ID: 1071503183

View in Genome Browser
Species Human (GRCh38)
Location 10:86217880-86217902
Sequence CTGAGGCAGGCTCTGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 526}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503183_1071503188 -4 Left 1071503183 10:86217880-86217902 CCACACCACAGAGCCTGCCTCAG 0: 1
1: 1
2: 2
3: 53
4: 526
Right 1071503188 10:86217899-86217921 TCAGCCCTCCCTGCAGCCCCGGG No data
1071503183_1071503191 3 Left 1071503183 10:86217880-86217902 CCACACCACAGAGCCTGCCTCAG 0: 1
1: 1
2: 2
3: 53
4: 526
Right 1071503191 10:86217906-86217928 TCCCTGCAGCCCCGGGCCACCGG No data
1071503183_1071503187 -5 Left 1071503183 10:86217880-86217902 CCACACCACAGAGCCTGCCTCAG 0: 1
1: 1
2: 2
3: 53
4: 526
Right 1071503187 10:86217898-86217920 CTCAGCCCTCCCTGCAGCCCCGG No data
1071503183_1071503193 4 Left 1071503183 10:86217880-86217902 CCACACCACAGAGCCTGCCTCAG 0: 1
1: 1
2: 2
3: 53
4: 526
Right 1071503193 10:86217907-86217929 CCCTGCAGCCCCGGGCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503183 Original CRISPR CTGAGGCAGGCTCTGTGGTG TGG (reversed) Intronic
900406253 1:2494349-2494371 CTGAGGCGGGTTCTGAGCTGGGG - Intronic
900511132 1:3061742-3061764 CAGAGCCTGGCCCTGTGGTGGGG - Intergenic
900974365 1:6007936-6007958 CTGAGGCAGGGGCAGTGGTGGGG + Intronic
901679492 1:10904849-10904871 CTGAGGCAGGCTGGATGGTGTGG - Intergenic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
901806327 1:11740918-11740940 CTGTGGCTGACTCTGCGGTGTGG + Intronic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
902296737 1:15472757-15472779 CTGAGCCAATCGCTGTGGTGGGG - Intronic
902332992 1:15739655-15739677 CTGAGCAAGGCTCTGGGATGTGG - Exonic
902437888 1:16409801-16409823 CTGAGGCAGGCTTGGAGCTGAGG + Exonic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
903687739 1:25144587-25144609 CTGAGTTGTGCTCTGTGGTGTGG - Intergenic
904042605 1:27593176-27593198 CTGGGGCAGGGGCTGAGGTGGGG + Intronic
904415157 1:30356422-30356444 CTGGTGCAGGCTCTATGCTGGGG - Intergenic
904828705 1:33293095-33293117 GTGGGGTTGGCTCTGTGGTGAGG + Intronic
905569358 1:38991538-38991560 CTGCTGCAGACTCTGCGGTGGGG - Exonic
905898924 1:41567803-41567825 ATGGGGCAGGCTCTGGGGTTGGG - Intronic
905945906 1:41901232-41901254 CTGAGGAAGGGGCTGGGGTGTGG + Intronic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906980077 1:50620827-50620849 CTCAGGTGTGCTCTGTGGTGTGG + Intronic
907345353 1:53773729-53773751 CTGGGGCAGGCCCTGTAGTCAGG - Intronic
907698265 1:56755968-56755990 CTGAATCAGGCTCTGTTGTTTGG + Intronic
907834388 1:58095165-58095187 GTGAGCCAGGCTCTGTGCTGGGG - Intronic
907848871 1:58235070-58235092 CTGAGGCAGGGTGTGTGGCGAGG - Intronic
907982573 1:59498586-59498608 CTGAAGCAGAAACTGTGGTGTGG - Intronic
908722326 1:67138868-67138890 CTGAGCCAGTCACTGTGGTCAGG - Intronic
909239582 1:73195347-73195369 GTGAGGGAGGCTCTGTGGCAGGG - Intergenic
910007347 1:82414814-82414836 CTGAGGCAGGCTCTCAGGCTGGG + Intergenic
911137560 1:94457577-94457599 CTGAGCCAGACTCTAAGGTGGGG - Intronic
912305016 1:108558773-108558795 CAGAGGCAGGTTCGGGGGTGGGG - Intergenic
912533732 1:110346961-110346983 CCGACTCAGGCACTGTGGTGAGG - Intergenic
913110172 1:115650291-115650313 CTGAGACTAGCTCTGGGGTGAGG + Intronic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914299122 1:146363025-146363047 CTGGGGTCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
915141340 1:153770495-153770517 ATGAGCCAGGCTCTGGGCTGGGG + Intronic
915380185 1:155433332-155433354 TTGGGTCAGGCTCTGAGGTGTGG + Intronic
915489043 1:156241456-156241478 GGGAGGCAGGCACTGAGGTGGGG - Intronic
915570844 1:156744401-156744423 CTGAGGGAGGGTCTGGGGAGGGG - Intronic
915635540 1:157183998-157184020 CTGAGGCTGGCCCTGGGCTGGGG - Intergenic
915648501 1:157290799-157290821 CTGAGGCCGGCTTTGGGCTGGGG + Intergenic
915897710 1:159824557-159824579 CTGGGGAGGGCTCTGTGGAGGGG - Intergenic
915915588 1:159938533-159938555 CTGAGCCTGGCAGTGTGGTGTGG - Intronic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
916462991 1:165046026-165046048 CAGAGGCAGGCTCTGTCTTTGGG - Intergenic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916789967 1:168116461-168116483 CTGGGGCGGGGTGTGTGGTGGGG + Intronic
917737385 1:177933196-177933218 CTGAGGTAGGCTCTGTGGGAGGG - Exonic
919211494 1:194492778-194492800 CTGGGGCATGCTGTCTGGTGGGG - Intergenic
921075643 1:211698511-211698533 CTGATTCAGGGTCTGTGGTGAGG + Intergenic
921102953 1:211946689-211946711 CAGAGGCATGCTGTGTGCTGGGG + Exonic
921222340 1:212981951-212981973 CTGAGGCAGCCTCAGTGCAGAGG - Intronic
921269262 1:213452680-213452702 CTGAGGAGGTCTCTGTGCTGCGG - Intergenic
921384026 1:214551718-214551740 CGGAGCCCGGCTCTGGGGTGGGG - Intronic
922235802 1:223721667-223721689 CTGAGCTAGGCTGTGGGGTGGGG - Intronic
922414580 1:225409201-225409223 CTGAGCCAGGGTCTGTGAAGTGG + Intronic
922826889 1:228527803-228527825 CTGTGACTGGCTCTGTGCTGGGG - Intergenic
923520780 1:234733490-234733512 ATGTACCAGGCTCTGTGGTGGGG - Intergenic
923850273 1:237786530-237786552 CTGAGGCAGGATCTATGGCTTGG - Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924622938 1:245678120-245678142 AGGAGGCAGGGTCAGTGGTGAGG + Intronic
1062917632 10:1253975-1253997 ATGAGGTGGGCTCTGTGGTTAGG + Intronic
1062917647 10:1254047-1254069 GTGAGGTCGGCTCTGTGGTTAGG + Intronic
1062917731 10:1254722-1254744 CTGAGGCAGATTCTTTGGTTTGG + Intronic
1062964702 10:1598468-1598490 CTGAGCAAGGCTGGGTGGTGGGG - Intronic
1063766102 10:9142166-9142188 ATTAGCCAGGCTCGGTGGTGTGG + Intergenic
1063969565 10:11372109-11372131 AGGAGGCCGGCTCAGTGGTGTGG - Intergenic
1065328753 10:24572173-24572195 CAGAGGCTGGCACTGAGGTGTGG - Intergenic
1065797977 10:29324392-29324414 AGGAGGCAGGCTCCGGGGTGTGG - Intergenic
1066055546 10:31677442-31677464 CTGAGGCAGTGCCTGGGGTGGGG - Intergenic
1066242347 10:33550543-33550565 CTAAGGTAAGCTCTTTGGTGCGG - Intergenic
1070276802 10:75015055-75015077 CTGAATCAGGATCTTTGGTGGGG - Intronic
1070531276 10:77339536-77339558 CTGAGTCAAGCTGGGTGGTGGGG - Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1072020620 10:91395972-91395994 CTGAGGCAGGCCTGGTGCTGGGG - Intergenic
1072969514 10:100005169-100005191 CTGGGGCAGCCACTGTGGAGAGG + Intronic
1073120521 10:101119856-101119878 CAGAGGAAGCCTCTGAGGTGGGG + Intronic
1074204623 10:111272139-111272161 CAGAGGCAGTCACAGTGGTGGGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074535295 10:114324719-114324741 CACAGGCAGGCTGTGAGGTGGGG + Intronic
1074974142 10:118566759-118566781 CTGAGTCCTGCCCTGTGGTGGGG + Intergenic
1075275503 10:121089409-121089431 CTGAGCCAGGGCATGTGGTGGGG + Intergenic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076292776 10:129360528-129360550 CTGATGCAGGCTCTCTTCTGTGG - Intergenic
1076362294 10:129897628-129897650 CTGAGGCAGGCACAGTGGGCAGG - Intronic
1076910877 10:133388720-133388742 CTGAGGGACGCTCTGTGGGGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077194264 11:1271550-1271572 GTGAGGCCGGCTCTGTGTCGGGG + Intergenic
1078268048 11:9769687-9769709 CTAACTAAGGCTCTGTGGTGAGG - Intergenic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078532253 11:12145769-12145791 CTTATGCAGACTCTGGGGTGAGG + Intronic
1078561503 11:12377278-12377300 TTGCGCCAGGCTGTGTGGTGGGG + Exonic
1079194534 11:18314060-18314082 ATTAGGCAGGCCATGTGGTGTGG + Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079761705 11:24337722-24337744 CTGTGACTGGCTCTGAGGTGAGG - Intergenic
1081744424 11:45463023-45463045 CTCGGGCAGCCTCTGTCGTGGGG - Intergenic
1081773128 11:45661906-45661928 CTGAGGCAGGCACTGGGGCGGGG + Intronic
1081805162 11:45886219-45886241 CTGCGGCAGGGTCTGGGGTCGGG + Intronic
1082887923 11:58108004-58108026 ATGAGGCAGGCACTGTGTTTAGG + Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1084116435 11:67045385-67045407 TTGAGTCAGGCTCTGCTGTGCGG + Intronic
1084876141 11:72135342-72135364 CAGAGGCAGGCTCAGAGGTTGGG - Intronic
1084881005 11:72171821-72171843 CAGAGGCAGGCTCAGAGGTTGGG - Intergenic
1084889474 11:72229652-72229674 CTGTGGCAGGTTCTGGGGGGAGG - Exonic
1084899063 11:72295995-72296017 GTGGGCCAGGATCTGTGGTGGGG + Intronic
1084969715 11:72764509-72764531 CTGAGGCAGGCCGGGTCGTGGGG + Intronic
1085019084 11:73193802-73193824 CTGAAGCCTGCTCTGTGGTAGGG - Intergenic
1085457882 11:76675518-76675540 GGCAGGCAGGCTCTGCGGTGGGG + Intergenic
1085636242 11:78161553-78161575 ATGAGGCCTCCTCTGTGGTGGGG + Intergenic
1085642085 11:78199034-78199056 CACAGGCAGGCTGTGTTGTGGGG + Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1087036087 11:93758139-93758161 CAGCGGCAGGCTCTCTGGAGCGG + Intronic
1088290117 11:108227029-108227051 CAGAGGAAGGCTCTGCGGGGCGG - Intronic
1088824604 11:113483233-113483255 CTGTGTCAGGTTCTGTGCTGGGG - Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089685805 11:120146059-120146081 CTGAGCCCGGCTCTGCTGTGTGG - Intronic
1090183927 11:124723899-124723921 GTGAGGAAGGCTCTGGGGTGTGG - Intergenic
1090252239 11:125259794-125259816 CGAAAGCAGGCTGTGTGGTGAGG - Intronic
1090387135 11:126363901-126363923 CAGAGGCAAGCTCTGGGCTGGGG - Intronic
1091008682 11:131978032-131978054 CAGAAGAAGGCTCTGTGGTCAGG + Intronic
1091239241 11:134041624-134041646 GTGAGGCAGGGGCTGGGGTGGGG - Intergenic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1096100931 12:48970094-48970116 TTGAGGATGGCGCTGTGGTGCGG + Exonic
1096630963 12:52926489-52926511 CTGGGGCAGGCTTTGTGGGGAGG - Intronic
1096995564 12:55835879-55835901 CTGAGGCAGGCACTGCCCTGTGG - Intronic
1097277251 12:57821953-57821975 CTGAGGCTGGATCTAGGGTGTGG + Exonic
1097989837 12:65823852-65823874 CGCCCGCAGGCTCTGTGGTGAGG + Intergenic
1101898124 12:108770668-108770690 CTGAGCAAGGTTCTGGGGTGGGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103520082 12:121532474-121532496 CTGAGGCAGGGTCTGGGGAAGGG - Intronic
1103913013 12:124362525-124362547 CTGGGGCAGGCTTTCTGGGGAGG - Intronic
1103920754 12:124398005-124398027 TTGAGCCAGGGGCTGTGGTGAGG - Intronic
1103975213 12:124698059-124698081 CTAAGGCAGGCTGGGTGCTGCGG - Intergenic
1104715621 12:131014270-131014292 CTGAGACAGGGTGGGTGGTGGGG - Exonic
1105966461 13:25388954-25388976 TTGGGCCAAGCTCTGTGGTGTGG + Intronic
1106475417 13:30094206-30094228 CTGCGGCAGGCCCTGTGGACAGG + Intergenic
1106524316 13:30526790-30526812 CACAGGAAGGCTCTGTGGTATGG - Intronic
1107017800 13:35721599-35721621 CAAAGCCAGGCTCTGTGGAGGGG + Intergenic
1107455535 13:40551133-40551155 TTGAGGGAGGGTCTGGGGTGAGG - Intergenic
1109626684 13:64983234-64983256 CTGTGAGAGACTCTGTGGTGAGG - Intergenic
1110380805 13:74848392-74848414 CTGAGCCAGCCTCTGGGTTGGGG - Intergenic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1112479257 13:99758701-99758723 CTGTTGCAGACTCTGTGGTCTGG - Intronic
1112678298 13:101730838-101730860 CTGACTCAGGCTCTGTGGTGAGG + Intronic
1113555209 13:111228476-111228498 ATGAGGCAGGCTCGATGCTGAGG + Intronic
1114046747 14:18882083-18882105 CTGAGGCCAGCCCTGTGGGGTGG - Intergenic
1114117466 14:19637364-19637386 CTGAGGCCAGCCCTGTGGGGTGG + Intergenic
1114154605 14:20086484-20086506 CAGAGGCGGGGACTGTGGTGGGG - Intergenic
1117546376 14:56797679-56797701 CAGAGGCAGGCTCTGGAATGGGG - Intergenic
1117980269 14:61336007-61336029 GTGAGGCAGGTACTGTGTTGTGG - Intronic
1118301305 14:64618897-64618919 CTGAGGAAGGCAGTGTCGTGTGG - Intergenic
1118895755 14:69943941-69943963 TTGAGGAAGGCAGTGTGGTGTGG + Intronic
1118909007 14:70045923-70045945 CTGCTGGAGGCTCTGTTGTGTGG + Exonic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121248810 14:92484269-92484291 CTGAGGAAGCATCTGAGGTGAGG - Intronic
1121581452 14:95035164-95035186 CTGACCCAGGTTCTGAGGTGGGG + Intergenic
1121802712 14:96788184-96788206 GGGAGCCAGGCTCTGAGGTGTGG + Intergenic
1122007189 14:98715285-98715307 CTAAAGCAGGCTCTGGGGTGTGG + Intronic
1122165438 14:99819805-99819827 GTGAGGCTGGCTGCGTGGTGTGG - Intronic
1122388321 14:101363956-101363978 CCGAGGCAGCATCTGTGGAGGGG - Intergenic
1122540908 14:102497210-102497232 GTGAGGCAGCCTTTGTGCTGGGG + Intronic
1122828215 14:104382601-104382623 CAGAGGCCGGCTGTGGGGTGTGG + Intergenic
1122900502 14:104780410-104780432 CTGAGAGGGGCGCTGTGGTGGGG - Intronic
1122924416 14:104893067-104893089 CTGAGGGAGGCGCTGTGGGCAGG - Exonic
1123886607 15:24733226-24733248 CTCAGGGAGGCGCTTTGGTGTGG - Intergenic
1124363184 15:29053834-29053856 CGGAGGCAGCCACTGTGGGGAGG - Exonic
1124494580 15:30178581-30178603 CTAAGTCAGGCTCTGTGGAGAGG - Intergenic
1124748990 15:32360064-32360086 CTAAGTCAGGCTCTGTGGAGAGG + Intergenic
1125513850 15:40307246-40307268 CTGAGGCAGGCTAGGAGGAGAGG - Intronic
1126118316 15:45228874-45228896 TAGAGGCAGGCTCTGTCCTGAGG - Intergenic
1127791906 15:62405666-62405688 CTGAGACTGGCTCTGGGGTGGGG + Intronic
1128568770 15:68718465-68718487 CTAAAGCACGCACTGTGGTGAGG + Intronic
1128608906 15:69058407-69058429 CTGAGGCAGGCCCTGGGAAGGGG + Intronic
1128778944 15:70345255-70345277 CATAGGCAGGCTCTGTGCTAAGG - Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129674125 15:77623158-77623180 ATGAAGGAGGCTTTGTGGTGAGG + Intronic
1129802714 15:78428269-78428291 CTTAGCCAGGCCCTGTGGTAAGG - Intergenic
1131522192 15:93125065-93125087 CTGAAGCAGGCCAGGTGGTGAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132335263 15:101044326-101044348 CTGAGGCTGTCTCAGTGGGGTGG + Intronic
1132383848 15:101386156-101386178 CTGAGGCAGCACCTGTGGCGCGG - Intronic
1132657004 16:1045602-1045624 CTGACACAGACCCTGTGGTGGGG + Intergenic
1132698662 16:1212989-1213011 CCGAGGCAGGTCCTGGGGTGTGG + Intronic
1132880404 16:2159551-2159573 CTGAGGCAGGGGCTGGGCTGGGG + Intronic
1132888279 16:2192002-2192024 ATGAGTCAGGCTCTGTGCCGTGG + Intronic
1133069241 16:3234934-3234956 CTGAGGCCGCCTCTGGGGAGCGG - Exonic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1133218773 16:4309267-4309289 CTGAGGCCGGCTGTGTGACGTGG - Intergenic
1133558313 16:6926403-6926425 CTGAGGCCTGCTGTGTGGTGAGG - Intronic
1134225653 16:12387840-12387862 CTGAAGCAGCCTCTGGGATGTGG + Intronic
1134297326 16:12958556-12958578 CTGAGTCATGCTCTGTTGTCAGG + Intronic
1134370581 16:13620424-13620446 CTGAGTCAGTTTCTGGGGTGGGG - Intergenic
1134480079 16:14611766-14611788 CTGAGGCAGGCGGTGAGGTCTGG - Intronic
1136139906 16:28281853-28281875 CCCAGGCAGGCTCTGGGGGGTGG + Intergenic
1136254307 16:29028191-29028213 CTGGGGCAGGCCCTGTGGCTGGG + Intergenic
1136508880 16:30723753-30723775 CTGGGGCAGGAAGTGTGGTGGGG - Exonic
1136515744 16:30767179-30767201 CTGAGCCAGGCTCTGTTCTAGGG + Intronic
1136715659 16:32279291-32279313 CTTGGGCAGGATCTGTGGGGCGG + Intergenic
1136752250 16:32650476-32650498 CTTGGGCAGGATCTGTGGGGCGG - Intergenic
1136822341 16:33329986-33330008 CTTGGGCAGGATCTGTGGGGCGG + Intergenic
1136828904 16:33386525-33386547 CTTGGGCAGGATCTGTGGGGCGG + Intergenic
1136833970 16:33485307-33485329 CTTGGGCAGGATCTGTGGGGCGG + Intergenic
1137249692 16:46732571-46732593 CTGCTGGAGCCTCTGTGGTGAGG + Exonic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1137716041 16:50598873-50598895 GTGGGGCAGGATCAGTGGTGTGG + Intronic
1137716055 16:50598922-50598944 GTGGGGCAGGATCAGTGGTGTGG + Intronic
1138375827 16:56563375-56563397 CTGTGGCAGGCACTGGGGAGGGG - Intergenic
1139209893 16:65067016-65067038 CTGTTGCAGGGGCTGTGGTGTGG + Intronic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1139737890 16:69008215-69008237 GTGAAGGAGGCTGTGTGGTGGGG - Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141846241 16:86610919-86610941 CTGAGGGCTGCTCTGGGGTGGGG + Intergenic
1142036723 16:87867016-87867038 CTGAGGCATGCTCCGGGATGTGG - Intronic
1142372648 16:89691663-89691685 CTGAGCCAGGCGGTGAGGTGGGG - Intronic
1203010946 16_KI270728v1_random:239213-239235 CTTGGGCAGGATCTGTGGGGCGG - Intergenic
1203054395 16_KI270728v1_random:910460-910482 CTTGGGCAGGATCTGTGGGGCGG - Intergenic
1142605171 17:1077540-1077562 CTGAGGCAGCCTCTCTCCTGCGG - Intronic
1142807415 17:2378800-2378822 CTGAGCCAGGCTCTGTGTCATGG + Intronic
1142860423 17:2757504-2757526 TTGAGCCAGGCGCTGTGGTCGGG - Intergenic
1143042501 17:4049222-4049244 CTGAGGCAGGCTGGGTGCAGTGG + Intronic
1143371271 17:6441558-6441580 CTGAGGAAGGCAGTGTGGTGTGG + Intergenic
1143471509 17:7178600-7178622 CTGAGGCTGGGGCTGAGGTGGGG + Intronic
1143539982 17:7563003-7563025 GAGAGGCAGGATCTGCGGTGGGG + Intronic
1143617961 17:8064688-8064710 CTGAAGCAGGGTCTGCCGTGGGG + Intergenic
1143975605 17:10827291-10827313 CTGAGTCAGGGTCAGTGATGAGG - Intronic
1144672592 17:17141378-17141400 CGGAGGCAGGCGCTGGGGTAGGG - Intronic
1144728402 17:17513130-17513152 CTGGGGCATGCTCTGTGCTAGGG + Intronic
1146637517 17:34517473-34517495 ATCAGGCAGGATCTATGGTGGGG + Intergenic
1147642767 17:42014662-42014684 CTGAGGCAGAGGTTGTGGTGAGG - Intronic
1147882225 17:43661307-43661329 CTGGGGCAGGCTGTGTGGGGTGG + Exonic
1148437922 17:47696618-47696640 CTGAGGCAGGTTGTGGGTTGGGG + Intronic
1148464560 17:47857196-47857218 CTGAGGCAGGCTCCAGGGAGGGG + Intergenic
1148901829 17:50884373-50884395 ATGAACCAGGCTCTGTGCTGGGG - Intergenic
1148911719 17:50946576-50946598 CTGAGCCAGGCTCTGGTGGGAGG - Intergenic
1149078214 17:52622474-52622496 CAGAAGCAGAATCTGTGGTGGGG + Intergenic
1151434798 17:74088414-74088436 CAGAGGCAGGCTGTGTGCAGAGG - Intergenic
1151494569 17:74451826-74451848 CAGAGGCAGGGTCGGGGGTGGGG - Intergenic
1151944317 17:77311232-77311254 CCTAGGGAGGCTCTGGGGTGGGG - Intronic
1152322255 17:79614233-79614255 CTGAAGCAGCCTCTGTGGCCTGG + Intergenic
1152770227 17:82163042-82163064 CTGAGGAAGGGGCTGTGGGGAGG - Intronic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1153728052 18:7978118-7978140 CAGAGGCTGGCTTTGTAGTGAGG - Intronic
1154333648 18:13449612-13449634 CTGAGCCAGGCTGTCTGCTGTGG + Intronic
1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG + Intronic
1156022798 18:32619119-32619141 TGGAGGCAGGTTCTGAGGTGGGG + Intergenic
1156496787 18:37531027-37531049 CTGAGGCAGGAGCTGGGGTGGGG + Intronic
1156569736 18:38239655-38239677 CTGGGGCAGGCTCCCTGGGGTGG + Intergenic
1156605713 18:38664770-38664792 CTGAGTCAGGCTGTGTAGTGAGG + Intergenic
1158686971 18:59623378-59623400 CTGAGGCATGGTGTGTGGTCAGG + Intronic
1159923754 18:74248557-74248579 GTGAGCCAGGCTATGTGCTGAGG + Intergenic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160741282 19:687227-687249 CTGAGGCAGGAGCGGGGGTGGGG - Intronic
1160798301 19:955661-955683 CTGAGGCAGGAGGTGCGGTGAGG + Intronic
1160872676 19:1284267-1284289 CTGAGGCAGGCCCTCTGGACAGG - Intergenic
1160874336 19:1290221-1290243 CCGAGGCAGCTCCTGTGGTGGGG + Intronic
1161176228 19:2843822-2843844 CTGAGGCAGCCCCTGTGTTCGGG - Intronic
1161290963 19:3493129-3493151 CTGAGTCACGTTCCGTGGTGTGG - Intronic
1161312571 19:3603133-3603155 CTGAGGCAGGGCCTGGGCTGTGG + Intronic
1162478746 19:10915902-10915924 CCTAGGCAGTCCCTGTGGTGTGG + Intronic
1162671245 19:12259638-12259660 ATGACACAGGCTCTCTGGTGGGG - Intronic
1162762402 19:12896476-12896498 GTCAGGCAGGCTCCGTGCTGGGG + Intronic
1162971869 19:14185608-14185630 CTGAGGCAGGCCCTGAAGCGTGG + Intronic
1163171709 19:15536036-15536058 CTGAGAAAAGTTCTGTGGTGTGG + Intronic
1163294841 19:16405346-16405368 CTGCGCTGGGCTCTGTGGTGGGG + Intronic
1163453341 19:17391835-17391857 CTGAAGCCGGCTCTGAGGAGTGG + Intergenic
1163543757 19:17928352-17928374 ATTAGCTAGGCTCTGTGGTGAGG + Intergenic
1164523992 19:29000254-29000276 CTGAGGCAGGCTCAGAGCTGTGG + Intergenic
1164816936 19:31211525-31211547 CTGGGGCAGGGGCAGTGGTGAGG + Intergenic
1164884589 19:31767813-31767835 CTGAGGCAGATTGTGTTGTGGGG - Intergenic
1165273717 19:34731766-34731788 CTGAGGCTGGCTCGGGGCTGGGG - Intergenic
1165789508 19:38483151-38483173 CTGAGGCAGGAGATGTGGGGAGG + Intronic
1166091604 19:40512932-40512954 CTGCAGCAGGCCCTGCGGTGTGG + Exonic
1166300532 19:41909857-41909879 CTGAGCCGGGCCCTGCGGTGAGG - Intronic
1166360302 19:42250325-42250347 CTGAGCCGGGCCCTGCGGTGAGG - Exonic
1166389099 19:42399074-42399096 CTGAGTCAGGGCCTGTGCTGGGG - Intergenic
1166532247 19:43550050-43550072 CAGGGGCAGGCTCTGTTGGGAGG - Intronic
1166664576 19:44671405-44671427 CTGAGGCAGGCTGGGTGCGGTGG - Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1167076185 19:47250920-47250942 CAGAGCCAGGCTCTGTGGGGAGG - Intergenic
1167100861 19:47403542-47403564 CGGAGGCTGGGTCTGTGGAGAGG + Exonic
1167163013 19:47779866-47779888 CTGAGGCTGGGACTGGGGTGGGG + Intronic
1167617194 19:50541822-50541844 CTGAGGGAGGATTTGCGGTGGGG + Intronic
1168325177 19:55535193-55535215 CTGAGGCCAGCCCTGTGCTGGGG - Intronic
1168403709 19:56100116-56100138 CTGAGGAAGGGTCCGGGGTGAGG + Intronic
925143297 2:1564622-1564644 CTGAGGCAGGATGTGGGTTGGGG + Intergenic
925237805 2:2294254-2294276 CTGAGGGGAGCCCTGTGGTGAGG + Intronic
925366366 2:3314774-3314796 CTGAGGCAGGTCCTGGGGAGAGG - Intronic
925404086 2:3594900-3594922 CTGAGGCCGGCTTTGGGGTGGGG - Intronic
926166793 2:10526144-10526166 CTGAGGCTGGGTCCGTGCTGGGG + Intergenic
926197280 2:10771642-10771664 CAGGGCCAGGCTCTGTGCTGGGG - Intronic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
926761720 2:16284138-16284160 ATGAGGCAGGTTCTGGGATGTGG - Intergenic
926878889 2:17518562-17518584 CTGAGGCTGGGGCTGTGGAGGGG - Intergenic
926896342 2:17693532-17693554 CCGGGGCCGGCTGTGTGGTGGGG + Intronic
928924695 2:36565665-36565687 CTGAGCCTGGCTCTGTTCTGTGG - Intronic
928965945 2:36975473-36975495 CTGAGGCAGGCTGGGCGCTGTGG + Intronic
929584095 2:43102511-43102533 AGGAGCCAGGCCCTGTGGTGCGG - Intergenic
930166401 2:48207705-48207727 TTGATGAAGGTTCTGTGGTGTGG + Intergenic
930700852 2:54456758-54456780 GGGCGGCAGGCTCTGCGGTGAGG + Intronic
932597935 2:73105820-73105842 CTGAGGTGGGCAGTGTGGTGTGG + Intronic
932730072 2:74213521-74213543 CTGAGGCAGGGTGTGAGGTGGGG - Intronic
932771553 2:74503357-74503379 CTCAGGCCGGATCTGGGGTGGGG - Intergenic
932871992 2:75410028-75410050 CAGGGGCAGGCTATCTGGTGTGG - Intergenic
933338072 2:80985333-80985355 CTGAGTCTGCCTCTGAGGTGAGG + Intergenic
933971591 2:87474145-87474167 TTAAGGCATGCTCTGTGGAGTGG + Intergenic
934502326 2:94870673-94870695 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
934549846 2:95252239-95252261 CTGGGGCCTGCTGTGTGGTGGGG - Intronic
934732743 2:96669710-96669732 CTGCTGGAGGCTGTGTGGTGAGG - Intergenic
934736275 2:96691434-96691456 CTTGGCCAGGCCCTGTGGTGGGG - Intergenic
935091075 2:99895607-99895629 CTGTGGCTGGCACGGTGGTGAGG - Intronic
935292246 2:101620533-101620555 CTGGGGAAGGCTCTGTGTGGAGG - Intergenic
935706778 2:105864088-105864110 CTGGGGCAGCCTCTGGGGTGGGG + Intronic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936322139 2:111476054-111476076 TTAAGGCATGCTCTGTGGAGTGG - Intergenic
937989815 2:127655933-127655955 CAGAGGCAGGCCCTGCTGTGGGG + Intronic
938266612 2:129932818-129932840 CTGAGGCCAGCCCTGTGGGGTGG + Intergenic
938942719 2:136182895-136182917 CTCTGGCTGGCTGTGTGGTGTGG + Intergenic
941044431 2:160656367-160656389 GTCAGGGAGGCTCTGTGGGGTGG - Intergenic
941403007 2:165054859-165054881 GTGAGGGAGGTTGTGTGGTGGGG + Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
945942004 2:215959693-215959715 CAGAGGCAGACTCTGTGTGGAGG - Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
947055261 2:226092405-226092427 CATAGGCATGCTATGTGGTGAGG - Intergenic
947605738 2:231484031-231484053 CGGAGGCTGCCTCTGGGGTGCGG + Intergenic
947670243 2:231931117-231931139 CTGGTGCAGGCTCTGAGCTGAGG - Intergenic
947712601 2:232324633-232324655 CAGAGGGTGGCTTTGTGGTGAGG + Intronic
947963506 2:234259795-234259817 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963516 2:234259836-234259858 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963526 2:234259871-234259893 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963555 2:234260020-234260042 CTGAGGCTGGGGCTGAGGTGAGG - Intergenic
947963561 2:234260043-234260065 CTGAGGCTGGGACTGAGGTGAGG - Intergenic
948148773 2:235728532-235728554 CTGAGGCAGGGTCTGTGTGCAGG + Intronic
948464019 2:238143607-238143629 CTGATGCAGGCTGGCTGGTGTGG + Intronic
948640216 2:239370997-239371019 CTGTGGGAAGCCCTGTGGTGTGG - Intronic
948884756 2:240877108-240877130 CTGAGGCAGGAGCAGTGCTGCGG + Intronic
948976218 2:241465298-241465320 CTGAGGAAGACTCTGTTCTGTGG - Intronic
949025215 2:241764628-241764650 CTGAGGCAGGACCTGAGTTGGGG + Intronic
1168814326 20:726454-726476 CAGAGGTGGGCTCTGGGGTGAGG - Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169728047 20:8757238-8757260 CTGACGGAGGCGCTGTGATGTGG + Intronic
1170590668 20:17769015-17769037 CTGGGGCAGGTTCTGAGGGGAGG - Intergenic
1170591104 20:17772667-17772689 CTGAGGCAGGCACTTTGCTGGGG - Intergenic
1170704559 20:18733425-18733447 CTCTGGCAGTGTCTGTGGTGGGG + Intronic
1170896618 20:20420623-20420645 CAGAAGCAGGCTCTCCGGTGAGG + Intronic
1171204041 20:23265476-23265498 CTGAGTCAGGCACTGTAGGGTGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172291942 20:33783256-33783278 TTGACCCAGGCTCTGTGCTGGGG + Intronic
1172435566 20:34926750-34926772 CTGAGGCTGTCTCTGTGGGCAGG + Intronic
1174115962 20:48226450-48226472 CTGAGGCAGTGTGGGTGGTGGGG + Intergenic
1175935980 20:62514224-62514246 AGGAGGCAGGGTCTGAGGTGGGG + Intergenic
1176059749 20:63167458-63167480 CTGAGGTGGGCACTGAGGTGAGG - Intergenic
1178894322 21:36546259-36546281 CTGAATCAGGCTCTGGGATGAGG - Intronic
1179261204 21:39759577-39759599 CTGAGGCAGGCTGGGTGTGGTGG + Intronic
1179465402 21:41568357-41568379 AGGAGGCAGAATCTGTGGTGGGG - Intergenic
1179504557 21:41831855-41831877 GTGAGGCTGGCTCTGGGCTGAGG - Intronic
1179534750 21:42044286-42044308 CTGAGGCAGGCTGGGTGGTGAGG - Intergenic
1180094946 21:45552107-45552129 ATGGGGCTGGCTGTGTGGTGGGG + Intergenic
1180148369 21:45934640-45934662 CTGAGCCAGGCTATGTGCAGGGG + Intronic
1180465283 22:15604722-15604744 CTGAGGCCAGCCCTGTGGGGTGG - Intergenic
1180933374 22:19608279-19608301 CGGATGCAGCCTCTGTGGGGAGG + Intergenic
1181130206 22:20726765-20726787 CTGAGGCAGGCTCCCTAGTGAGG - Intronic
1181133464 22:20748352-20748374 AACAGGCAGGCTGTGTGGTGTGG + Intronic
1181137187 22:20776395-20776417 CTGAGGCAGGTGCTGAGATGGGG + Intronic
1181343516 22:22200878-22200900 CTGAGGCAGACACTGAGGTGGGG - Intergenic
1181541960 22:23578432-23578454 CAGGGTCAGGCTCTGTGCTGGGG - Intronic
1181543016 22:23584023-23584045 CTGAGGCTGCCTCTGTTGAGAGG - Intergenic
1181750066 22:24983016-24983038 GTGGGCCAGGCTCTGTGCTGGGG + Intronic
1181765361 22:25087674-25087696 CAGAAGCAGACTCTGAGGTGGGG + Intronic
1182129331 22:27839467-27839489 GTCAGGCGGGCTCTGTGGTCTGG - Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183685906 22:39361300-39361322 CGGGGGCAGGCACTGGGGTGAGG + Intronic
1184094895 22:42311188-42311210 CTGCGGCAGGCTCTGGGCAGGGG + Intronic
1184240072 22:43207309-43207331 CTGAGGGAAGCTGTTTGGTGAGG - Intronic
1184802033 22:46767177-46767199 ATGAGCCAGGATGTGTGGTGTGG + Intronic
1185045707 22:48527744-48527766 CTGGGTCAGCCTCTGTCGTGTGG + Intronic
1185304167 22:50103451-50103473 CTGAAGCACTCTCTGTGGTGGGG + Intronic
950139097 3:10602872-10602894 AGGAGGGAGGCTCTGAGGTGTGG - Intronic
950206159 3:11082772-11082794 CTGGGGCAGAATCTGGGGTGAGG - Intergenic
950531978 3:13557542-13557564 CCCAGGCAGGCTCTGCCGTGTGG + Intronic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
951576274 3:24117466-24117488 CTGAGCCAATCACTGTGGTGAGG - Exonic
952311513 3:32194745-32194767 CTGAGCCAGGCTGTGTCATGGGG - Intergenic
952730529 3:36633531-36633553 GTGAGGGAGGCTCTGTGTGGTGG - Intergenic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
954160471 3:48717805-48717827 CTCAGACAAGCCCTGTGGTGTGG - Intronic
954689796 3:52389611-52389633 CCCAGGCAGGGCCTGTGGTGTGG + Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
956401483 3:68884349-68884371 CTTTGGCAGGATCTGTGGGGTGG + Intronic
958720470 3:97837300-97837322 GTCAGGTGGGCTCTGTGGTGAGG + Intronic
959905273 3:111704295-111704317 CTGTGACTGGCTCTGAGGTGAGG - Intronic
960360212 3:116701994-116702016 CTGAGGGAGTCGCTGTGGTGTGG - Intronic
961115217 3:124323456-124323478 GTGGGCCAGGCTCTGTGTTGGGG - Intronic
961454971 3:127019465-127019487 CTGAGGCTGGCTGTCTGGCGAGG + Intronic
961511599 3:127407069-127407091 CTAAGGAAGCCTCTGGGGTGTGG - Intergenic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961935323 3:130576733-130576755 GTGAGGCAGGCTATGAGCTGAGG + Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
963064506 3:141252842-141252864 GTGAGAGAGGGTCTGTGGTGCGG + Intronic
964373119 3:156022245-156022267 CTGAGGCAGGTTCTGAGCTCAGG - Intergenic
964502413 3:157363027-157363049 CTGAAGCCGGCTCTGGGGTAGGG - Intronic
966350842 3:179032024-179032046 CAGAGGGAGGCTGTGTGGAGGGG - Intronic
966669006 3:182506102-182506124 ATGTGAAAGGCTCTGTGGTGGGG - Intergenic
967070819 3:185961039-185961061 CTGTGGCACACCCTGTGGTGGGG - Intergenic
967862304 3:194161240-194161262 GTGAGGCAGGCTCTGTTCTCAGG - Intergenic
968124125 3:196145920-196145942 CTGAGGCAGCCTCTGGGTAGTGG + Intergenic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968517265 4:1020628-1020650 CTGAGGCAGGGGATGGGGTGGGG + Intronic
968568305 4:1326620-1326642 CTGAGGCAGGGGCGGGGGTGGGG - Intronic
968632329 4:1658516-1658538 CTAAGCCAGGCTCTGGAGTGTGG + Intronic
968635414 4:1675910-1675932 CTGAGGCACTGCCTGTGGTGGGG - Intronic
968688798 4:1979055-1979077 CTGAGGATGGCTCAGTGGTGGGG - Exonic
969125339 4:4943805-4943827 CTGAGGCAGGGGTTGTGGGGTGG + Intergenic
969324234 4:6431685-6431707 CAGAGGCAGGCCCCGAGGTGTGG - Intronic
970608450 4:17704100-17704122 CTGGGGCATGCACTGTTGTGTGG - Intronic
971727130 4:30328183-30328205 CAGAGGCAGGGGCTGTGGAGTGG + Intergenic
973637956 4:52877292-52877314 CTGGGGCCTGCTCTGTGGAGGGG + Intronic
975195350 4:71518098-71518120 CTGAGGCTGGCTTGGTGCTGGGG + Intronic
975392140 4:73832968-73832990 CTGAGGAAGGCTGGGTGGTTTGG - Intergenic
975405636 4:73985802-73985824 TTGAGGAAAGCACTGTGGTGTGG + Intergenic
976072799 4:81260801-81260823 CTGGGGAAGGTGCTGTGGTGGGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
977695387 4:99959183-99959205 CTGAGGCTGAATCTGTGGAGGGG - Intergenic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
981658233 4:147136589-147136611 CAGAGGCAGGGAGTGTGGTGGGG - Intergenic
982119823 4:152132206-152132228 CTCAGGCAGGCTCTGTGTCCTGG + Intergenic
983912982 4:173260554-173260576 CTGAGGCAAGAGTTGTGGTGGGG + Intronic
984708289 4:182863718-182863740 CTCAGGCTGGCGCTGGGGTGTGG - Intergenic
984709810 4:182875663-182875685 CTGAGGCAGGGTGTGTGGGAGGG + Intergenic
985083611 4:186291653-186291675 CTGAGCCAGTCACTCTGGTGGGG - Intergenic
987701798 5:21409498-21409520 CTGAGCCAGGGTCTGTGGAATGG - Intergenic
988082162 5:26428286-26428308 CTGAGGCCTGTTGTGTGGTGGGG - Intergenic
991583777 5:68182505-68182527 CTTGAGCAGGCTCTGTGCTGTGG + Intergenic
991944285 5:71884504-71884526 CTTGGGCAAGCTCTGTGGTAAGG + Intergenic
992507959 5:77406621-77406643 AGGAGGCAGGCTCTGATGTGGGG + Intronic
992671829 5:79069436-79069458 CTGAGGCAGGCTCAGGGGTTAGG - Intronic
994386656 5:99141531-99141553 ATGAAGCCTGCTCTGTGGTGGGG - Intergenic
995275574 5:110274169-110274191 CAGAGCCAGGCTCTGTCTTGGGG - Intergenic
995456173 5:112354481-112354503 ATGAGGGAAGCTCTGTGGTAAGG + Intronic
999316634 5:150588431-150588453 CTGAGGCTGGCTCTGGGGGAGGG - Intergenic
999750884 5:154627575-154627597 CAGAGGCAGGGTGTGTGTTGGGG - Intergenic
999821464 5:155233118-155233140 CTGGGGCTGGATCTGTGCTGTGG - Intergenic
1001325798 5:170722915-170722937 ATGAGGCAGGCTCTGCTTTGGGG + Intronic
1001603049 5:172941498-172941520 CAGAGGCAGGCACTGGGGTCAGG - Intronic
1002604373 5:180373465-180373487 ATGGGGCAGGCTCTGTGGTCAGG + Intergenic
1002607355 5:180391049-180391071 GTGGGGCCGGCTCTGTGGTCTGG - Intergenic
1002685475 5:181005900-181005922 CTGTGTCTGGGTCTGTGGTGTGG - Exonic
1002939586 6:1704356-1704378 CTGAGGCTGGCAGAGTGGTGTGG + Intronic
1003068225 6:2921014-2921036 CTGAGGCAGGCACAGGGGAGTGG - Intergenic
1003269287 6:4593137-4593159 CAGAGCCAGGCCCTGCGGTGGGG - Intergenic
1004126931 6:12883133-12883155 CTCAGGCAGGGGCTGGGGTGGGG - Intronic
1005302159 6:24481584-24481606 CTGAGCCAAACTCTGTGGTGAGG - Intronic
1005650299 6:27879427-27879449 CTGAGGCTGGATCTAGGGTGTGG + Intergenic
1006029765 6:31170447-31170469 TTGGGCCAGGCTCTGAGGTGTGG - Exonic
1006058396 6:31402539-31402561 CTGAGGCAGGCACCGTGTTTAGG + Intronic
1006070836 6:31497082-31497104 CTGAGGCAGGCACAGTGTTTAGG + Intronic
1006135358 6:31892630-31892652 CTGAGGGAGGGTCAGAGGTGGGG - Intronic
1006807403 6:36797629-36797651 CTGAAGCGGGCTCTGGGATGAGG - Intronic
1006813524 6:36836365-36836387 CAGAAGAAGGCTCTGTGGTAGGG + Intronic
1007472130 6:42097812-42097834 CTGTGGCTGGCTCACTGGTGGGG + Intergenic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1008166496 6:48145271-48145293 CTGAGGCAGGGTTTCTGTTGTGG + Intergenic
1008430629 6:51412823-51412845 ATGAAGAAGGCTGTGTGGTGGGG + Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1012554255 6:100492441-100492463 CTGAGAGAGGCTCTGCTGTGGGG + Intergenic
1012947741 6:105485946-105485968 TTGAAGCAGGCTCTGTTGTCAGG - Intergenic
1014213424 6:118730584-118730606 CTGAGGAAGGCCATGTGGGGTGG + Intergenic
1015612157 6:135034919-135034941 CTGAAGCAGTCTCTGTGGAATGG - Intronic
1016997611 6:149971170-149971192 CCTGGGCTGGCTCTGTGGTGTGG + Intronic
1017945672 6:159094607-159094629 CTGAGCCAGGCTCTGGGCCGCGG - Intergenic
1018767767 6:166947126-166947148 CTCATGCTGGATCTGTGGTGCGG - Intronic
1018842319 6:167526297-167526319 CTGGCGCAGGCTCAGGGGTGAGG - Intergenic
1018903887 6:168064205-168064227 CTGAGGCAGTCGCTGAGGTCAGG - Intronic
1018934034 6:168261544-168261566 CCAAGGCAGCCTCTGTGGTCAGG - Intergenic
1019047525 6:169160333-169160355 CTGGGCCAGGTTCGGTGGTGTGG - Intergenic
1019121048 6:169803939-169803961 CTGAGGAGAGTTCTGTGGTGTGG - Intergenic
1019121132 6:169804910-169804932 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121356 6:169807736-169807758 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019179553 6:170177787-170177809 CTGAGGCAGCCTCTGGGGCTCGG + Intergenic
1019200497 6:170310392-170310414 CACAGGGTGGCTCTGTGGTGAGG + Intronic
1019430779 7:997942-997964 CTGGGGCAGGGTCTGTGGCCAGG - Intronic
1019664701 7:2245997-2246019 GTGCGACAGGCTCTGTGCTGGGG + Intronic
1019665968 7:2252538-2252560 CTGGGGTTGGCTCTGTGGAGGGG - Exonic
1021195923 7:17674189-17674211 CGGAGGCAGGCTCTTTATTGGGG + Intergenic
1021999141 7:26208225-26208247 CGGAGGCAGGCTGGGGGGTGGGG + Intronic
1022038532 7:26557334-26557356 GTGAGGCAGACACTGTGCTGGGG + Intergenic
1022467002 7:30658666-30658688 CTAAGGCAAGCTCTGTGGTTAGG - Intronic
1023489631 7:40725036-40725058 CTGAGACAGGAGCTGTCGTGGGG + Intronic
1024983965 7:55180108-55180130 CTGAGCCAGGCTCTGAGATAGGG - Intronic
1029428505 7:100513385-100513407 CTTAGGGAGGCTGAGTGGTGAGG + Intergenic
1029434730 7:100556639-100556661 CTTGGGTAGGCTCTGGGGTGGGG - Intronic
1030259245 7:107544609-107544631 CCTAGGCAGGCTTTCTGGTGTGG - Intronic
1030330347 7:108263687-108263709 GTGAGCCAGGCTCTGTGGAGTGG - Intronic
1030889298 7:114979506-114979528 CTGAGGCAAGCGCTGAGGTTGGG - Exonic
1032336458 7:131029369-131029391 TTGAGCCAGGCTCTGTGATAGGG - Intergenic
1032411455 7:131696067-131696089 CTGTGTCAGGCTCTGTTTTGGGG + Intergenic
1032852590 7:135808111-135808133 CTGAGGCACACTGTGTGCTGAGG - Intergenic
1034331740 7:150288813-150288835 ATGAGGCAGGCTCTGCAGTTGGG - Intronic
1034666298 7:152821057-152821079 ATGAGGCAGGCTCTGCAGTTGGG + Intronic
1035357555 7:158285633-158285655 CAGCAGCATGCTCTGTGGTGTGG - Intronic
1036008678 8:4695595-4695617 ATGGGGAAGGCTGTGTGGTGGGG - Intronic
1037950674 8:23017157-23017179 CTGCTGCAGGCCTTGTGGTGGGG + Intronic
1039177461 8:34825653-34825675 CAGAGGCATGCTTGGTGGTGTGG + Intergenic
1039785596 8:40831890-40831912 CTGAGCCAGGCCTTGTGCTGAGG + Intronic
1043581484 8:81720973-81720995 CTGAGGCAGGGCCTGAGGAGCGG - Intronic
1044927786 8:97224065-97224087 CTGAGGGAGGCTCTGGGGGAAGG - Intergenic
1047697256 8:127416018-127416040 TTGGGCCAGGCTCTGAGGTGTGG + Exonic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048963698 8:139600065-139600087 CTGAGGCAGGCTGGCTGGAGGGG - Intergenic
1049017650 8:139932253-139932275 CTGAGCGAGGCCCCGTGGTGCGG - Exonic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049308558 8:141920925-141920947 CTGAGAGGGGCTCTGTGCTGGGG - Intergenic
1049414790 8:142490259-142490281 CTGAGGGTGGCTCTCAGGTGTGG - Intronic
1049436985 8:142591045-142591067 AAGAGGCAGGGTCTTTGGTGGGG - Intergenic
1049608276 8:143540017-143540039 CGGGGGCAGGGCCTGTGGTGGGG - Intronic
1049758028 8:144319448-144319470 CTGGGGCTGTCTCTGGGGTGTGG - Intronic
1053350817 9:37412231-37412253 CAGAAGCAGGCTCTCTGCTGAGG - Intergenic
1053521934 9:38789573-38789595 CTGGGTCAAGCTCTGTGGTCTGG - Intergenic
1053787207 9:41660695-41660717 CTGAAGCAGTGCCTGTGGTGAGG - Intergenic
1054175484 9:61872034-61872056 CTGAAGCAGTGCCTGTGGTGAGG - Intergenic
1054194100 9:62013561-62013583 CTGGGTCAAGCTCTGTGGTCTGG - Intergenic
1054644307 9:67575130-67575152 CTGGGTCAAGCTCTGTGGTCTGG + Intergenic
1054662053 9:67708776-67708798 CTGAAGCAGTGCCTGTGGTGAGG + Intergenic
1055161371 9:73132491-73132513 CTGAGACAGGCTCAGCCGTGGGG + Intergenic
1055804614 9:80078274-80078296 AAGAGGCAGGGCCTGTGGTGGGG - Intergenic
1056235536 9:84590261-84590283 CTTATGCAGGCTCTGGGGTGGGG - Intergenic
1056926774 9:90840987-90841009 GTGGTGCAGGATCTGTGGTGTGG + Intronic
1057379207 9:94553744-94553766 CTCACGCACGCTCTGTGTTGTGG - Intergenic
1058388276 9:104463867-104463889 CTGAGGCAAACATTGTGGTGTGG - Intergenic
1058650852 9:107174659-107174681 CACAGGCAGCCTCTGTGGTGAGG + Intergenic
1058676580 9:107405340-107405362 CTGAGGCAGGCTGGGTGCAGTGG - Intergenic
1058779088 9:108315520-108315542 CAGAGTCAGCCTCTGTGGTAGGG + Intergenic
1058811569 9:108644582-108644604 AAGAGCCAGGCTCTGTGATGTGG + Intergenic
1059028216 9:110660046-110660068 CTGAGGCAGAGAGTGTGGTGAGG + Intergenic
1059367104 9:113794787-113794809 CTGAGGTGGGGTCTGAGGTGGGG + Intergenic
1060050062 9:120372104-120372126 CTGAGGCAGGGGCTGTGCTGAGG + Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060824416 9:126679814-126679836 CAGAGTCAGGCTCTGTGTAGAGG - Intronic
1060939310 9:127534581-127534603 CTGAGGCAGGGCCCGGGGTGTGG - Intronic
1061087417 9:128407205-128407227 CTGGGTCAGGCTCTGTTCTGAGG + Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061400586 9:130366071-130366093 CTCAGCTAGGCTCTGGGGTGGGG - Intronic
1061632611 9:131882706-131882728 CTGAGGCAGGCAGTGTGAGGAGG - Intronic
1061770891 9:132920569-132920591 TAGAGGCAGTGTCTGTGGTGAGG + Intronic
1061807382 9:133144042-133144064 CTGAGGCAGGGTCTGGGGCTGGG + Intronic
1061912313 9:133731669-133731691 CTGAGGCAGGCTCCGGGGCCAGG + Intronic
1062039564 9:134397875-134397897 CTGAGGCTGTCCCTGTGGTTTGG + Intronic
1062105648 9:134753438-134753460 CTGAGTCAGGCCCTGTGTGGAGG - Intronic
1062387521 9:136318877-136318899 CTGAGGCTGGCACTGTGGCCTGG + Intergenic
1203563233 Un_KI270744v1:74557-74579 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
1186116981 X:6314496-6314518 CTGAGGCTGGGGTTGTGGTGGGG - Intergenic
1186411429 X:9347693-9347715 CTGGAGCATGCTCTGTGGTGGGG - Intergenic
1187257108 X:17653856-17653878 CTGAATCAGACTCTGGGGTGAGG - Intronic
1189134472 X:38534280-38534302 CTCAGGCAGGCTGAGAGGTGAGG + Intronic
1190380708 X:49837276-49837298 CTCAGGCAGGCTCCTTGGAGGGG + Intergenic
1190492519 X:50997135-50997157 CAGAGGCAGGGTGAGTGGTGTGG - Intergenic
1190690375 X:52908658-52908680 TTGAGGGAAGCTCTGTGCTGTGG + Intergenic
1190695608 X:52947134-52947156 TTGAGGGAAGCTCTGTGCTGTGG - Intronic
1190873793 X:54445792-54445814 TGGAGGCAGGATCTGTGGTAGGG + Exonic
1196459248 X:115912554-115912576 CTTGGGCAGCCGCTGTGGTGTGG - Intergenic
1197652577 X:129081937-129081959 CTGAGTCAGCCTCTGGGTTGAGG + Intergenic
1197759197 X:130015765-130015787 CTTAGGCAGGTTCTGGGGGGTGG - Exonic
1198457283 X:136828923-136828945 CAGAAGCAGGCTCTGAGATGAGG + Intergenic
1198792685 X:140362731-140362753 CTGGACCAGGCTCTGTGGAGGGG - Intergenic
1200017747 X:153179339-153179361 CTGACCCAGGCTCTGTGAGGAGG + Exonic
1200691342 Y:6308033-6308055 CTGAGGTGGGGTCCGTGGTGGGG + Intergenic
1200702894 Y:6417270-6417292 TTCAGGCAGCCTCTGTGGTCGGG + Intergenic
1200805257 Y:7427311-7427333 CTGGAGGAGGCTCTGTGGTGTGG + Intergenic
1200872737 Y:8121126-8121148 CTGTGACAGGGGCTGTGGTGGGG + Intergenic
1200940322 Y:8773872-8773894 ATGAGGCAGGCTCAGGTGTGTGG + Intergenic
1201018311 Y:9626197-9626219 CTGAGGTAGGCACCATGGTGGGG + Intergenic
1201031216 Y:9747427-9747449 TTCAGGCAGCCTCTGTGGTCGGG - Intergenic
1201043930 Y:9866683-9866705 CTGAGGTGGGGTCCGTGGTGGGG - Intergenic