ID: 1071502150

View in Genome Browser
Species Human (GRCh38)
Location 10:86211813-86211835
Sequence CCAATGCTGCAAAGAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071502145_1071502150 1 Left 1071502145 10:86211789-86211811 CCAGACCACCAGGCACCTCTACA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1071502150 10:86211813-86211835 CCAATGCTGCAAAGAGAAAGTGG No data
1071502143_1071502150 27 Left 1071502143 10:86211763-86211785 CCAGAGAGCAAACAGCAAAGAGA 0: 1
1: 0
2: 6
3: 38
4: 416
Right 1071502150 10:86211813-86211835 CCAATGCTGCAAAGAGAAAGTGG No data
1071502147_1071502150 -7 Left 1071502147 10:86211797-86211819 CCAGGCACCTCTACATCCAATGC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 1071502150 10:86211813-86211835 CCAATGCTGCAAAGAGAAAGTGG No data
1071502146_1071502150 -4 Left 1071502146 10:86211794-86211816 CCACCAGGCACCTCTACATCCAA 0: 1
1: 0
2: 1
3: 9
4: 174
Right 1071502150 10:86211813-86211835 CCAATGCTGCAAAGAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071502150 Original CRISPR CCAATGCTGCAAAGAGAAAG TGG Intronic
No off target data available for this crispr