 8:38269232-38269254 CGTGGCCACCTCCGCGGGGAGGG + Intronic
1040811289 8:51456454-51456476 AGTGCTCCCCTCCACTGGGATGG + Intronic
1042869605 8:73386328-73386350 AGTGCTCCCTTCCCAGGGGATGG + Intergenic
1049662925 8:143828499-143828521 AGTGCCCACTTCCCCGGGCAGGG - Intronic
1049801624 8:144520393-144520415 CACGCGCACCTCCACGGGGATGG - Exonic
1051506893 9:17837468-17837490 TGTTCTCACCCCCACGGTGAAGG - Intergenic
1056693332 9:88826356-88826378 AATCCTAACCTCCAAGGGGATGG + Intergenic
1057920531 9:99093232-99093254 AGTGCTCAACACCAGGGGTAGGG - Intergenic
1060896464 9:127221260-127221282 AATGCTTCCCTCCAGGGGGAGGG - Exonic
1061046789 9:128169595-128169617 AGAGCTCACCTCCCCCGGGCAGG + Intronic
1061371377 9:130199471-130199493 AGTGCTGACCAGCACGGGGATGG + Intronic
1061397215 9:130349667-130349689 AGTGCCCCCCTCCCCGAGGATGG + Intronic
1061495705 9:130973194-130973216 AGAGCTCACCTGCAGGTGGACGG - Intergenic
1062523950 9:136970772-136970794 AGTGAGAACTTCCACGGGGAGGG + Intronic
1185828562 X:3276504-3276526 AATGTTCACCTCCAAGGTGATGG + Intronic
1194479273 X:94400621-94400643 AGTGATCAACACCACTGGGATGG + Intergenic
1194515550 X:94847741-94847763 AGTGCTCACCTGCGAGGGAATGG + Intergenic
1195165872 X:102219936-102219958 AGTGCTCAGCTACCTGGGGAAGG + Intronic
1195192987 X:102467155-102467177 AGTGCTCAGCTACCTGGGGAAGG - Intronic
1195399693 X:104448064-104448086 AGTGCTCAGCTGCACAGGAATGG - Intergenic
1197808426 X:130418949-130418971 ACTGCTCACTTCCCAGGGGAGGG + Intergenic
1200042436 X:153379838-153379860 AGTGCCCACCTCCAAGGGCCGGG + Intergenic