ID: 1071502088

View in Genome Browser
Species Human (GRCh38)
Location 10:86211426-86211448
Sequence CTGTGTCCTGGGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071502075_1071502088 -7 Left 1071502075 10:86211410-86211432 CCCCCCCACCTGCACCCTGTGTC No data
Right 1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG No data
1071502074_1071502088 -3 Left 1071502074 10:86211406-86211428 CCAGCCCCCCCACCTGCACCCTG 0: 1
1: 0
2: 16
3: 143
4: 1288
Right 1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG No data
1071502077_1071502088 -9 Left 1071502077 10:86211412-86211434 CCCCCACCTGCACCCTGTGTCCT 0: 1
1: 1
2: 5
3: 49
4: 565
Right 1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG No data
1071502076_1071502088 -8 Left 1071502076 10:86211411-86211433 CCCCCCACCTGCACCCTGTGTCC 0: 1
1: 0
2: 5
3: 52
4: 797
Right 1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG No data
1071502078_1071502088 -10 Left 1071502078 10:86211413-86211435 CCCCACCTGCACCCTGTGTCCTG 0: 1
1: 2
2: 6
3: 56
4: 487
Right 1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071502088 Original CRISPR CTGTGTCCTGGGAAAGTGGA GGG Intronic
No off target data available for this crispr