ID: 1071503513

View in Genome Browser
Species Human (GRCh38)
Location 10:86219540-86219562
Sequence AGCAGGGAGAAGGGGAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503513_1071503522 4 Left 1071503513 10:86219540-86219562 CCCCCGCTCCCCTTCTCCCTGCT No data
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503513_1071503526 14 Left 1071503513 10:86219540-86219562 CCCCCGCTCCCCTTCTCCCTGCT No data
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503513 Original CRISPR AGCAGGGAGAAGGGGAGCGG GGG (reversed) Intronic
No off target data available for this crispr