ID: 1071503512

View in Genome Browser
Species Human (GRCh38)
Location 10:86219524-86219546
Sequence GCGGGGGTGCTGCCCCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503512_1071503522 20 Left 1071503512 10:86219524-86219546 CCTATGAGGGGCAGCACCCCCGC 0: 1
1: 0
2: 1
3: 12
4: 80
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503512_1071503526 30 Left 1071503512 10:86219524-86219546 CCTATGAGGGGCAGCACCCCCGC 0: 1
1: 0
2: 1
3: 12
4: 80
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503512 Original CRISPR GCGGGGGTGCTGCCCCTCAT AGG (reversed) Intronic
900287229 1:1907512-1907534 GCAGGGGTGCTGCCCCTCCTGGG + Intergenic
900456772 1:2778690-2778712 GGGTGGGTGCTGCCCCTCCTGGG - Intronic
901792006 1:11658665-11658687 GCGGGGGTGGGGCGCCTGATTGG - Intronic
903323469 1:22556155-22556177 TCTGGGGTGCTGCTCCGCATGGG - Intergenic
904042565 1:27593071-27593093 GCTGCGGTGCTGCCCCTCCAGGG + Intronic
905340115 1:37272456-37272478 GCTAGGGAGCTGGCCCTCATGGG + Intergenic
915518808 1:156429565-156429587 AAGGGGGTGCTGCCCCTCTCTGG + Intronic
1063922088 10:10943314-10943336 GTGGGAGTTCTGCCCCTCACAGG - Intergenic
1065794268 10:29291877-29291899 GCGGGCATTCTGACCCTCATTGG + Exonic
1065948293 10:30626884-30626906 GCGGGCATTCTGACCCTCATTGG - Exonic
1066192018 10:33064678-33064700 GGGGGGGTGCTGCCCATCCCTGG + Intergenic
1070306996 10:75245635-75245657 GCGGGGGTGCTGCCTCACGCAGG + Intergenic
1070314242 10:75295243-75295265 GCAGGGGCGCGCCCCCTCATGGG + Intergenic
1070774707 10:79102941-79102963 GAGGAGGTGCTGACCCTCCTGGG + Intronic
1071503512 10:86219524-86219546 GCGGGGGTGCTGCCCCTCATAGG - Intronic
1072719347 10:97771211-97771233 GGGGGGGAGCTGCACCTCTTGGG + Intronic
1076758199 10:132586166-132586188 TCTGGGGTGCTGACCCTCCTGGG + Intronic
1077505609 11:2928782-2928804 GCGGGGGCGCTGCACCTCCTTGG - Intronic
1082787982 11:57327674-57327696 GGAGGGGTGATGCCTCTCATGGG - Intronic
1082987591 11:59181874-59181896 CCAGGGGTGCTGCTTCTCATAGG - Exonic
1083808295 11:65087974-65087996 GCGGGGCTGCTGCTACTCTTGGG + Exonic
1084557535 11:69883848-69883870 GCGGGGATGCTGCCACCCACAGG + Intergenic
1092245595 12:6862382-6862404 CCTGGGGTTCAGCCCCTCATGGG - Intronic
1095812129 12:46383065-46383087 GCGGGGGTGCGGCGCCCCAGAGG + Intergenic
1102475745 12:113186996-113187018 GTGGGGGTGCTGCCCCTTGAGGG - Exonic
1103558818 12:121781483-121781505 ACTGGGGGGCTGCCGCTCATGGG - Exonic
1106108758 13:26759295-26759317 CTGGGGCTGCTGCCCGTCATGGG - Exonic
1106384407 13:29270062-29270084 GTGGGGGTGCTGCCGTTCGTTGG + Intronic
1113259499 13:108546078-108546100 GCGTGAGTGCAGACCCTCATGGG + Intergenic
1120714122 14:87822045-87822067 GAGGGGATGCAGCTCCTCATTGG + Intergenic
1131527947 15:93167525-93167547 GCCTGGCTGCTGCCCCTCCTTGG - Intergenic
1137523384 16:49212693-49212715 GCTGGGGTTATGCCCCTCAGAGG + Intergenic
1145811572 17:27767427-27767449 GCGGGGCTCCTGGCCCACATGGG - Intronic
1146161085 17:30559791-30559813 CGGGGGCTGCAGCCCCTCATGGG + Intronic
1146882804 17:36453075-36453097 GCGGGGCTGGAGCCCCTCGTGGG - Intergenic
1148092477 17:45030917-45030939 GTGGGGGTGCTGCCCTTGACTGG - Intronic
1157283220 18:46359692-46359714 GCTGGTGTGGTGCCCCTCAGTGG + Intronic
1160935174 19:1591449-1591471 GCGGTCGTTCTGCCCCTCCTTGG + Intronic
1161167719 19:2797188-2797210 GCATGGGGGCTGCCCCTCATCGG + Intronic
1161217708 19:3102753-3102775 GCAGGAGGGCTGCCCCTCCTCGG + Intronic
1161264611 19:3358632-3358654 GCGGGGGCGCTGACCCACCTCGG + Intergenic
1161408401 19:4102930-4102952 ACGCGGGTGCTGCCCCGCGTGGG + Intronic
1166965855 19:46529019-46529041 GTGTGGGTCCTGCCACTCATGGG - Intronic
1168335648 19:55596101-55596123 GTGGGGGTGAGGCCCCTCAGGGG + Intronic
925149245 2:1603202-1603224 GCGGAGGTGCTGCTCCTCTCCGG + Intergenic
925314382 2:2909857-2909879 GCGGTGGTGCTGCCCCCACTGGG - Intergenic
927451089 2:23210078-23210100 TCTGGGGTGCTGCTCCTCTTGGG - Intergenic
927718770 2:25369761-25369783 GCGGGAGTGCTGCCCCTTCCAGG - Intergenic
934839910 2:97618221-97618243 GGGGAGGGGCTGCCACTCATCGG + Intergenic
936384019 2:112012625-112012647 CAGGGGTTGCTGCCCCTCTTAGG - Intronic
936985822 2:118310645-118310667 GCCGGGGTGCTGGCACTCAACGG + Intergenic
937953245 2:127404576-127404598 ACGGGGGAACTGCCCCACATGGG + Intergenic
948530196 2:238599307-238599329 GCAGGGGTGCTGCCCCGCGTGGG + Intergenic
948724097 2:239921186-239921208 GCGAGTGAGCTGCACCTCATTGG + Intronic
948888869 2:240897234-240897256 ACTGGGCTGCAGCCCCTCATAGG - Intergenic
948928747 2:241116926-241116948 GCGGGGGTGCAGCCCCTGCGAGG + Intronic
1170472843 20:16685544-16685566 GCGGGTGGCCTGCCCTTCATAGG + Intergenic
1175125798 20:56750717-56750739 GCGGGGCTGCGGCACCTCCTGGG + Intergenic
1175902694 20:62366382-62366404 GCAGAGATGCTGCCCCTCCTGGG + Intronic
1176257787 20:64161265-64161287 GCGGGGGTGCTGCCCCAGGCCGG - Intronic
1178673756 21:34614446-34614468 GCGGCGGCGCTGCCCCACCTTGG + Intronic
1180045224 21:45302064-45302086 GCAGGGATGCAGCCCCGCATGGG - Intergenic
1181519332 22:23436363-23436385 GCGGGGGTCCTGCTCCGCCTGGG + Intergenic
1182483923 22:30627910-30627932 GCAGGGATCCTGCCTCTCATTGG + Intergenic
1183712249 22:39512031-39512053 GAAGGGCTGCTGCCCCTCCTGGG + Intronic
1184827680 22:46964053-46964075 GCCGGGCTCCTGCCCCTCCTTGG + Intronic
1185274391 22:49944085-49944107 GCCGGGTTGCTGCCCCTCTTGGG - Intergenic
949795930 3:7851055-7851077 GTGGCGGTGCTGTGCCTCATAGG - Intergenic
953605836 3:44412665-44412687 GCAGGGCTGCTGGCCCTCCTCGG + Intergenic
954420951 3:50418770-50418792 GCAGGGGTGGGGCCCCTCAGAGG + Intronic
963466993 3:145695033-145695055 GTGGGGATGTTGCCACTCATTGG + Intergenic
968820082 4:2843746-2843768 GCAGGGGACCCGCCCCTCATGGG + Intergenic
990186136 5:53212112-53212134 GCAGGGCTGCTGCACATCATGGG + Intergenic
991927460 5:71719309-71719331 GTGAGGCTGCTGCCCCTCCTGGG + Exonic
993503859 5:88689457-88689479 GATGGGGGGCGGCCCCTCATTGG + Intergenic
1004197194 6:13515714-13515736 CGGGGGGTTCTGCCCCACATAGG - Intergenic
1008109681 6:47478346-47478368 GGTGGGGTGCTGCCGCTCAGGGG - Intronic
1018745396 6:166757759-166757781 CCGGGAGTCCTGCCCCTCACAGG + Intronic
1019181053 6:170187448-170187470 GCGGGGGGCCTGCCCCTCACCGG - Intergenic
1019591947 7:1839968-1839990 GCGGGGGTCCTGCTCCGCCTGGG - Intronic
1041652259 8:60312725-60312747 GCAGGGCTGCTGCACGTCATGGG + Intergenic
1049277995 8:141729483-141729505 GTGGGGGCTCTGCCCCGCATCGG - Intergenic
1049752670 8:144292617-144292639 GCGGTGGCTCTGCCCCTCACCGG - Intronic
1049839795 8:144763627-144763649 GCGGTGTTGATGCCCCTGATGGG + Intergenic
1057305310 9:93908930-93908952 GCTGGAGTGCAGCCCCTGATGGG + Intergenic
1060600764 9:124875936-124875958 GCGGGTGTGCTGCACCTCCTTGG + Intronic
1061283305 9:129609528-129609550 GTGGGGGGGCTGCCCCTCCTGGG - Intronic
1062069054 9:134545614-134545636 GAGGGAGTGCTGCCTCTCACCGG - Intergenic
1062582434 9:137234511-137234533 GCGGCCGTCGTGCCCCTCATGGG + Exonic
1200099242 X:153681412-153681434 ACGGGGGTGAAGCGCCTCATCGG - Intronic
1202281965 Y:23199080-23199102 GCGGGTGTGCTGCCACCCATTGG - Exonic
1202283926 Y:23219439-23219461 GCGGGTGTGCTGCCACCCATTGG + Intronic
1202433637 Y:24813465-24813487 GCGGGTGTGCTGCCACCCATTGG - Exonic
1202435602 Y:24833825-24833847 GCGGGTGTGCTGCCACCCATTGG + Intronic