ID: 1071503514

View in Genome Browser
Species Human (GRCh38)
Location 10:86219541-86219563
Sequence GAGCAGGGAGAAGGGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1638
Summary {0: 1, 1: 1, 2: 7, 3: 166, 4: 1463}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503514_1071503526 13 Left 1071503514 10:86219541-86219563 CCCCGCTCCCCTTCTCCCTGCTC 0: 1
1: 1
2: 7
3: 166
4: 1463
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data
1071503514_1071503522 3 Left 1071503514 10:86219541-86219563 CCCCGCTCCCCTTCTCCCTGCTC 0: 1
1: 1
2: 7
3: 166
4: 1463
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503514 Original CRISPR GAGCAGGGAGAAGGGGAGCG GGG (reversed) Intronic
900195777 1:1374880-1374902 GCGGAGGGAGAAGGGAAGCGAGG - Exonic
900386361 1:2412731-2412753 GCGCAGGGCGGAGCGGAGCGGGG + Intronic
900391557 1:2436113-2436135 GAGCAGGGAGGAAGGGAGGAGGG - Intronic
900391572 1:2436157-2436179 GAGCAGGGAGGAAGGGAGGAGGG - Intronic
900391598 1:2436243-2436265 GAGGAGGGAGGAGGGGAGGAGGG - Intronic
900391680 1:2436477-2436499 GAGGAGGGAGGAGGGGAGGAGGG - Intronic
900427393 1:2586840-2586862 GAACAGGGAGTCGGGGAGCCGGG + Exonic
900622263 1:3592926-3592948 GGGCAGGGAGCAGGGGAGGGTGG - Intronic
900862277 1:5242143-5242165 GAGCAGGGAGGAGGGGGGTCTGG + Intergenic
900892328 1:5458454-5458476 GAGAAGGGAGGAGGGAAGGGAGG - Intergenic
900923958 1:5691599-5691621 GAGCAGGAGGAAGAGGAGGGAGG - Intergenic
900929977 1:5730279-5730301 GAGCAGGGAGAGAGGGAGCAAGG + Intergenic
900932859 1:5747729-5747751 GAGGAGGGAGAAAGGAAGGGAGG + Intergenic
901005106 1:6167825-6167847 GAGCAGGGAGTGGGGCAGGGAGG + Intronic
901037118 1:6343069-6343091 GGGCAGGGAGCAGGTGAGGGAGG + Intronic
901135421 1:6989919-6989941 GAGCAAGGAGAATGGGGGAGTGG + Intronic
901166396 1:7224771-7224793 GAGCAGGGCCCTGGGGAGCGGGG - Intronic
901182632 1:7352141-7352163 AAGCAGGGAGAAGAAGAGGGAGG + Intronic
901237963 1:7677692-7677714 GTGCTGGGAGGAAGGGAGCGTGG - Exonic
901342745 1:8510046-8510068 GAGGAGGAAGAAGGGGAGAAAGG + Intronic
901648464 1:10729080-10729102 CAGCTGGGGGAAGGGGAGTGGGG + Intronic
902163396 1:14550754-14550776 GAGTAGGGGGAAGGGGAGAGGGG - Intergenic
902219880 1:14958088-14958110 GAGCAGGCAGAGGGGGAGCAGGG - Intronic
902360941 1:15942321-15942343 GTGCAGGAAGAAGGTGAGGGGGG - Exonic
902390143 1:16098991-16099013 GAGAAGGGAGAGGAGGAGAGGGG + Intergenic
902783003 1:18716611-18716633 GATCAGGGAGACGGTGAGCAAGG - Intronic
902982085 1:20131481-20131503 GGGCTGAGAGAAGGGGAGAGTGG - Intergenic
902987692 1:20165117-20165139 GAGCAGGGAGGCTGGGAGAGTGG - Intronic
903031159 1:20465319-20465341 GAGGAGGGAGGAGGGAAGTGGGG - Intergenic
903482341 1:23662990-23663012 GAGCTGGGAGAGGGTGAGGGTGG - Intergenic
903539721 1:24090126-24090148 GAGAAGGGAGCATGGGAGGGTGG + Intronic
903953546 1:27010407-27010429 GGGCGGGGAGAGGGGGAGGGTGG - Intronic
904329595 1:29749564-29749586 GGGCAGGAAGGAGGGGAGAGAGG + Intergenic
904340387 1:29830349-29830371 GAGGAGGGAGAATGTGGGCGAGG + Intergenic
904535793 1:31198689-31198711 GGGCAGGGGGAAGGGCAGCAGGG - Intronic
904813969 1:33181767-33181789 GAGCTGGGAGAAGGGGATCCCGG + Intronic
905092020 1:35437315-35437337 AAGGAGGGAGAAGGGAAGAGAGG - Intronic
905136956 1:35807765-35807787 GAGGAGGGAGGAGGGAGGCGAGG + Intergenic
905277611 1:36828954-36828976 GAGCAGGAAGAATGGCAGGGAGG - Intronic
905315421 1:37079755-37079777 GAGGAGGGAGAGGGAGAGGGAGG - Intergenic
905323491 1:37133886-37133908 GAGGAGGGAGAGGAGGAGAGAGG + Intergenic
905538670 1:38743060-38743082 GAGCTGGGAGAATGGGAGGATGG - Intergenic
905648218 1:39639500-39639522 GAGCAGGCGGAGGGCGAGCGGGG - Intronic
905942915 1:41878674-41878696 GAGGAGGGAGGAGGGAAGGGAGG - Intronic
905966377 1:42100874-42100896 AAGAAGGGAGGAGGGGAGAGGGG + Intergenic
906020024 1:42619790-42619812 GAGCAGGTGGATGGGGGGCGGGG - Intronic
906953595 1:50353998-50354020 GAGCAGGGAAAACGGAGGCGAGG - Intergenic
906964262 1:50441194-50441216 GTGCAGGGGGTAGGGGAGGGTGG + Exonic
907294056 1:53438569-53438591 GAACAAGGAGAAGGGCATCGCGG - Intergenic
907317685 1:53582899-53582921 GAGCAGGTAGAAGGGGTACTGGG + Intronic
907404350 1:54244742-54244764 AAGCAGGGAGCAGGGAAGCAAGG - Intronic
907585721 1:55616045-55616067 GTGCAGGGGGTAGGGGAGAGAGG + Intergenic
907900954 1:58741008-58741030 GAACAGAAAGAAGGGGAGAGGGG + Intergenic
908513800 1:64872015-64872037 GAGGAGGGTGATGGGGAACGAGG - Intronic
909075487 1:71047005-71047027 CAGCAGGGCGAAGGCGAGCACGG + Exonic
909144050 1:71906237-71906259 GAGAAGGGGGAAAGGGAGTGAGG + Intronic
909174346 1:72336869-72336891 GAGTAGGGAGAGAGGGAGAGAGG - Intergenic
909897738 1:81094081-81094103 AAGAAGGGAGGAGGGGAGGGAGG + Intergenic
911210992 1:95137721-95137743 GAGAAGGAAGAAAGGGAGGGAGG - Intronic
911871877 1:103108729-103108751 GAGGAGGGAGGAGAGGAGTGGGG - Intergenic
911891302 1:103375801-103375823 GGGCTGGGAGAAGAGGAGTGGGG - Intergenic
912028785 1:105212729-105212751 GGGCAGTGAGAAGGGGGGCAGGG + Intergenic
912382202 1:109253732-109253754 GAGCTGGGGGAAGGGCAGAGAGG + Intronic
912567649 1:110599783-110599805 GTGCTGGGAGAAGGGGAGCCTGG + Intronic
912568596 1:110606394-110606416 CAGCAGCGAGAGGGGGAGCCTGG + Intronic
912589171 1:110797316-110797338 GAGGAGAGAGAAGGGGAGGAGGG + Intergenic
912904496 1:113689607-113689629 GGGCAGGGAGAAGGGATGCAGGG + Intergenic
912950650 1:114118187-114118209 GAGCAGGGGGAAGGGAGGCCTGG - Intronic
913214820 1:116611355-116611377 GTGCAGGGAGAAGGCATGCGAGG - Intronic
913344329 1:117793013-117793035 GAGCAGGGGGAAGGTGGGGGTGG + Intergenic
913963686 1:143357575-143357597 GAGGAGGGGGAAGGGGAGGGTGG - Intergenic
913969450 1:143403417-143403439 GGGCAGGGAGCAGGGTAGAGGGG - Intergenic
914058045 1:144183164-144183186 GAGGAGGGGGAAGGGGAGGGTGG - Intergenic
914121100 1:144783201-144783223 GAGGAGGGGGAAGGGGAGGGTGG + Intergenic
914428344 1:147599454-147599476 GCGGAGGGGGAAGGGCAGCGTGG - Intronic
914918390 1:151831818-151831840 GAGCAGGGCCCAGGGGAGGGAGG + Exonic
915118685 1:153615524-153615546 GAGCAGGGGGTGGGGGAGAGGGG - Intronic
915330488 1:155108814-155108836 GAGAAGGGAGGAAGGGAGGGAGG - Intergenic
915557835 1:156670109-156670131 GAGGAGGGAGAAGAGGAGTGTGG - Exonic
915624475 1:157106417-157106439 GAGGAGGAAGTAGGGGAGTGGGG - Intergenic
916015434 1:160745343-160745365 GGGGATGGAGAAGGGGAGTGAGG + Intronic
916166383 1:161970309-161970331 GAGCCGGGAGAAGGAGAGAGGGG + Intergenic
916495863 1:165346020-165346042 GGGGAGGGAGAAGGGGACAGAGG + Intronic
916876742 1:168977700-168977722 GGGCAGGGAGATGTGGAGCGTGG + Intergenic
917444081 1:175091987-175092009 GGGCAGGGAGATGGGGTGGGAGG + Intronic
917678205 1:177340244-177340266 GAGGAGGGAGAAGAGGAGGAGGG + Intergenic
917725223 1:177821378-177821400 AAGGAGGGAGAAGGGGAGGCAGG + Intergenic
917782483 1:178412903-178412925 CAGCAGGGAGAAGGGAAAGGAGG + Intronic
917839398 1:178965202-178965224 GAGAAGGAAGAAGGGGAGAGAGG - Intergenic
917985791 1:180317337-180317359 GGGCAGGGAGGAGGGAAGCATGG + Intronic
918043621 1:180928052-180928074 GAGGAGGGAGAAAGGGCCCGGGG - Intronic
918063700 1:181085103-181085125 CAGCAGTGAGAAGAGGAGCCAGG + Intergenic
918125799 1:181582301-181582323 CAGCAGGAAGGAGGGGAGGGAGG + Intronic
918135926 1:181673907-181673929 GAGCAGGGTGAAGGGCAGCAAGG - Intronic
918149107 1:181782860-181782882 TTGGTGGGAGAAGGGGAGCGGGG + Intronic
918586339 1:186193212-186193234 GAGAAGGGAGGAAGGGAGGGAGG + Intergenic
918682215 1:187369535-187369557 GAGCAGAGGGAGGGGGAGAGAGG + Intergenic
919429165 1:197471491-197471513 CAGCAGGGAACAGGGGAGGGAGG - Intronic
919434825 1:197544950-197544972 GAGAAGGGAGAAGGAGAAGGAGG + Intronic
919727987 1:200896040-200896062 GAGCTGGGAGAAGGGGAAGCTGG + Intronic
919833113 1:201555851-201555873 GTGAAGGGAGATGGGGGGCGGGG + Intergenic
919837641 1:201586663-201586685 GAGCAGGGAGAGAAGGAGAGAGG + Intergenic
919845034 1:201636620-201636642 GCCCAGGGAGGAGGGGAGAGCGG + Intronic
919932302 1:202229294-202229316 GGGCAGGGAGAAGGAGAAGGGGG - Intronic
920065877 1:203269349-203269371 GGGCAGAGAGAAGGGCAGCTGGG - Intronic
920274409 1:204793298-204793320 GAGCTGGGAGTAGGGGAGTGAGG + Intergenic
920366386 1:205450329-205450351 GAGAAAGGAGATGGGGAGGGAGG - Intronic
920394825 1:205637273-205637295 AAGCAGGGAGAAGCTGAGAGAGG - Intergenic
920670912 1:208003089-208003111 GAGCAGGGAAAAGTGGAGAGAGG + Intergenic
920777009 1:208948707-208948729 GAGAAGAGAGAAGAGGAGAGGGG + Intergenic
920903505 1:210136314-210136336 GAGTAAGGAGAAAGGGAACGGGG + Intronic
921023743 1:211259329-211259351 GCGGAGGGAGGAGGGGAGAGAGG + Intronic
922179004 1:223219102-223219124 TAGCAAGGAGAAAGGGAGCTGGG + Intergenic
922723282 1:227909787-227909809 GAGGAGGCAGGAGGGGAGGGAGG + Intergenic
922723313 1:227909868-227909890 GAGGAGGCAGGAGGGGAGGGAGG + Intergenic
922901315 1:229138901-229138923 GAGGAGAGGGAAGGGGAGGGTGG - Intergenic
923030998 1:230249020-230249042 GAGGAGAGAGAAGGGGACTGGGG - Intronic
923051372 1:230393250-230393272 GAGCAGGGAAAAGGGGGAGGAGG + Intronic
923082147 1:230668247-230668269 AAGGAGGGAGAAGGGGAAAGGGG + Intronic
923082150 1:230668254-230668276 GAGAAGGGGAAAGGGGAGAGGGG + Intronic
923414765 1:233745845-233745867 GAGGATGGAGAAGGAAAGCGAGG + Intergenic
923482368 1:234397294-234397316 GAGGAGGGGGAAGGGGAGAAAGG + Intronic
923482576 1:234397730-234397752 GAGGAGGGAGAAGAGGGGGGAGG + Intronic
924035639 1:239933797-239933819 AAGAAGGGAGGAGGGGAGGGAGG + Intergenic
924474060 1:244367891-244367913 GAGGAGGAAGCAGGGGAGAGAGG - Intronic
924622248 1:245672265-245672287 GAGCAGGGAGCAGGGGTGGAAGG + Intronic
1062800522 10:376217-376239 GAGCAGCGAGATGGGGACCCAGG + Intronic
1062841925 10:679124-679146 GCGCAGGGAGGATGGGTGCGGGG - Intronic
1062841989 10:679312-679334 GCGCAGGGAGGATGGGTGCGGGG - Intronic
1062916143 10:1242333-1242355 GAGGAGGGAGACGGGGGCCGTGG - Intronic
1063197795 10:3759440-3759462 AGGGAGGGAGAAGGGGAGGGAGG + Intergenic
1063280916 10:4628474-4628496 GAGGAGAGGGAAGGGGAGCCCGG - Intergenic
1063429609 10:5977377-5977399 GAGCTGGGAGCAGGGGCGCCCGG - Intronic
1063450199 10:6145560-6145582 GGGCACGGAGAGGGGCAGCGCGG + Intronic
1063484025 10:6402486-6402508 GAGCAGGGAGATGCGGAGTCAGG - Intergenic
1063605715 10:7521234-7521256 AAGCAGTGAGAAGGGGTGCCAGG + Intergenic
1063859708 10:10294511-10294533 TAGCAGGGAGTAGAGGAGCTTGG + Intergenic
1063938938 10:11107788-11107810 GAGGAGGGAGAAGAGGAAAGGGG - Intronic
1064131457 10:12713598-12713620 GAGCAGGGAGAAAGGAAGAAAGG + Intronic
1064272701 10:13879764-13879786 GAGGAGGAAGAAGGGGAAGGAGG - Intronic
1064370650 10:14749531-14749553 GACCAGGGAGAAAGGGTGCTAGG - Intronic
1064526304 10:16260362-16260384 GAGAAGGTAGAAGGGAAGGGAGG + Intergenic
1064628528 10:17285732-17285754 GAGAAGGGAAAGGGGGAGGGAGG + Intergenic
1065550447 10:26863928-26863950 GAGGAGGGAGAGAGGGAGCGGGG + Intergenic
1065667207 10:28075093-28075115 GAGCAGGAAGAAGGGGAAGAGGG + Intronic
1065765623 10:29026889-29026911 GAGAAGGTAGAAAGGGAGGGAGG + Intergenic
1065973979 10:30826767-30826789 GAGGAGTGAGAAGGGGAGGCAGG - Intronic
1066413362 10:35195461-35195483 GAGTGGGGAGGAGGGGAGGGAGG - Intronic
1066439648 10:35426075-35426097 GTGAAGGGAGAAGAGGAGCCAGG - Intronic
1067116215 10:43437224-43437246 GGGCTGTGAGAGGGGGAGCGTGG + Exonic
1067142677 10:43669755-43669777 GAGCTGGGAGAAGGGAAGGGAGG + Intergenic
1067158054 10:43799430-43799452 GAGCAAGGAGAAGGGTGGCAAGG + Intergenic
1067286314 10:44910003-44910025 GGGGAAGGAGAAGGGGAGGGAGG + Intergenic
1067441917 10:46313304-46313326 GAGCAGGGACCAGGTGAGCTAGG + Exonic
1067545433 10:47189402-47189424 AAGCAGGGAGAAGGGGTGGAGGG + Intergenic
1067783620 10:49227017-49227039 GAGCAGGTGGAAGGAGAGTGGGG + Intergenic
1067789619 10:49277854-49277876 GAGGAGGCAGATGGGGAGAGGGG + Intergenic
1067933646 10:50589051-50589073 GATCAGGGAGAAGGTGAGGCTGG + Intronic
1068777455 10:60883489-60883511 GAGTAGGGAGAAGTTGATCGAGG - Intronic
1068841153 10:61615776-61615798 GAGCAGGGAGAGAGGGAGAGGGG - Intergenic
1068891353 10:62151293-62151315 GAGCAGGAGGAAGGGGATGGGGG - Intergenic
1069063235 10:63915782-63915804 CAGCAGGGAAAAGGGAAGCAAGG - Intergenic
1069397615 10:68007067-68007089 GAGGAGGTAGAAGGAGAGAGAGG - Intronic
1069878622 10:71578177-71578199 GAACAGGGAGAAGAGGTGCTGGG + Intronic
1070225878 10:74505030-74505052 GAGCAGGCTGAAGAGGAGGGTGG + Intronic
1070521774 10:77260127-77260149 GAGCAGGAAGAAGAGCACCGCGG + Intronic
1071086785 10:81875130-81875152 GGGCGGGGAGGAGAGGAGCGGGG - Intergenic
1071444891 10:85736269-85736291 AAGGAGGGAGGAGGGGAGAGAGG + Intronic
1071481459 10:86067993-86068015 AAGCAGGGAGAAAAGGAGAGGGG + Intronic
1071489363 10:86125666-86125688 GAGGAGGGATAAGGGGAGGAAGG - Intronic
1071503514 10:86219541-86219563 GAGCAGGGAGAAGGGGAGCGGGG - Intronic
1072100709 10:92226826-92226848 GAGCTGGGAGAAGGGGCCTGTGG + Intronic
1072443701 10:95479634-95479656 GACCAGGGTGATGGGGAGAGAGG + Intronic
1072457298 10:95588024-95588046 GAGCAGGGAGTGGGGAAGAGAGG - Intergenic
1072537535 10:96374880-96374902 GAGATGGGATAAGGTGAGCGGGG + Intronic
1072681964 10:97514183-97514205 GAGCAGGCAGGATGGGAGCCTGG + Intronic
1073283846 10:102375322-102375344 GGGCAGGGAGCGGGGAAGCGGGG - Intronic
1073533432 10:104253956-104253978 GAGCAGGCAGTAGGGGAAAGTGG + Intronic
1073564344 10:104522336-104522358 GAGCAGGGAGAAGAGGGGCGAGG + Intergenic
1073649093 10:105339967-105339989 GAGGGAGGAGAAGGGGAGGGAGG - Intergenic
1074081258 10:110169821-110169843 GAGGAGGGGGTAGGGGAGAGAGG - Intergenic
1074214696 10:111372959-111372981 GAGCAGGGAGAAAGACAGCACGG - Intergenic
1074908636 10:117887143-117887165 CAGGAGGGAGAAGGGGAGAGGGG - Intergenic
1075247531 10:120836478-120836500 GAGCAGGGTGAGGGGGAAAGAGG + Intergenic
1075273743 10:121075670-121075692 GAGAAGGGAGAAAGGGAGAGAGG - Intergenic
1075576326 10:123580382-123580404 GAGCAGGGAGAGGGTCAGGGAGG - Intergenic
1075585441 10:123653798-123653820 GAGAAGGGGGAAGGGGGGAGGGG + Intergenic
1075858983 10:125657389-125657411 GAGTAGGGAGAAGAGGAGAGTGG + Intronic
1075896582 10:126001573-126001595 AAGGTGGGAGAAGGGGAGAGTGG - Intronic
1075993047 10:126854139-126854161 AAGGAGGGAGAAGAGGAGCTTGG + Intergenic
1076230132 10:128813418-128813440 GAGCAGGGAGAGAGGGAGGGAGG + Intergenic
1076290549 10:129342486-129342508 AAGGAGGGAGAAAGGGAGAGAGG + Intergenic
1076365420 10:129918640-129918662 GGGCAGGGAGCTGGGGAGGGGGG - Intronic
1076409295 10:130234557-130234579 GAGCAGTGAGAAGGGGGCCCAGG - Intergenic
1076442616 10:130490799-130490821 GAGCAGGAAGGAGGAGAGAGAGG - Intergenic
1076444868 10:130507477-130507499 TAGCAAGGAGAAGGAGAGGGCGG + Intergenic
1076522328 10:131089061-131089083 GGGCAGGCAGCAGGGGAGAGGGG + Intergenic
1076554140 10:131311303-131311325 GAGCGCGGGGAAGGGGTGCGCGG + Exonic
1076571957 10:131438905-131438927 GTGGAGGGAGAAGGGAAGAGAGG - Intergenic
1076626495 10:131824404-131824426 CAGTAGGGAGAAGGGGAGGGAGG - Intergenic
1076635750 10:131880862-131880884 AAGGAGGGAGAAGAGGAGCCTGG - Intergenic
1076695711 10:132246381-132246403 GAGCAGGGTGGAGGGGAACCAGG - Intronic
1076746586 10:132517664-132517686 GCGCAGGAAGAAGGGGCGTGTGG - Intergenic
1076792619 10:132785270-132785292 GAGCCAGGTGAAGGTGAGCGCGG - Exonic
1076835147 10:133017188-133017210 GAGCGTGGCGACGGGGAGCGTGG - Intergenic
1076835151 10:133017203-133017225 GAGCGTGGCGACGGGGAGCGTGG - Intergenic
1077227454 11:1444647-1444669 GCGGAGGGAGAGGGGGAGGGAGG - Intronic
1077236305 11:1483568-1483590 GAGCAGGGAGGAGGGAGGTGAGG - Intronic
1077258302 11:1599721-1599743 GAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1077282407 11:1751603-1751625 AAGGAGGGAGATGGGGAGAGTGG + Intronic
1077295936 11:1826350-1826372 GAGCAAGTAGAAAGGGGGCGGGG + Intergenic
1077538911 11:3137471-3137493 GTGCGGGGAGCAGGGGAGCAGGG + Intronic
1077788199 11:5408371-5408393 AAGAAGGGAGAAAGGGAGGGAGG - Intronic
1078362911 11:10683530-10683552 GGGCAGGGAGAAAGGGAAGGAGG - Intronic
1078390533 11:10932043-10932065 GGGCAGGGAGGAGGGGAAGGAGG + Intergenic
1078507028 11:11959878-11959900 AAGCAGAGGGAAGGGGAGCTTGG - Intergenic
1078840560 11:15073096-15073118 GGGGAGGGAAAAGGGGAGGGAGG - Intronic
1079190044 11:18269640-18269662 GAACAGGGAGAATGGGAGGGTGG + Intronic
1079322295 11:19461253-19461275 GACCAGGGAGAGGGGAGGCGGGG - Intronic
1079359497 11:19758643-19758665 GAGCAGGTTGCAGGGGAGCGGGG + Intronic
1079662500 11:23057496-23057518 GAGTAGGGAGTAGGGAGGCGAGG + Intergenic
1079809769 11:24982617-24982639 GAGAAGGGAGAAGAGTAGAGTGG + Intronic
1080463853 11:32478947-32478969 GAGCAGGGTTGAGGGGAGCTGGG + Intergenic
1081106364 11:39075019-39075041 GAGGGGGGAGAAGGAGAGAGAGG - Intergenic
1081286669 11:41278972-41278994 GAACAGGGAGGATGGGAGAGGGG - Intronic
1081964680 11:47162278-47162300 GAGAAGGGAGAGGGGGAGTTTGG + Intronic
1082669798 11:56020893-56020915 GAGGAGGGAGGAGGAGAACGAGG + Intergenic
1082748860 11:56996889-56996911 TAGCAGGGATAAGGGGAGAAGGG + Intergenic
1082928879 11:58579132-58579154 GAGCCGGGCGGAGGGGAGGGGGG + Exonic
1082996869 11:59262039-59262061 GAGCAATGGGTAGGGGAGCGGGG + Intergenic
1083129437 11:60610656-60610678 AACCAGGGAGAAAGGGAGAGAGG + Intergenic
1083187125 11:61024240-61024262 AAGGAGGGAGAAAGGGAGGGAGG - Intergenic
1083692096 11:64415531-64415553 GAGGAGGTGGGAGGGGAGCGTGG + Intergenic
1083745978 11:64736718-64736740 GGGCAGGGAGGTGGGGAGCTGGG - Intronic
1083932411 11:65853182-65853204 GAGCAGGGGTGTGGGGAGCGAGG + Intronic
1083944280 11:65915491-65915513 GAGCGGGGACAAGAGGAGGGTGG + Intergenic
1084087046 11:66859556-66859578 GAGCTGGGAGCACGGGAGTGGGG + Intronic
1084148062 11:67275475-67275497 GGGCAGGAAGAAGGGGAAGGGGG - Intronic
1084209189 11:67613140-67613162 CTGCAGGGAGAAGGGCAGAGAGG + Intergenic
1084393234 11:68892093-68892115 GAGGGTGGAGAAGGGGAGCGAGG + Intronic
1084571669 11:69963426-69963448 GAGGAGGGGGAAGGGGGGAGGGG + Intergenic
1084582543 11:70032894-70032916 GAGAAGGGAGAAAGGGAGGAAGG + Intergenic
1084590411 11:70086802-70086824 GAGTAGGGTGAAGGGGAGGGAGG - Intronic
1084635210 11:70387626-70387648 GAGCAGGGAGAAAGAGAGGAAGG - Intergenic
1084691930 11:70732593-70732615 GAACAGCAAGAAGGGCAGCGCGG - Intronic
1084735688 11:71103849-71103871 GGAGAGGGAGAAGGGGAGGGGGG - Intronic
1085026871 11:73241497-73241519 GAGCAGGGAGCATGGGTGGGAGG - Intergenic
1085082364 11:73645742-73645764 GAGCAGGGAGAGCTGGAGAGAGG + Intergenic
1085116911 11:73937730-73937752 GAGACGGGAGAGGGAGAGCGAGG + Intergenic
1085282880 11:75342320-75342342 GAGCAGAGGGAAGGGGGGTGAGG - Intronic
1085299525 11:75450093-75450115 GAGCAGGGCAGAGGGGAGGGAGG + Intronic
1085409624 11:76283415-76283437 GAGAAGGGGGAAGGGGAGGGAGG + Intergenic
1086525381 11:87719402-87719424 GAGCAGGGAGGAGGTAAGGGAGG - Intergenic
1086813708 11:91342429-91342451 GAGAGGAGAGAAGGGGAGTGTGG + Intergenic
1087666319 11:101053504-101053526 AAGGAGGGAGAAGGGGAGGGAGG - Intronic
1087699616 11:101420896-101420918 GAGCAGGAGGAAGGGGAGAGAGG + Intergenic
1087774316 11:102243552-102243574 GAGGAGGGAGAAGGGGGAAGGGG + Intergenic
1088825153 11:113487830-113487852 GAGCAGGGTGAAGGGCAGAAAGG - Intergenic
1088891844 11:114050751-114050773 GAGCAGGCAAATGGAGAGCGAGG - Intergenic
1089083689 11:115798956-115798978 GAGCAGGGAGGATGGGAGCAGGG - Intergenic
1089109023 11:116040062-116040084 GAGAAGGGAGGGGGGGAGAGAGG - Intergenic
1089327714 11:117668769-117668791 GAGTAGAGAGAAGAGAAGCGAGG + Intronic
1089506915 11:118969528-118969550 GAGAAGGGAGGAGGGAAGGGAGG + Intergenic
1089567956 11:119382000-119382022 GCCCAGTGAGAAGGGGAGTGGGG - Intergenic
1089610809 11:119667486-119667508 GTGCAGGGTGCAGGGGAACGGGG + Intronic
1089852878 11:121515507-121515529 GAGCAGGGAGGAGGCCAGGGTGG + Intronic
1089853109 11:121517231-121517253 GGGCTGGGAGAAGGGGACGGTGG - Intronic
1089910948 11:122100480-122100502 GAGGACGGAGAACGGGGGCGGGG + Intergenic
1090116216 11:123977149-123977171 GAGCAGGCGGAAGGTGAGGGAGG + Exonic
1090186031 11:124739841-124739863 GGGCGGGGAGAAGTGGAGGGAGG - Exonic
1090279832 11:125446119-125446141 GAGAAGAGAGGAGGGGAGAGCGG + Intronic
1090575626 11:128099712-128099734 GAGCAGCAAGAAGTGGAGCAGGG - Intergenic
1090697552 11:129263596-129263618 GAGGAGGAAAATGGGGAGCGGGG + Intronic
1090868948 11:130726124-130726146 GAGCCTGGAGAAGGGGTGCCTGG - Intergenic
1091091688 11:132777029-132777051 GTGCATGGAGAAGGGTAGTGTGG - Intronic
1091124391 11:133082480-133082502 GGGAAGGGAAGAGGGGAGCGTGG - Intronic
1091218812 11:133918942-133918964 GGGCAGGGGGAGGAGGAGCGGGG + Intronic
1091286683 11:134412075-134412097 GGGCAGGGAGGCGGGGGGCGGGG + Intergenic
1091460828 12:642726-642748 GAGCCGGGAAAAGGTGAGGGCGG + Intronic
1091460959 12:643122-643144 GCGCAGGCAGCAGGGGAGCCGGG - Intronic
1091701647 12:2667282-2667304 GAGGAGGGAGAAAAGGAGCGTGG - Intronic
1091797447 12:3305417-3305439 GAATAGGGAGCAGGGGAGGGGGG - Intergenic
1091813656 12:3419989-3420011 GAGAGGGGAGAGGGGGAGAGAGG + Intronic
1091823318 12:3492027-3492049 GAGGAGAGGGCAGGGGAGCGCGG - Intronic
1091829493 12:3539673-3539695 GAGCAGGGAGAAGGAGATGGGGG - Intronic
1091995894 12:4993752-4993774 GACCAGGGAGACTGGGAGCTGGG - Intergenic
1092092284 12:5812739-5812761 GGGAAGGGAGGAGGGGAGGGAGG + Intronic
1092165576 12:6340598-6340620 GAGCAGAGAGGAGGGGAAGGAGG + Intronic
1092169131 12:6362407-6362429 GAGCATGGACCAGGGGAGCATGG + Intronic
1092222108 12:6721491-6721513 GAGGAAGGAGAAGGGGACAGAGG - Intergenic
1092228883 12:6766263-6766285 GAGCGGGGAGGAGAGGAGAGGGG - Intronic
1092535077 12:9379486-9379508 GAGCAGTGGGAAGGGCAGTGAGG + Intergenic
1093080323 12:14803237-14803259 AACCAGGGAGAGGAGGAGCGGGG + Intronic
1093094546 12:14957881-14957903 GAGAAGGGAGAAAGAGAGAGAGG + Intronic
1093409317 12:18845503-18845525 CAGCTGGGAGATGGGGAGCCTGG - Intergenic
1093523334 12:20076070-20076092 GAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1093719522 12:22422992-22423014 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1093720019 12:22429632-22429654 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1094041074 12:26122465-26122487 GGGCAGGCAGAAGGGGGCCGCGG + Exonic
1094155799 12:27335728-27335750 GAGGAGGGAGAAGGCAAGAGAGG + Intronic
1094772751 12:33684483-33684505 GAAGAGGGAGAAGGGGAAGGGGG - Intergenic
1094786796 12:33858702-33858724 GAGTAGGGGGAAGGGGATTGTGG - Intergenic
1095422310 12:42037902-42037924 GGGCAGGGAGCAGGGAAGTGGGG + Intergenic
1095944396 12:47745879-47745901 GAGCAAGGAGAAGCGGAGGTGGG + Intronic
1096065859 12:48739662-48739684 GAGAAGAGAGAAGGGGTGGGTGG + Intergenic
1096077238 12:48813576-48813598 GAGAAGGGAGGTGGGGAGAGAGG - Intergenic
1096478783 12:51924341-51924363 GAGTGGGGAGAAGGGCAGTGGGG + Intergenic
1096489573 12:52006492-52006514 GGGCAGGGAGAGCGGCAGCGGGG - Intergenic
1096589276 12:52646706-52646728 GGGAAGGGAGAAGGGGACCCTGG - Intronic
1096595030 12:52689545-52689567 GAGGAGGGAGAAGAGGAGGAAGG + Intergenic
1096783456 12:54004038-54004060 GAACTAGGAGAAGGGGATCGAGG - Intronic
1096980882 12:55727877-55727899 GAGGAGGGAAAGGGGGAGAGGGG + Intronic
1097057190 12:56257378-56257400 GAGCAGGGAGTATGGGCGCGGGG + Intronic
1097092947 12:56521930-56521952 AGGGAGGGAGGAGGGGAGCGAGG - Exonic
1097124972 12:56766787-56766809 GAGAAGGGAGAGGAGGAGCTGGG + Intronic
1097173198 12:57128699-57128721 GAGCAGCGAGGAGTGAAGCGGGG + Exonic
1097791672 12:63821919-63821941 GAGCTGGGGGAAGGTGAGCGGGG - Intergenic
1098166088 12:67699542-67699564 GAGCTGGGAGAAGGAGGGCAAGG - Intergenic
1098285387 12:68901875-68901897 GAGGAGAGAGAAGGGGAGAGGGG + Intronic
1098286966 12:68917088-68917110 GAGAAAGGAGAAGGTGAGTGTGG - Intronic
1099046642 12:77728837-77728859 AAGCGGGTAGAAGGGGAGCCAGG - Intergenic
1099304562 12:80937584-80937606 GGGAAGGGAGGAGGGGAGAGGGG + Intronic
1099558567 12:84143952-84143974 GAACAGGGAGAAGGTGATTGTGG - Intergenic
1100390961 12:94146527-94146549 GGGCAGGGAGTGGGGGAGCAAGG + Intergenic
1100569784 12:95837078-95837100 GAGGAGAGAGAGGGGGAGGGTGG + Intergenic
1100569829 12:95837276-95837298 GAGGAGGGAGAGAGGGAGAGAGG + Intergenic
1100738225 12:97561940-97561962 GAGGAGGGAGAAAGGAAGCAAGG + Intergenic
1101253760 12:102957987-102958009 GCGAAGGGAGGAGGGGAGGGAGG + Exonic
1101411555 12:104472933-104472955 GAGCAGGGAGTGGGGCAGTGAGG + Intronic
1101673368 12:106896748-106896770 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
1101709576 12:107252699-107252721 GAGGAGGGAGAAGGGAAGGAAGG - Intergenic
1101864654 12:108511558-108511580 TAGCAGGGAGAAGGGCTGCTGGG + Intergenic
1101966287 12:109284407-109284429 GGGCTGGGAGGAGGGGCGCGTGG + Intronic
1101973587 12:109335301-109335323 GAGCAGGGAGCAGGTGTGGGGGG + Intergenic
1102214067 12:111147724-111147746 GAGGAGGGAGAGGGCGAGGGAGG + Intronic
1102275726 12:111580654-111580676 GGGGAGAGAGAAGGGGAGGGAGG + Intronic
1102275737 12:111580678-111580700 GGGGAGAGAGAAGGGGAGGGAGG + Intronic
1102420393 12:112798840-112798862 GAGGAGAGAGAAAGGGAGAGAGG - Intronic
1102587306 12:113932469-113932491 CTGCAGGGAGAAGGAGAGGGAGG - Intronic
1102598739 12:114012871-114012893 GAGGAGGGAGAGGGAGAGGGAGG + Intergenic
1102598750 12:114012903-114012925 GAGGAGGGAGAGGGAGAGGGAGG + Intergenic
1102689685 12:114750596-114750618 GAGGAGGGAGGGAGGGAGCGAGG - Intergenic
1102692837 12:114774863-114774885 GGGCAGGTAGCTGGGGAGCGTGG - Intergenic
1102772042 12:115486455-115486477 GAGCAGAGAGGAGGGGGGCGAGG + Intergenic
1102904448 12:116663330-116663352 GAGCAGGGAGAGGTGGGGAGGGG - Intergenic
1103334349 12:120178034-120178056 GAACAGAGAGGAGGCGAGCGGGG - Intronic
1103425543 12:120830448-120830470 GGGGAGGGGGAAGGGGAGGGGGG + Intronic
1103425559 12:120830477-120830499 GGGGAGGGGGAAGGGGAGGGGGG + Intronic
1103440852 12:120961793-120961815 CAGCAGGGAGGAAGGGGGCGTGG + Intergenic
1103500951 12:121400875-121400897 GAAAAGGGGAAAGGGGAGCGGGG + Intronic
1103509850 12:121466983-121467005 GAGCGGGGCGTAGAGGAGCGCGG - Intronic
1103744613 12:123113848-123113870 GGGCAGGGAGGAGGGGAGGATGG - Intronic
1103767868 12:123295187-123295209 GGGCAGGGAGAAGGGGAAGGAGG + Exonic
1103896622 12:124277690-124277712 GAGAGGGGAGAAGGGGAGAAGGG - Intronic
1104134369 12:125923379-125923401 GAGCAGAGAGGAAAGGAGCGGGG + Intergenic
1104930258 12:132335232-132335254 GAGAAGGGAGAAGTGGTGCCAGG + Intergenic
1104986149 12:132598563-132598585 GAGCGGAGAGGAGGGGCGCGCGG - Intergenic
1104986164 12:132598614-132598636 GAGCGGAGAGGAGGGGCGCGCGG - Intergenic
1105021279 12:132818103-132818125 GAGCATGGAGGAGTGGAGGGGGG - Intronic
1105021289 12:132818136-132818158 GAGCATGGAGGAGTGGAGGGTGG - Intronic
1105344809 13:19561899-19561921 CAGCAGGGAGGAGGGCAGGGCGG - Intergenic
1105780890 13:23704636-23704658 GAGGAGGGAGAAGGAGAGGGAGG - Intergenic
1105890753 13:24680814-24680836 GAGCAGGCTGACGGGAAGCGAGG + Intronic
1106307730 13:28528226-28528248 GAGCGGGGAAATGGGGAGGGAGG + Intergenic
1106415607 13:29543646-29543668 GAGGAGGGAGAAGGGTGGGGAGG + Intronic
1106443221 13:29799199-29799221 GGGCAGGGGGAAGGGGAAGGTGG - Intronic
1106456162 13:29929202-29929224 GAGGAGGGAGGAAGGGAGCCTGG + Intergenic
1106512244 13:30421908-30421930 GAGGAGGGAGAGGTGGGGCGGGG + Intergenic
1106512254 13:30421930-30421952 GAGGAGGGAGAGGTGGGGCGGGG + Intergenic
1106590076 13:31091435-31091457 GAGCAGGGATGCCGGGAGCGGGG - Intergenic
1106793187 13:33177717-33177739 AAGGAGGGAGAAAGGGAGGGAGG + Intronic
1107119746 13:36783171-36783193 GAGAAGGGAGAGAGGGAGGGAGG + Intergenic
1107359549 13:39603418-39603440 ACGCAGGGAGAGGGGGCGCGAGG - Intronic
1107440740 13:40425384-40425406 GAGCAGGGTGAGGTGGAGGGTGG - Intergenic
1107600992 13:42012241-42012263 GAGAAGGGAGCAGGGGACAGAGG - Intergenic
1107755232 13:43614602-43614624 GAGCAGGGAGAGAAGGAGGGAGG - Intronic
1107863728 13:44683477-44683499 GGGGAGGGAGAGGGGGAGGGGGG + Intergenic
1108092094 13:46859624-46859646 GAGCAGGAGGAAGGTGAGGGAGG - Intronic
1108686003 13:52819050-52819072 GAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1108690027 13:52851326-52851348 GAGCTGGGAGCCGGGGAGCCCGG + Intergenic
1109033462 13:57224234-57224256 AAGGAGGGAGAAAGGGAGGGAGG + Intergenic
1109203835 13:59459965-59459987 GAGCAGGCAGATGAGGAGCAAGG + Intergenic
1109272342 13:60268477-60268499 GGGGAGGGGGAAGGGGAGAGAGG + Intergenic
1109405825 13:61898829-61898851 GAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1109895104 13:68676770-68676792 GGGGAGGGGGAAGGGGAGAGGGG - Intergenic
1110219500 13:73058857-73058879 GAGCAGGGAGAGAGGCAGCCAGG - Exonic
1110515848 13:76411461-76411483 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1110515872 13:76411508-76411530 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1110868106 13:80420301-80420323 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1110868143 13:80420430-80420452 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1110868150 13:80420452-80420474 GAGAAGGGAGAAGAGAAGGGGGG - Intergenic
1111048482 13:82846956-82846978 GAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1111048516 13:82847080-82847102 GAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1111053395 13:82915883-82915905 GTGCAGGGAGAAGTGGGGCCTGG + Intergenic
1111757907 13:92421825-92421847 GAGCAGGAGGAAGGTGAGCAGGG + Intronic
1112210082 13:97367719-97367741 GAGCAGAGAGTGGGGGAGGGAGG + Intronic
1112211778 13:97384942-97384964 GAGTAGGGAGAATGGGAGAATGG + Intronic
1112358693 13:98696718-98696740 GAGGTGGGAGAAGGGGTGAGGGG + Intronic
1112550840 13:100418937-100418959 GAGCAGAGAGAAGGGGAGGCCGG - Intronic
1112647412 13:101350293-101350315 GAGCTGGGAGAAGGCCAACGTGG - Intronic
1112748420 13:102553714-102553736 GATGAGGGAGAAGGGGAGAAAGG - Intergenic
1112839118 13:103553668-103553690 GAGGAGGTAGAAGGGGAGACAGG - Intergenic
1113088400 13:106592171-106592193 GAGGAGGTAGAAGGGGAGGCAGG - Intergenic
1113201058 13:107867578-107867600 GAGGAGGGAGAAGGCGCGCGGGG + Intergenic
1113386596 13:109854503-109854525 GAGGAGAGAGAAGGGGGGAGAGG - Intergenic
1113541755 13:111115109-111115131 GGGAAAGGGGAAGGGGAGCGGGG - Intronic
1113655635 13:112066752-112066774 GAGCGGGGAGGAGGGGAGGAAGG - Intergenic
1113755381 13:112807831-112807853 GAGCAGAGAGAAGGGGCGCGGGG + Intronic
1113791574 13:113031600-113031622 GAGCTGGGAGATGGGGAGGAGGG + Intronic
1114318204 14:21525848-21525870 GGGGAGGGAGGAGGGGAGGGGGG + Intronic
1114525743 14:23366073-23366095 GAGCAAAGAGAAGGCGAGGGAGG + Intergenic
1114533713 14:23410381-23410403 GAGCAGGGAGAGAAGGAGCCTGG - Intergenic
1114846890 14:26333208-26333230 GAGCAGTGAGAAGGCCAGGGTGG - Intergenic
1115253471 14:31373777-31373799 GAGCAGGTGGAAGGGGAGGCAGG - Intronic
1115474833 14:33802890-33802912 GAGGAGGGAGAGGGGGAGATGGG - Intronic
1115498248 14:34027365-34027387 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1115498282 14:34027429-34027451 GAGGGGGAAGAAGGGGAGGGGGG + Intronic
1115778001 14:36737404-36737426 GAGCAGAGAGAAGGGAAGTAGGG - Intronic
1117030203 14:51660936-51660958 GAGCAGGGAGAAGGCCACAGTGG + Intronic
1117135338 14:52730088-52730110 GGGCGGGCAGAAGGCGAGCGTGG + Intergenic
1117592170 14:57281830-57281852 GAACATGGAGACGGGGAGCCTGG + Intronic
1117622061 14:57597581-57597603 GAGCAGGAAGAAAGGGAGTGAGG + Intronic
1117781778 14:59240552-59240574 GACAAGGGAGATGGGGAGTGAGG - Intronic
1117922446 14:60739189-60739211 GAGAAGAGAGAAAGGGAGGGAGG + Intronic
1118347598 14:64951243-64951265 GAGCAGGGAGAATGGGAGAGTGG - Intronic
1118538876 14:66801561-66801583 GAGTGGGGAGAGGGGCAGCGGGG - Intronic
1118747551 14:68785177-68785199 AAGCTGGTAGAAGGGGAGCTGGG + Intergenic
1118785864 14:69044868-69044890 CACTAGGGAGAAGGGGAGCCAGG - Intergenic
1118971515 14:70641958-70641980 CAGCGGGGAGAATGGGAGTGCGG + Exonic
1119190152 14:72675996-72676018 GAGAAGGGAGAAGGGGACTCTGG - Intronic
1119309409 14:73633888-73633910 GAGGAGGGAGGAGGGGGGCCCGG - Intergenic
1119516869 14:75255058-75255080 GAGGAGGGAGAAGAGGAAGGAGG + Intronic
1119823978 14:77641923-77641945 GAGAAGGGAGAGCGGGAGCCGGG + Intergenic
1119872646 14:78030152-78030174 GAGCAGGGAGGAGGGGACCCAGG + Intergenic
1119932045 14:78556973-78556995 GGGAAGGGAGAAGGGAAGGGAGG - Intronic
1120187293 14:81406868-81406890 GAGCATGGGGATGGGGAGAGAGG - Intronic
1120484772 14:85099284-85099306 GAGAAGGGAGAAGAGAAGAGAGG + Intergenic
1121181790 14:91934798-91934820 GAGCAGGTGGAAGGGAAGCAAGG - Intronic
1121421801 14:93821180-93821202 GGGCAGGGAGATGGGGACCAGGG - Intergenic
1121698555 14:95933270-95933292 CAGCAGGGAGACAGGGAGCTGGG - Intergenic
1121720842 14:96107660-96107682 CAGCAGGGTGCAGGGGAGTGTGG - Intergenic
1122012160 14:98759182-98759204 GAGGAGGAAGAAAGGGAGGGAGG - Intergenic
1122227783 14:100289980-100290002 GAGCAAGGTGAAGGGGCGGGGGG - Intergenic
1122234181 14:100322792-100322814 GAGCAGAGAGCAGGGAACCGGGG + Intergenic
1122275093 14:100587113-100587135 GCGCAGCGCGGAGGGGAGCGGGG + Intronic
1122278908 14:100609952-100609974 GAGCAGAGAGCAGGGGTGCTTGG - Intergenic
1122599062 14:102912340-102912362 GAGCAGGGAGGAGTGGACCTAGG + Intergenic
1122743360 14:103884432-103884454 GTGCGGGGAGAAGGAGAGTGAGG - Intergenic
1122918848 14:104871350-104871372 GAGCAGAGGGAAGGGGACCCTGG - Intronic
1122947491 14:105019592-105019614 AAACAGGGAGAAGAGGAGCAAGG + Intronic
1123021367 14:105399269-105399291 GAGCAGGGGGAGGTGGGGCGGGG - Intronic
1123022912 14:105410675-105410697 CACCAGGGGGAAGGGGAGAGGGG - Intronic
1123048105 14:105528132-105528154 GTGCAGGGAGGAGGGGCGTGGGG + Intronic
1123068298 14:105628977-105628999 GAGCCGGGAGCAGAGCAGCGAGG - Intergenic
1123164771 14:106315666-106315688 CAGCAGGGAGAGGGTGAGCAGGG - Intergenic
1202856917 14_GL000225v1_random:57763-57785 GGGCAGGGCGAAGGGGTGAGGGG - Intergenic
1123464503 15:20505620-20505642 GAGGGGAGAGAAGGGGAGAGAGG + Intergenic
1123653610 15:22495421-22495443 GAGGGGAGAGAAGGGGAGAGAGG - Intergenic
1123744033 15:23304279-23304301 GAGGGGAGAGAAGGGGAGAGAGG - Intergenic
1124275231 15:28321584-28321606 GAGGGGAGAGAAGGGGAGAGAGG + Intronic
1124307470 15:28590009-28590031 GAGGGGAGAGAAGGGGAGAGAGG - Intergenic
1124378151 15:29141595-29141617 GAGCAGGGAGAGTGGGTGCTGGG - Intronic
1124439539 15:29676020-29676042 GAGCTGAGAGGAGGGGAGGGAGG + Intergenic
1124636508 15:31368056-31368078 GAGCATGGAGAAGAGGGGAGGGG - Intronic
1124651940 15:31480503-31480525 GAGCAGGGAGAAAGGGAAGAAGG - Exonic
1124993587 15:34700368-34700390 GAGAAGGGAGAGGAGGAGGGAGG - Intergenic
1125201023 15:37100762-37100784 GAACAGGGAGAGAGGGAGAGGGG + Intronic
1125223762 15:37370613-37370635 GAGCAGGGAGGATAGGAGGGAGG - Intergenic
1125550119 15:40538690-40538712 GAGCTGGGAGAAGCAGAGGGAGG + Intronic
1125588734 15:40841153-40841175 GAGAAGGAGGGAGGGGAGCGTGG - Intergenic
1125600513 15:40912975-40912997 GAACAGGGAGAAGGAGGCCGTGG + Intergenic
1125931600 15:43604159-43604181 GAGAAGGTAGAAGGAGAGTGGGG + Intronic
1125944704 15:43703639-43703661 GAGAAGGTAGAAGGAGAGTGGGG + Intergenic
1126109106 15:45165516-45165538 GAGCAGGGAGAAGAGGGCTGAGG - Exonic
1126238746 15:46416830-46416852 GAGCAGGAAGAGTGGGAGTGGGG - Intergenic
1126704838 15:51397405-51397427 TAGAAGGGGGAAGGGGAGAGAGG - Intronic
1126778433 15:52119023-52119045 GAGCTGGGGGAAGGGGAATGGGG + Exonic
1127117875 15:55744884-55744906 GAACAGGGAGAAGGGGAAGGGGG - Intergenic
1127278286 15:57466992-57467014 GATGAGGGAGAAGAGGAGGGAGG + Intronic
1128134748 15:65254543-65254565 CAGTAGAGAGGAGGGGAGCGGGG + Intronic
1128304134 15:66586988-66587010 GAGAAGGGGGAAGGGAAGTGGGG - Intronic
1128326160 15:66725596-66725618 GAGCAGGGAGAAGCTGGGCTGGG + Intronic
1128360682 15:66959466-66959488 GAGCAGGGACAGGAGGAGCAAGG + Intergenic
1128368027 15:67018489-67018511 GAGGAGGGCAAAGGGGAGGGAGG - Intergenic
1128557468 15:68641481-68641503 GAGCAGGGAAAAGGAGAAGGGGG + Intronic
1128582504 15:68819376-68819398 GAGGAGGGGGAAGGTGAGGGTGG - Intronic
1128634922 15:69297087-69297109 GAGGAGGGGGAAGGGCAGGGAGG - Intergenic
1128637791 15:69314293-69314315 CAGGAGGGAGAAGGGCAGCTGGG - Intronic
1128672656 15:69586177-69586199 AACCAGGGGGAAGGGGAGGGAGG - Intergenic
1128731804 15:70026369-70026391 GAGCAGGGAGAATGGGGGGTGGG - Intergenic
1128791926 15:70440168-70440190 GAGCGTGGAGAAGGCGTGCGAGG - Intergenic
1128881992 15:71252460-71252482 GAGCAGGGAGCTGCGGAGTGAGG - Intronic
1129016594 15:72474429-72474451 GAGGAGGGAGGGAGGGAGCGAGG - Exonic
1129020542 15:72513782-72513804 AAGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020553 15:72513806-72513828 GGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129057990 15:72835735-72835757 GAGGAGGGGGAAGAGGAGCAGGG + Intergenic
1129145888 15:73646814-73646836 GAGGAGGGGGAGGGGGAGGGGGG + Intergenic
1129388985 15:75211154-75211176 GGGCAGGCAGAAGGGAAGGGTGG - Exonic
1129710214 15:77817044-77817066 GAGCAGGGAGAGGCAGAGAGAGG + Intronic
1129785378 15:78306669-78306691 GCACAGGGAGAAGGAGAGGGAGG + Intergenic
1129823590 15:78620374-78620396 GGGCAGGGCGACGGGCAGCGCGG + Intronic
1130270711 15:82445530-82445552 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic
1130335823 15:82956368-82956390 GAGCTGGGAGAAGGCCAGTGTGG + Intronic
1130654488 15:85782524-85782546 GAGCAGGGAGAATGAGAGGAAGG - Intronic
1130720999 15:86386041-86386063 GAGGAGGGGGAGGGGGAGAGAGG - Intronic
1130856043 15:87840900-87840922 GAGGAGGGAGGAGGAGAGGGAGG + Intergenic
1131232579 15:90670494-90670516 TAGCAAGGAGACGGGGAGCTTGG + Intergenic
1131275170 15:90974475-90974497 GAACAGGGAGCCGGGGACCGGGG - Intronic
1131391424 15:92052075-92052097 GAGCAGGGACACGGGCAGTGTGG - Intronic
1131456343 15:92585344-92585366 GAGCGGGGAGAAACGGAGAGAGG - Intergenic
1131620395 15:94062108-94062130 GAGCAGGAAGAAGAGGGGCAGGG - Intergenic
1131721167 15:95170428-95170450 GAGGGGGGAGAAGCGGAGGGAGG - Intergenic
1132242357 15:100267670-100267692 GAGAAGGGAGACAGGGAGGGGGG - Intronic
1132415335 15:101615149-101615171 GATCAGGGAGATGGCGAGGGAGG + Intergenic
1132647799 16:1007105-1007127 GAGCAGGATGGAGGGGAGCAAGG + Intergenic
1132660274 16:1058020-1058042 GAGCTGGGAGGAGGGGGGTGGGG + Intergenic
1132740310 16:1408700-1408722 GAGCAGGCAGGGGTGGAGCGAGG + Intronic
1132789462 16:1677605-1677627 TAAGAGAGAGAAGGGGAGCGGGG - Exonic
1132804977 16:1771227-1771249 GTGTGGGGGGAAGGGGAGCGGGG - Intronic
1132918024 16:2364697-2364719 GAGGAGGGAGAGAGGGAGGGAGG + Intergenic
1132926026 16:2429529-2429551 GGGCAGGCAGAAGGGGTGTGGGG - Intronic
1133034677 16:3028160-3028182 GCGCAGCGAGAAGCGGGGCGCGG + Exonic
1133161608 16:3915699-3915721 GGGCAGGGAGAGGAGGAGAGAGG + Intergenic
1133392596 16:5422218-5422240 GAGGAGGGAGAGGGAGAGGGAGG + Intergenic
1133485443 16:6214804-6214826 GGACAGGGAGAGGGGGAGAGGGG + Intronic
1133981703 16:10637444-10637466 GAGGAAGGAGGAGGGGAGAGGGG + Intronic
1134044870 16:11093712-11093734 GAGGAGGTAGAAGGCGAGCCAGG + Intronic
1134291028 16:12902783-12902805 GAACACGGAGAAGGGGCGCTGGG + Intronic
1134347503 16:13404565-13404587 GAGCACAGAGAATGGGAGGGAGG + Intergenic
1134396757 16:13872300-13872322 GAGTTGGGAAAAGGGGAGGGTGG - Intergenic
1134771349 16:16812212-16812234 AAGCAGAGAGAGGGGGAGAGAGG + Intergenic
1134799541 16:17071619-17071641 GAGCGGGGAGGGGAGGAGCGGGG - Intergenic
1135250917 16:20900449-20900471 CAGGAGGGAGAATGGGAGAGGGG + Intronic
1135357955 16:21785684-21785706 GACCACGGAGAAGGAAAGCGAGG - Intergenic
1135456460 16:22601802-22601824 GACCACGGAGAAGGAAAGCGAGG - Intergenic
1135504449 16:23024056-23024078 GATCAGAGAGTAGGGGAGGGAGG - Intergenic
1135774137 16:25241570-25241592 GAGCAGGGAGTATGTGGGCGTGG - Intronic
1135788339 16:25370902-25370924 GGGAAGGGAAAAGAGGAGCGTGG + Intergenic
1135792053 16:25405857-25405879 GAGGAGGCAGAAAGGGAGCCAGG + Intergenic
1136030503 16:27499357-27499379 CAGCAGGGAGAGGTGGAGTGGGG + Intronic
1136146059 16:28317379-28317401 CAACAGGGAGAAGATGAGCGTGG + Exonic
1136381402 16:29897778-29897800 GCTCAGGGAGATGGGGAGCCAGG - Intronic
1136614920 16:31392956-31392978 AGGCAGGGAGAAGGGGAGCTAGG - Intergenic
1136617694 16:31408650-31408672 CAGCAGGGAGGAGGGTAGCCTGG + Intronic
1136631306 16:31490640-31490662 AGGCCGGGAGAAGGGGAGCCAGG - Exonic
1136872352 16:33819176-33819198 CAGAAGGGAAAAGGGAAGCGAGG + Intergenic
1137373697 16:47932626-47932648 GAGGAGGGAAGAGGGGAGGGGGG - Intergenic
1137374563 16:47941613-47941635 GAGTAGGGGGAGGGGGAGTGAGG + Intergenic
1137567085 16:49540002-49540024 GGGCAGGCAGAAGGGCAGAGAGG + Intronic
1137705168 16:50530394-50530416 GAGCAGGGAACAAGGGAGCTGGG + Intergenic
1137706135 16:50537195-50537217 GAGCAGGGAGAACAGGAGGAAGG + Intergenic
1138141057 16:54568852-54568874 GAGAAGGGAGAAGGAGAAGGAGG + Intergenic
1138358579 16:56406086-56406108 GAGGGGGGAGAGGGGGAGAGGGG + Intronic
1138364497 16:56463076-56463098 GAGCAGGGAGAAGGTGAAGAAGG - Intronic
1138517167 16:57542558-57542580 GAGCAGAGAGAAGTGCAGTGGGG + Intronic
1138621240 16:58212957-58212979 GAGGAGGAAGAAAGGGAGGGAGG + Intergenic
1138667754 16:58586370-58586392 GGGCAGGGGGAGGGGGAGGGAGG + Intronic
1139754666 16:69132659-69132681 GAGCACCGGGAAGGGGAGCGTGG + Exonic
1140104438 16:71946820-71946842 GAGGAGGGAGAAGGGGATGAGGG + Intronic
1140684729 16:77422503-77422525 ATGCAGGGAGATGGGGAGGGAGG + Intronic
1140870508 16:79102043-79102065 GGGCAGGGAGTAGGGGGGAGGGG + Intronic
1140884337 16:79229553-79229575 GAGCGGGGATAAGTGAAGCGCGG + Intergenic
1141165146 16:81655328-81655350 GAGCAGGCAGAGGGGCATCGTGG + Intronic
1141210251 16:81972958-81972980 GAACAGAGAGAAAGGGAGGGAGG + Intergenic
1141266128 16:82498787-82498809 GGGAAGGGAGTAGGGGAGTGGGG + Intergenic
1141410786 16:83831577-83831599 GAGGAGGGAGGAGTGGAGAGAGG - Intergenic
1141514555 16:84535083-84535105 AAGGAGGAAGAAGGGGAGGGAGG - Intronic
1141548457 16:84787993-84788015 GAGCAGGGAGGTGGAGGGCGTGG + Intergenic
1141711775 16:85703834-85703856 GAGCATGGTGGTGGGGAGCGGGG + Intronic
1141775782 16:86121825-86121847 GAGGAGGGAGGAAGGGAGAGAGG - Intergenic
1141845230 16:86603927-86603949 GAGGAGGGAGAAGGAGAAGGAGG - Intergenic
1141927398 16:87178505-87178527 GAGGAGGGAGAAAGGGAGAGAGG - Intronic
1141927406 16:87178538-87178560 GAGGAGGGAGAAAGGGAGAGAGG - Intronic
1141927414 16:87178571-87178593 AAGGAGGGAGAAAGGGAGAGAGG - Intronic
1141998304 16:87648661-87648683 GGGCTGGGAGAGGGGGAGCTGGG + Intronic
1142023639 16:87800534-87800556 CAGAAGGCAGAAGGAGAGCGAGG + Intergenic
1142137761 16:88459564-88459586 GAGGAGGAAGAAGAGGAGGGGGG - Intronic
1142151950 16:88516486-88516508 GAGGAGGGAAGAGTGGAGCGGGG - Intronic
1142246434 16:88972281-88972303 GAGCAGGGAGCAGGGGCTCTGGG - Intronic
1142274828 16:89112922-89112944 GAGCTGGGAGGGGAGGAGCGGGG - Intronic
1142337957 16:89502437-89502459 GGGCAGGTAGCAGGGGAGTGGGG - Intronic
1203099820 16_KI270728v1_random:1296892-1296914 CAGAAGGGAAAAGGGAAGCGAGG - Intergenic
1142877776 17:2862516-2862538 GGGCAGGGAGTTGGGGGGCGTGG - Intronic
1143041730 17:4043102-4043124 GCTCAGGGAGATGGGGAGGGCGG - Intronic
1143285319 17:5784837-5784859 AAGCAGGGAAAAGGTGAGCAAGG - Intronic
1143325611 17:6096377-6096399 AAGCAGGGAGAGCGGGAGTGGGG - Intronic
1143383936 17:6515038-6515060 GGGCTGGGAGAAGGGGAATGGGG + Intronic
1143476519 17:7206524-7206546 GAGCAGGGGGAAGAGGAGGTAGG - Intronic
1143601713 17:7950956-7950978 GAGCAGGGAGGGAGGGAGGGAGG + Intergenic
1143724456 17:8835876-8835898 GAGGAGGGAGTAGGGGAGGTTGG - Intronic
1143894500 17:10125654-10125676 GAGGAGGGAGGAGGGCAGGGTGG + Intronic
1143966978 17:10762442-10762464 GAGCAGAGAGGAGTGGAGAGTGG + Intergenic
1144182094 17:12761971-12761993 GAGGATGCAGAAGGGGAGTGTGG + Intronic
1144206058 17:12980240-12980262 GACCAAGGAGAAGGGAAGCAGGG - Intronic
1144233313 17:13231106-13231128 GTGCAGGAAGAAGGGAAGGGAGG - Intergenic
1144355327 17:14440072-14440094 AAGGAGGGAGAAAGGGAGGGAGG + Intergenic
1144877648 17:18410850-18410872 AGGGAGGGAGAAGGGAAGCGGGG - Intergenic
1144939977 17:18932190-18932212 GAGCACAGAGAAGGCCAGCGTGG - Intergenic
1145154584 17:20533553-20533575 AGGGAGGGAGAAGGGAAGCGGGG + Intergenic
1145221630 17:21094213-21094235 GAGGAGGGAGAGGGGGAGGAGGG + Intergenic
1145285934 17:21506056-21506078 GAGCAAGGAGATGGCGAGTGTGG - Intergenic
1146126581 17:30235955-30235977 TCGCAGGGAGGAGCGGAGCGCGG + Exonic
1146149901 17:30458522-30458544 GAGCAGGGAGGTGGGCAGGGGGG - Intronic
1146307663 17:31742961-31742983 GATCAGGGAGAATGGAAGCTGGG + Intergenic
1146666267 17:34706237-34706259 CAGCCGGGAGAAGGGGAAAGTGG + Intergenic
1146669692 17:34728471-34728493 GACCAGAGAGGAGGGGAGAGAGG + Intergenic
1146944547 17:36864758-36864780 AAGGAGGGAGGAGGGGAGGGAGG - Intergenic
1147458518 17:40553701-40553723 GGGCAGGGAGGAGGGGAGAGGGG + Intergenic
1147625884 17:41899596-41899618 GTACAAGGAGGAGGGGAGCGTGG - Intronic
1147632749 17:41942667-41942689 GGGGAGGGAGAAGGGGACCTTGG + Intronic
1147690649 17:42312658-42312680 GAGCAGGGGGAAGGCGGGGGTGG + Intergenic
1147710074 17:42457089-42457111 GAGCAGGGAGAAGGAGGGTATGG + Intergenic
1147740738 17:42669887-42669909 GAGAAGGGAGAAGGGGACTCTGG - Intronic
1147910419 17:43852923-43852945 AAGGTGGGAGAAGGGGAGGGAGG - Exonic
1147935463 17:44008097-44008119 GAGCAGGGTGTAGGGGTGAGGGG - Intronic
1148188481 17:45661791-45661813 GAGCAGGCAGAAGGCTAGGGTGG + Intergenic
1148242079 17:46006429-46006451 GAGGAGGGTGGAGGGGAGCAGGG + Intronic
1148647795 17:49229352-49229374 GAGCAGGGAGAAGGGCTTCTGGG + Intronic
1148684719 17:49495123-49495145 AGGCAGGGAGAAGCGCAGCGGGG + Intergenic
1148760953 17:49999720-49999742 TGGCAGGGAGAAGGGAAGGGGGG + Intergenic
1149080683 17:52653102-52653124 GAGAAAGGAGAAAGGGAGGGAGG + Intergenic
1149422166 17:56521489-56521511 GAGCAGGGGGGTGGGGAGCCTGG + Intergenic
1149422505 17:56524380-56524402 GAGGAGGGAGAGGGCGGGCGCGG + Intergenic
1149441601 17:56678855-56678877 GAGGAGGGGGGAGGGGAGCCGGG - Intergenic
1149962515 17:61127398-61127420 GAGCAGGGATAAGGGGACACTGG + Intronic
1150782407 17:68134220-68134242 GGGCAAGGAGTTGGGGAGCGGGG + Intergenic
1150819953 17:68427002-68427024 GTGAAGGGGGAAGGGGAGGGAGG + Intronic
1150819977 17:68427069-68427091 GTGCAGGGAGAAGGGGAGGGAGG + Intronic
1150899925 17:69262372-69262394 GGGCAGGAGGAAGGGGAGCAAGG - Intronic
1150977813 17:70108792-70108814 GGGCAAGGAGAAAGGGAGGGAGG - Intronic
1151116472 17:71740969-71740991 GAGCTGGGGGAAGGGGAGAGGGG - Intergenic
1151305937 17:73262690-73262712 GAGCAGGGGGAGGGGGAACCTGG - Intergenic
1151390553 17:73784187-73784209 GGGCACGGGGAAGGGGAGCTGGG + Intergenic
1151393140 17:73801390-73801412 GAGGAGGGAGAAGGGATGAGAGG + Intergenic
1151467904 17:74299640-74299662 GGGCAGGGAGCAGGGGAGAGAGG - Intronic
1151563638 17:74884664-74884686 GAGCAGCGAGACGGGGATAGGGG + Intronic
1151577999 17:74962585-74962607 GGACAGGGAGAAAGGGAGGGAGG + Intronic
1151784439 17:76268496-76268518 GGGCAGGGAGTAGTGGAGGGAGG + Intronic
1151896157 17:76982236-76982258 GAGGATGGAGAAGGGCAGCTTGG + Intergenic
1152043080 17:77917563-77917585 GAGGAAGGAGAAGGGGGGGGAGG + Intergenic
1152126429 17:78450091-78450113 GAGCTGGAAGAGGGGGAGCCAGG - Intronic
1152199812 17:78938785-78938807 GAGGAGCAAGAAGGGGAGGGTGG - Intergenic
1152211120 17:79003927-79003949 GAGCTGGGAGTTAGGGAGCGGGG + Intronic
1152217791 17:79044495-79044517 AGGCAGGGAGAAGTGGAGCATGG + Intronic
1152241805 17:79164874-79164896 GTGCAGGGAGAAGAGGGGCGAGG - Intronic
1152335314 17:79697282-79697304 GTGCAGGGAGAAGGAAAGGGTGG - Intergenic
1152515346 17:80820387-80820409 CAGCACGGAGAAGGGGCACGGGG - Intronic
1152558005 17:81064129-81064151 GAGGAGGAAGAAGGGCAGCCAGG - Intronic
1152647643 17:81477155-81477177 GAGCAGGGAGAAGTGGAGAGTGG - Intergenic
1152676739 17:81645203-81645225 CAGCAGGGAGAAGGGGAAGTTGG - Exonic
1152779240 17:82219107-82219129 GGGCAGGGAGGAGAGGAGCAGGG + Intergenic
1152817188 17:82414992-82415014 GCCCAGGCAGAACGGGAGCGGGG + Intronic
1153024007 18:657584-657606 GAGCAGGAAGAGGCGGAGCGCGG + Exonic
1153576180 18:6524133-6524155 GAACAGGGAGAAAGTCAGCGTGG + Intronic
1153939791 18:9968077-9968099 GAGCAGGGAAGAGGGGCGAGGGG - Intergenic
1153951489 18:10061374-10061396 GAGCAGGGAGAGGGGGAAAAGGG - Intergenic
1155066531 18:22273753-22273775 GAGGAGGGAGGAGGGGAGGAGGG - Intergenic
1155396595 18:25392877-25392899 GTGCAGGGGGAAGGTGAGCAAGG + Intergenic
1155507633 18:26548427-26548449 GAGCGGGGCGAGGGCGAGCGCGG - Intronic
1155615528 18:27716925-27716947 GAGCAGGGAGTGGGGAAGGGTGG + Intergenic
1156022100 18:32611545-32611567 GAGCAAGGAGAGAGGGAGCGGGG - Intergenic
1156090818 18:33466629-33466651 GAGCAGGAAAAAGGGGGGTGGGG - Intergenic
1156259159 18:35428610-35428632 GAGGAGGGAGAACAGGAGCAAGG - Intergenic
1156291925 18:35755047-35755069 GTGGAGGGAGAAGGGGCGGGTGG - Intergenic
1156367450 18:36442144-36442166 AATCTGGGAGAAGGGGAGCAGGG - Intronic
1156469452 18:37368307-37368329 GAGTAGGGAGACGGGCAGGGAGG - Intronic
1156722568 18:40088169-40088191 GAGAAGGGGGAAAGGGAGCATGG + Intergenic
1157105408 18:44770064-44770086 GAGCTGGGAGGAGGGGAAAGAGG - Intronic
1157124023 18:44938061-44938083 AAGCAGGGAGTGGGGGAGCAGGG + Intronic
1157398786 18:47368286-47368308 GAGGAGGTAGAAGGGGAGGCAGG + Intergenic
1157470168 18:47982627-47982649 GAGAAGGGGGAGGGGGAGAGGGG + Intergenic
1157475477 18:48020991-48021013 TAGAAGGGAGAAGAGGAGCGAGG - Intergenic
1157610671 18:48952872-48952894 CCGGCGGGAGAAGGGGAGCGGGG + Intergenic
1158103741 18:53861269-53861291 GAGGAGGGAGAGAGGGAGGGAGG + Intergenic
1158550388 18:58430913-58430935 GATCAGTGAGAAGAGGAGGGTGG - Intergenic
1158776716 18:60591191-60591213 GGGAAGGGAGAAAGGGAGGGAGG - Intergenic
1159571524 18:70119476-70119498 GGGAAGGGAGAAGGGAAGGGAGG + Intronic
1159724048 18:71931177-71931199 GAGAAGAGAGTAGGGGAGAGGGG - Intergenic
1159957773 18:74531970-74531992 GAGAGGGGAGAAAGGGAGAGAGG - Intergenic
1160187156 18:76684745-76684767 GTGCAGAGAGAAGGGGAGCTTGG - Intergenic
1160356082 18:78229516-78229538 GAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1160396115 18:78573354-78573376 GAGCAGGATGAAGGGGGGTGGGG - Intergenic
1160413579 18:78691014-78691036 GAGCAGAGAGGAGAGGAGCTGGG - Intergenic
1160430955 18:78812269-78812291 GAGGTGGGAGAAGGGGGGCCGGG - Intergenic
1160448643 18:78947017-78947039 GAGGAGGGACGAGGGGAGGGAGG + Intergenic
1160527584 18:79546581-79546603 GAGCGTGGAGAGGGTGAGCGTGG - Intergenic
1160695138 19:480235-480257 GAGCAAGGAGAAGAGGAGCCGGG + Intergenic
1160703486 19:518676-518698 TAGCTGGGAGAAGGGAGGCGGGG + Intronic
1160914950 19:1491856-1491878 GAGCTGGGGGAAGGTGAGCTAGG - Intronic
1160916848 19:1500823-1500845 GAGGAGGGAGGAGGGGAGGAGGG + Intergenic
1160916860 19:1500845-1500867 GAGGAGGGAGGAGGGGAGGGGGG + Intergenic
1161030778 19:2056821-2056843 GAGGAGGGGGAAGGGGAGGAGGG - Intergenic
1161093846 19:2377493-2377515 GGGGAGGGGGAAGGGGAGAGGGG - Intergenic
1161203575 19:3029015-3029037 GAGGAGGGAGAAGCGGCGCGGGG + Exonic
1161403961 19:4081668-4081690 GAGCAGGGAGGAGGGAGGAGGGG - Intergenic
1161403983 19:4081728-4081750 GAGCAGGGAGGAGGGAGGAGAGG - Intergenic
1161477679 19:4495550-4495572 GTGGAGGGAGGAGGGGAGAGAGG + Intronic
1161621426 19:5299277-5299299 GAGCAGAGTGAGGGGGAGAGAGG - Intronic
1161797415 19:6395076-6395098 GAACAGAGAGAAGGGGAGTATGG + Intergenic
1161803512 19:6429393-6429415 GAGAAGGGAGAAAGGAAGAGGGG + Intronic
1161915483 19:7225038-7225060 GAGGAGAGAGGAGGGGAGAGGGG + Intronic
1161918736 19:7250342-7250364 GAGGAGGGAGAAAGGGAAAGAGG + Intronic
1161931460 19:7343336-7343358 GGGGAGGGAGATGGGGAGCGAGG + Intergenic
1162215041 19:9127208-9127230 GAGGAGGGAGAGAGGGAGGGAGG - Intergenic
1162352715 19:10160516-10160538 AAACAGAGAGAAGGGGAGGGAGG + Intronic
1162371694 19:10283804-10283826 CAGCAGGGAGAAGGTGGGGGTGG + Intronic
1162581603 19:11534599-11534621 GAGAAGGGAGAAGGGGAAGAAGG + Intergenic
1162769431 19:12940217-12940239 AAGAAGGAAGAAGGTGAGCGGGG - Intronic
1162911711 19:13851284-13851306 GGGCAGGCAGAAGGGGGGCCTGG + Intergenic
1163121355 19:15220101-15220123 GAGAAGGGAGAGGTGGAGCCAGG - Intergenic
1163164011 19:15483033-15483055 GAGGAGGTGGAAGGGGAGAGAGG - Intronic
1163246440 19:16097897-16097919 GAGCAGGGAGAGGCTGAGGGTGG - Intronic
1163558835 19:18007346-18007368 GAGCAGGCACAAGGGCTGCGGGG + Intronic
1163957902 19:20661142-20661164 GTGCAGGGACCAGGGGAGGGTGG - Intronic
1164394515 19:27851374-27851396 AAGCAGTGAGAAGGGAAGCCCGG + Intergenic
1164523837 19:28999253-28999275 GAGGAGGGAGCAAGAGAGCGAGG + Intergenic
1164649894 19:29884192-29884214 GAGAAGGAGGAAGGGGAGGGAGG - Intergenic
1164695199 19:30238619-30238641 AAGAAGGGAGAAAGGGAGGGAGG - Intronic
1165313046 19:35040093-35040115 CAGCAAGGAGGAGGGGTGCGGGG - Intronic
1165331034 19:35141308-35141330 GACCAGGGAGAAGCGGGGCCAGG - Intronic
1165438876 19:35812554-35812576 GAGCTGGGTGACAGGGAGCGAGG + Exonic
1165902160 19:39174065-39174087 GAGGAGGGAGGAGGGGAGGGAGG - Intronic
1166197906 19:41219027-41219049 GAGGAGGGGGAAGGGGACCCTGG - Intergenic
1166283962 19:41812120-41812142 GGCCAGGGAGAAGAGGAGAGAGG - Intergenic
1166297674 19:41896944-41896966 GAGGAGGGGGAAGGTGAGAGAGG - Intronic
1166300816 19:41911298-41911320 GAGGAGGGGGAAGGGGACAGAGG - Intronic
1166305995 19:41937297-41937319 GAGAGGGGGGAAGGGGAGAGGGG + Intergenic
1166310397 19:41959164-41959186 GAGGAGGGAGGAGGGGGCCGGGG + Intronic
1166318034 19:41999417-41999439 GAGAAGTGGGAAGGGAAGCGAGG - Intronic
1166338380 19:42122482-42122504 GGGCAGGGAGCAGGGGGGCAGGG - Intronic
1166556434 19:43703134-43703156 GAGGAGGGAGAAAGAGAGAGAGG - Intergenic
1166908436 19:46132753-46132775 AAGGAGGGAGAAAGGGAGGGAGG + Intergenic
1166960511 19:46493674-46493696 CAGGAAGAAGAAGGGGAGCGCGG - Exonic
1167041943 19:47027696-47027718 GGGCAGAGAGAAGGGGACCAGGG - Intronic
1167151582 19:47713382-47713404 GAGCGGGGAGGACGGGAGGGAGG - Exonic
1167153935 19:47726619-47726641 GAGGAGGGAGGAAGGGAGAGAGG - Intronic
1167286657 19:48602229-48602251 GAGGAGGGAGGAGGGGAGCCAGG + Intronic
1167338779 19:48902853-48902875 GAGCAGGGAGAGTGAGAGGGAGG + Intronic
1167775631 19:51552975-51552997 GAGCAGGAGGAAGAGGAGGGGGG + Intergenic
1167779934 19:51592703-51592725 GAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1168251599 19:55145384-55145406 GAGGAGGGAAAGGGGGAGGGAGG + Intronic
1168284959 19:55326596-55326618 GAGAAAGGAGATGGGGAGAGTGG + Intronic
1168333844 19:55585867-55585889 GAGCCGGGAGGAGGGGGGCGGGG + Intergenic
1168353722 19:55689938-55689960 GGGCAAGGAGGAGGTGAGCGGGG + Exonic
1168359827 19:55730107-55730129 GAACAGGGAGAAGGTCAGCCAGG + Intronic
1168389358 19:55993476-55993498 GAGGGGGGAGAGGGGGAGGGAGG - Intergenic
1168525771 19:57087766-57087788 GAGAGGGGAGAGGGGGAGGGGGG + Intergenic
1202697529 1_KI270712v1_random:135832-135854 GAGGAGGGGGAAGGGGAGGGTGG - Intergenic
925068653 2:950187-950209 GTGGAAGGAGGAGGGGAGCGGGG + Intergenic
925287330 2:2724407-2724429 GAGCAGAGAGAAGGGGTGATTGG - Intergenic
925297092 2:2784498-2784520 GAGCAGGCAGAAGGGGTCTGTGG + Intergenic
925492484 2:4410242-4410264 GAGAAGGGAGAAAGGGAGGAAGG - Intergenic
925733484 2:6940891-6940913 GAGCAGGGAGGAGAGGAGCAGGG - Intronic
925807099 2:7661210-7661232 GGGAAGGGAAAAGGGGAGCAGGG + Intergenic
925910255 2:8569290-8569312 GAGGAGGGAGGTGGGGAGAGAGG + Intergenic
925927615 2:8681735-8681757 GAGGAGGGAGAGGAGGAGGGAGG - Intronic
925974796 2:9134503-9134525 GAGAAGCGAGAGGGGGTGCGGGG + Intergenic
925988594 2:9235591-9235613 GAGGAGGGAGAACTGGAGCTGGG + Intronic
926244575 2:11113506-11113528 AAGAAGGAAGAAGGGGAGGGAGG - Intergenic
926444303 2:12924831-12924853 GATCAGGGAGAAAGGTAGAGAGG + Intergenic
926729483 2:16025462-16025484 GGGCATGGAGAAGTGGAGCATGG + Intergenic
926753645 2:16219301-16219323 GGGGAGGGAGAAGGGGGGAGGGG - Intergenic
927084439 2:19660460-19660482 GTGGAGGGTGAAGGGGAGCCAGG - Intergenic
927467268 2:23346899-23346921 GACCAGGGAGCATGGGAGAGGGG + Intergenic
927842270 2:26453340-26453362 GAGCATGGAGAAGGCGAGCATGG + Exonic
927846471 2:26474978-26475000 GAGCAGGGAGTAAGGGATTGGGG - Intronic
927873719 2:26640494-26640516 GAGCTGGGAGAAGGAAAGAGGGG + Intronic
927874326 2:26644698-26644720 AAGCAGGGAGCGGGGGAGAGAGG + Intergenic
927882526 2:26698721-26698743 GAGCGGGGAGATGGGGGGTGGGG - Intronic
927905000 2:26849267-26849289 GAGGAGGGAGGACGGGAGCGAGG + Intronic
927935578 2:27074189-27074211 GACCTGGGAGAAGGGGAACTGGG + Intergenic
928105808 2:28470006-28470028 GAGGAGGGAGAAGGGGAAGTGGG + Intronic
928105819 2:28470034-28470056 GAGGAGGGGGAAGGGGAGGAGGG + Intronic
928121919 2:28589972-28589994 AAGCAGGGAGATGGGGAGTGAGG - Intronic
928165444 2:28968407-28968429 GGGCAGGGAGAGAGGGAGCGAGG - Intronic
928201644 2:29251157-29251179 GAGCGTGGAGGTGGGGAGCGAGG - Exonic
928219493 2:29391663-29391685 GAGGAGGGAGACAGGGAGGGAGG - Intronic
928332504 2:30368506-30368528 GGACAGGGAGCAGAGGAGCGAGG - Intergenic
928619185 2:33071548-33071570 GAACAGGGGGAAGGGAAGCAGGG + Intronic
928902799 2:36338677-36338699 GAAGAGAGAGAAGGGGAGGGTGG - Intergenic
928958667 2:36898886-36898908 GAGAAGGGAGAAGGGGAAGAGGG + Intronic
929123787 2:38504484-38504506 GAGAAGGGGGAAGGGGAGGTGGG - Intergenic
929857840 2:45651214-45651236 GAGCGGGGACGCGGGGAGCGCGG + Intergenic
929876028 2:45797294-45797316 CTGCAGGGTGAAGGGGAGGGAGG + Intronic
929917933 2:46151646-46151668 GAACAGAGAGGAGGGGAGGGAGG + Intronic
929921934 2:46178893-46178915 GAGCCGGGAGGAGGGCAGGGTGG + Intronic
929922780 2:46184501-46184523 GAGAAGGAAGAAGGGGTGAGAGG - Intronic
930084002 2:47480051-47480073 GAGAAGGGAGAATGGGAGAATGG - Intronic
930316815 2:49806739-49806761 AAGCAGGGAGAGGTGGAGAGGGG + Intergenic
930695018 2:54402521-54402543 GAGGAGGAAGAAGGGGAATGAGG + Intergenic
930710529 2:54547120-54547142 GAGCTGGGGGAAGGGGAACGTGG - Intronic
931107993 2:59078761-59078783 GAGGAGGGAGAAGGAGAGTTGGG - Intergenic
931133389 2:59366215-59366237 AAGAAGGGAGAAAGGGAGGGAGG + Intergenic
931320395 2:61170311-61170333 GAGGAGGTAGAAGGGGAGGCAGG - Intergenic
931449183 2:62353309-62353331 GAGTAGGGAGAGGGAGAGAGAGG + Intergenic
931590667 2:63880147-63880169 GGGAAGGGGGAAGGGGAGAGGGG - Intronic
931899212 2:66769382-66769404 GAGCAGGGAGGAGGTGAACAAGG - Intergenic
931906213 2:66846507-66846529 GGGCTGGGAGCAGGGAAGCGGGG - Intergenic
932088124 2:68780589-68780611 GAGAAGGGGGAAGGGGAAGGAGG - Intronic
932106190 2:68944779-68944801 GAGAAGGGAGAAAGGGAGAGAGG - Intergenic
932292572 2:70594868-70594890 GAGCCTGGAGAAGAGGAGAGGGG + Intergenic
932336660 2:70935676-70935698 GTGGAGGGAGAAGGGAAGAGGGG - Intergenic
932601896 2:73133392-73133414 GGGAAGGGAGAGGGGGAGGGAGG + Intronic
932841578 2:75088192-75088214 GAGCAGGGTGCAGAGGAGAGTGG - Intronic
932924316 2:75954302-75954324 GAGAAGAGGGAAGGGGAGGGTGG - Intergenic
933142867 2:78815442-78815464 GGGAAGGGAGAAAGGGAGGGAGG + Intergenic
933861500 2:86474209-86474231 GAGGGAGGAGAAGGGGAGAGAGG - Intronic
933918194 2:87017912-87017934 GAGAAGGGAGAGAGGGAGCGAGG + Intronic
933941346 2:87247595-87247617 GGGCAAGGAGAAGGTGAGAGAGG - Intergenic
934004800 2:87752001-87752023 GAGAAGGGAGAGAGGGAGCGAGG - Intronic
934047334 2:88183595-88183617 GAGAGGGAAGAAGGAGAGCGAGG - Intronic
934174141 2:89564320-89564342 GGGCAGGGAGCAGGGTAGAGGGG - Intergenic
934284457 2:91638669-91638691 GGGCAGGGAGCAGGGTAGAGGGG - Intergenic
934674887 2:96242513-96242535 GAGCTGGAAGAGGGGGAGTGAGG + Intergenic
935127348 2:100236008-100236030 GGGCAGGGAGGAGAGGAGCGAGG + Intergenic
935138895 2:100333571-100333593 GAGCCGGGAGAAAGGGATCCAGG + Intergenic
935584716 2:104790360-104790382 GAGGAGGGAAGAGGGCAGCGAGG - Intergenic
935666301 2:105516016-105516038 CAGCAGGGAGATAGGGAGCAAGG - Intergenic
935767758 2:106386034-106386056 GAGAAGGGAGAGAGGGAGCGAGG - Intergenic
936338876 2:111613993-111614015 GGGCAAGGAGAAGGTGAGAGAGG + Intergenic
936502650 2:113078334-113078356 AGGGAGGGAGAAGGGGAGGGAGG - Intergenic
936523954 2:113230260-113230282 AGGCAGGGGGAAGGGGAGTGCGG - Intronic
936679848 2:114757342-114757364 AAGTAGGGAGAGGGGGAGGGAGG + Intronic
937098078 2:119248584-119248606 GAGCTGGAAGGAGGGGAGAGGGG + Intronic
937439837 2:121906323-121906345 GGGCGGGGAGTGGGGGAGCGGGG - Intergenic
937465209 2:122126357-122126379 GAGCAGGAGGAAGGGGGGAGAGG - Intergenic
937958560 2:127437767-127437789 GCTCAGGAAGAAGGGGAGGGAGG - Intronic
937972827 2:127563984-127564006 GAGCAGGGAGAAAGAGAGATGGG + Intronic
938063990 2:128271367-128271389 GAGCAGGCAGAAGTGGTGTGAGG + Intronic
938632577 2:133184107-133184129 GAGCAGGGAGGAAGGGTGAGTGG - Intronic
939612964 2:144332382-144332404 CAGCGGGGAGGCGGGGAGCGCGG - Intronic
939847174 2:147261425-147261447 GAGCAAGAGGAAGGGGAGGGAGG - Intergenic
940025672 2:149204748-149204770 GAGCAGTGAGAAGGACAGCAGGG - Intronic
941121442 2:161535135-161535157 GAGCAGGGAGGATGGAAGTGGGG + Intronic
942042152 2:172078018-172078040 GTGCAGGGGGCAGGGGAGGGGGG + Intronic
942914414 2:181285834-181285856 GAGGAAGGAGCTGGGGAGCGGGG + Intergenic
942947540 2:181685631-181685653 AAGGAGGAAGAAGGGGAGGGAGG - Intergenic
942984087 2:182118846-182118868 GGAGAGGGAGAAGGGGAGAGAGG - Intronic
943278272 2:185896888-185896910 GAGAAGGAAGAAGAGGAGGGAGG + Intergenic
943502418 2:188708531-188708553 GAGCGAGGAGGAGGGGAGCATGG - Intergenic
943516248 2:188890897-188890919 GAGCAGGGTGCAGCGGAGCAGGG - Intergenic
943645045 2:190401080-190401102 GTGCAGGAACAAGGGGAGGGTGG + Intergenic
943852005 2:192735496-192735518 GAGCAGGGAGAAGAAGTGAGTGG - Intergenic
943890250 2:193277263-193277285 GAGGAGGAGGAAGGGGAGGGGGG - Intergenic
944441908 2:199751635-199751657 GGGCAGAGAGAAGGGGAGAAAGG - Intergenic
944933811 2:204546107-204546129 GACCCGGGAGAAGGTGAGCGCGG + Exonic
945080804 2:206085344-206085366 GACCCGGGGGAAGGGGAGCCGGG + Intronic
945131328 2:206575887-206575909 GAGTAAGGAGTAGGGGAGCTGGG + Intronic
945176939 2:207052645-207052667 GGGCAGGGATGAGGGGAGGGTGG - Intergenic
945910203 2:215640208-215640230 GGGGAGGGAGAAAGGGAGAGAGG - Intergenic
946109627 2:217403192-217403214 GAGAAGGGAGAGGGGGAGGGAGG + Intronic
946126328 2:217566226-217566248 GAGCAGGAAGAAGTGGGGGGAGG + Intronic
946228880 2:218279527-218279549 TGGCAGGGAGCATGGGAGCGGGG - Intronic
946427732 2:219608367-219608389 GAACAGGGAGAAGAGGAGGCAGG + Exonic
946981895 2:225227255-225227277 GAGAAGGGAGAAAGGAAGCTTGG - Intergenic
947077750 2:226363994-226364016 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077797 2:226364113-226364135 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077803 2:226364125-226364147 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077823 2:226364173-226364195 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077845 2:226364221-226364243 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077851 2:226364233-226364255 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077857 2:226364245-226364267 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077863 2:226364257-226364279 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947077869 2:226364269-226364291 GGGGAGGGAGGAGGGGAGGGAGG + Intergenic
947718258 2:232352478-232352500 CAGAAGGAAGGAGGGGAGCGCGG - Intergenic
947828912 2:233125261-233125283 GACCAGGGAGAGAGGGAGAGGGG + Intronic
947936564 2:234009633-234009655 GGAAAGGGAGAAGGGGAGGGAGG - Intronic
948017954 2:234705477-234705499 GAGCAGGAGGAAGAGGAGAGGGG - Intergenic
948091795 2:235301748-235301770 GAGGAGGGAGAAGGAGGGAGGGG - Intergenic
948091942 2:235302210-235302232 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
948233101 2:236366120-236366142 GATCAGGGAGAAGTGAAGGGTGG - Intronic
948390458 2:237607859-237607881 GGGCATGGAAAAGGGGATCGGGG - Intergenic
948445620 2:238030738-238030760 CAGCAGGGAGAAGAGGAGGCAGG - Intronic
948694315 2:239725540-239725562 CAGGAGGGAGAAGGTGAGTGAGG + Intergenic
948766072 2:240219772-240219794 GTTCAGGGAGGATGGGAGCGAGG - Intergenic
948766078 2:240219796-240219818 GATGAGGGAGGATGGGAGCGAGG - Intergenic
948815832 2:240510029-240510051 GAGCAGGGAGATAGGAAGGGAGG - Intronic
948983210 2:241505534-241505556 GAGCAGGGAGTAGAGCAGGGCGG - Intronic
949055504 2:241926111-241926133 GAGCAGGGAGAGGGAGCGAGAGG - Intergenic
1169064916 20:2689735-2689757 GAGCTGGGAGACAGGGAGCTGGG + Intergenic
1169334933 20:4748394-4748416 GAGAAGGGAGATGGGAAGTGTGG + Intergenic
1169345202 20:4823496-4823518 GAGGAAGGAGGAGGGGAGCGAGG - Intronic
1169745567 20:8939133-8939155 GAGCAGGAGGAAGGGGTGTGGGG + Intronic
1169971712 20:11275719-11275741 AAGCAAGGAGGAGGGGAGGGAGG - Intergenic
1170204552 20:13784578-13784600 GAGCGGGCAGAAGGGGAGGGTGG - Intronic
1170366174 20:15600492-15600514 GAGAAAGAAGAAGGGGAGGGCGG - Intronic
1170522314 20:17199186-17199208 GAGCAGAGAGAATGGGATCAAGG - Intergenic
1170618635 20:17975651-17975673 AATCAGGGAAAAGGGGAGGGGGG - Intronic
1170631745 20:18072325-18072347 AAGGAGGGAGGAGGGGAGGGAGG - Intergenic
1170938289 20:20828037-20828059 AAGCAGGGAGAGAGGGAGTGAGG + Intergenic
1171161385 20:22927279-22927301 GAGGAGGAGGAAGGGGAGAGAGG - Intergenic
1171217605 20:23363154-23363176 GAGACTGGAGAAGGGGAGAGGGG + Intronic
1171377331 20:24702507-24702529 GGGCAGGGAGCAGGGGACAGGGG + Intergenic
1171418116 20:24997403-24997425 GAGCAGGTGGAAGGGGAGGCTGG - Intergenic
1171557854 20:26094609-26094631 GAGAAAGGTGAAGGTGAGCGTGG - Intergenic
1172044525 20:32070968-32070990 GAGCAGGAAGGAAGGGAGGGAGG + Intronic
1172118029 20:32583454-32583476 GAGGGGGGAGCGGGGGAGCGGGG + Intronic
1172303339 20:33864917-33864939 GTACAGGGAGAAGGGGAGACAGG - Intergenic
1172342940 20:34172987-34173009 GAGCAGGCAGGAGGGGAAAGAGG - Intergenic
1172389604 20:34558308-34558330 GAGAAGGGAGAAGGTGCGGGAGG - Intronic
1172408018 20:34703881-34703903 GAGCAGGAATAAGGGCAGTGGGG + Intronic
1172474685 20:35227378-35227400 GAGAAGGGGGAGGGGGAGGGCGG + Intronic
1172644795 20:36462480-36462502 GAGCAGAGAGAAGGGGAGACAGG - Intronic
1172777143 20:37414432-37414454 GAGGTGGGGGAAGGAGAGCGAGG - Intergenic
1172999982 20:39098721-39098743 GAGGAAGGAGAAAGGGAGAGAGG - Intergenic
1173144188 20:40510748-40510770 AAGGAGGGAGAAAGGGAGGGAGG + Intergenic
1173397759 20:42696334-42696356 GAGAAAGGAGAACGGGAGAGAGG - Intronic
1173443228 20:43096068-43096090 GAGAAGGGAGAGAGGGAGAGAGG - Intronic
1173454066 20:43189698-43189720 GAGCAGGCTGAGGGCGAGCGCGG + Exonic
1173581441 20:44149545-44149567 CAGCAGGGAAATGGGGAGGGAGG - Intronic
1173670649 20:44796429-44796451 GAGGAGAGAGAAGGGGAGGAAGG + Intronic
1173906267 20:46631980-46632002 GGGCAGGGGGAAGGGGACAGTGG - Intronic
1174062767 20:47844146-47844168 GAGAAGGGAGAAAGGAAGGGAGG + Intergenic
1174416967 20:50373859-50373881 GAGCAGGGAGGAGGCCAGTGTGG + Intergenic
1174478058 20:50811181-50811203 GAGCAGGTAGAAGATGAGGGAGG + Intronic
1174505470 20:51014974-51014996 AAGCTGGGAGAAGAGGAGAGGGG + Intronic
1175487437 20:59355873-59355895 GAGAGGGGAGAAGGAGAGAGGGG - Intergenic
1175491543 20:59383908-59383930 GAGCAGGGAGGAGGTGAGCAGGG + Intergenic
1175491559 20:59383979-59384001 GAGCAGGGAGAAGATGAGCAGGG + Intergenic
1175491566 20:59383994-59384016 GAGCAGGGGGGTGGTGAGCGGGG + Intergenic
1175491606 20:59384112-59384134 GAGCAGGGAGGAGGTGAGCAGGG + Intergenic
1175491646 20:59384283-59384305 GAGCAGGGAGGAGGCGAGCAGGG + Intergenic
1175636310 20:60587102-60587124 GGGAAGGCAGAAGGGGAGCAAGG + Intergenic
1175781086 20:61682437-61682459 GGGGTGGGAGAAGGGGAGGGAGG + Intronic
1175891574 20:62318219-62318241 GAGAGAGGAGAAGGGGAGAGGGG + Intronic
1175986209 20:62765292-62765314 GAGCAGGGAGAAGAGAGGAGAGG - Intergenic
1176061276 20:63173974-63173996 GAGCAGAGAGAAAGGGGCCGTGG + Intergenic
1176086758 20:63298940-63298962 GTCCAGGGAGCAGGGGAGGGTGG - Intronic
1176087276 20:63303880-63303902 CTGCAGGGAGAAGAGGAGGGTGG - Intronic
1176087286 20:63303920-63303942 CTGCAGGGAGAAGAGGAGGGAGG - Intronic
1176087296 20:63303960-63303982 CTGCAGGGAGAAGAGGAGGGAGG - Intronic
1176087402 20:63304320-63304342 CTGCAGGGAGAAGAGGAGGGAGG - Intronic
1176087451 20:63304480-63304502 CTGCAGGGAGAAGAGGAGGGAGG - Intronic
1176087509 20:63304680-63304702 CTGCAGGGAGAAGAGGAGGGAGG - Intronic
1176103476 20:63375088-63375110 GTGCAGGGAGTGGGGGAGCCTGG - Intronic
1176195969 20:63836424-63836446 GAGCAGGGGCAGGGAGAGCGCGG + Intergenic
1176382739 21:6121251-6121273 GAGGAGGGTGCTGGGGAGCGGGG - Exonic
1176546521 21:8204675-8204697 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176554415 21:8248866-8248888 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176565472 21:8387722-8387744 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176573337 21:8431890-8431912 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1176956834 21:15115313-15115335 AAGCAGGAAGAAAGGGAGGGAGG + Intergenic
1177144992 21:17397796-17397818 AAGGAGGGAGAAGGGAAGGGAGG + Intergenic
1177775505 21:25562036-25562058 GAGGGGGGAGAAGGGGGGGGGGG + Intergenic
1178143453 21:29710850-29710872 GAGGAGGGAGAGAGGGAGGGAGG - Intronic
1178223018 21:30682707-30682729 GGGCAGGAAGAAGGGGAGTATGG - Intergenic
1178598324 21:33974683-33974705 GAGAAGGGAGGAAGGGAGGGAGG - Intergenic
1178824683 21:36005062-36005084 GGGCCGGGGGAAGGGGTGCGGGG + Intergenic
1179094161 21:38296950-38296972 CAGGTGGGTGAAGGGGAGCGAGG + Exonic
1179171453 21:38976016-38976038 GAGCAGGCAGATGGGAAGCAGGG + Intergenic
1179283040 21:39951359-39951381 GAGAAGGAATAAGGGGAGTGCGG - Intergenic
1179291211 21:40019917-40019939 AAGGAGGGAGAAGGGGAAGGGGG - Intronic
1179291430 21:40021289-40021311 GAGAAGGGAAAAGGGGAACATGG + Intronic
1179417942 21:41213393-41213415 CAGCAGGCAGAAGGGGTGAGAGG + Intronic
1179443270 21:41410985-41411007 GGGCAGGGAGAAGGGGAAATGGG + Intergenic
1179509835 21:41865160-41865182 GAGGAGTGAGCAGGGGAGTGAGG - Intronic
1179575374 21:42305232-42305254 GGGCAGGAAGGAGGGGAGTGTGG - Intergenic
1179586155 21:42375363-42375385 GAGCAGGGAGAAAGTGGGAGGGG - Intronic
1179740730 21:43416988-43417010 GAGGAGGGTGCTGGGGAGCGGGG + Exonic
1179802835 21:43819515-43819537 GGGTGGGGAGAAGGGGAGGGAGG + Intergenic
1179818996 21:43925540-43925562 GGGGAGGGAGAACGGGAGCTTGG + Intronic
1179894239 21:44352329-44352351 GAGGAGGGAGAGGGGGAGGTGGG + Intronic
1179927103 21:44540749-44540771 AAACAGGGAGAAGGGGAGCAAGG + Intronic
1179938887 21:44625663-44625685 AAACAGGGAGAAGGGGAGCAAGG - Intronic
1180050865 21:45330528-45330550 GAGCAGTGAGCAGGGCAGCAGGG - Intergenic
1180186828 21:46144467-46144489 GGGGAGGGAGAGGGGGAGAGGGG - Intronic
1180581496 22:16843386-16843408 GAGAAGGGAGAAGGGGAAGAGGG + Intergenic
1180938561 22:19641905-19641927 GAGGAGGGAGGAGGGGAGGGAGG + Intergenic
1181017524 22:20079965-20079987 ATGCCGGGAGCAGGGGAGCGCGG - Intergenic
1181535020 22:23537302-23537324 GAGCAGAGAGAAGGAGGGAGAGG + Intergenic
1181885307 22:26017371-26017393 GAGGAAGGAGGAGGGGAGGGAGG - Intronic
1181911002 22:26238156-26238178 GAGCAGGCAGAAGGGCAAAGGGG + Intronic
1181998562 22:26902554-26902576 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1182278831 22:29206493-29206515 GAACAGGGAAAAGGGGAGAGAGG - Intronic
1182738290 22:32546839-32546861 GAGAAGGGAGAAGAGGGGCGAGG - Intronic
1183001275 22:34861457-34861479 GAGCAGAGTGAAGGGGAAGGTGG - Intergenic
1183065027 22:35356875-35356897 GAGCAGGGGGTAGGGGAGAGGGG - Intergenic
1183097361 22:35561155-35561177 AGGCAGGGAGAAGGGGGGAGAGG - Intergenic
1183153174 22:36053783-36053805 GGGAAGGGAGAAGGGAAGGGAGG - Intergenic
1183153187 22:36053814-36053836 GGGAAGGGAGAAGGGAAGGGAGG - Intergenic
1183184498 22:36284365-36284387 GGGCAGTGAGAAGGGCAGCGGGG - Intronic
1183325342 22:37188353-37188375 GAGCAGGGAGGAGGGGAAGTGGG - Intronic
1183352765 22:37343274-37343296 GAGCAGGGAGGAGCGGACCTGGG - Intergenic
1183410422 22:37651868-37651890 GAGCAGGTTAAGGGGGAGCGTGG + Intronic
1183464330 22:37972072-37972094 GAGAAAGGAGAGGGGGAGGGGGG + Intronic
1183503588 22:38195982-38196004 GAGGAGGAAGAAGGGGAGGAGGG + Intronic
1183584747 22:38746429-38746451 GGGCAGGTGGCAGGGGAGCGGGG + Intronic
1183615708 22:38944079-38944101 GAGCGAGGAGAAGGAGAGGGAGG - Intergenic
1183618521 22:38959430-38959452 GAGCAGGGGGAAGGAGGGTGGGG + Intronic
1183720726 22:39560003-39560025 GAGCAGAGAGAGGGTGAGAGAGG - Intergenic
1183813750 22:40281176-40281198 TAGCTGGGAGAAGGGGAGAAGGG - Exonic
1183821282 22:40347632-40347654 GGGCAGTGATAAGGGGAGGGAGG - Intronic
1184037507 22:41925725-41925747 GGGCAGGGAGTTGGGGAGCTGGG + Intronic
1184078885 22:42203769-42203791 GAGAATGGAGAAAGGGAGTGTGG + Intronic
1184272607 22:43393304-43393326 CAGCAGGGGAAAGGGGAGTGGGG - Intergenic
1184411464 22:44328764-44328786 GGGCAGGGAGGAGGGGAGGGTGG - Intergenic
1184460550 22:44635314-44635336 TGGCAGGGAGAAGGGGAGAAGGG + Intergenic
1184461505 22:44640431-44640453 GAGGAGGGAGGAGGGGAGGAGGG + Intergenic
1184515789 22:44961400-44961422 GAGAGGGAAGGAGGGGAGCGAGG - Intronic
1184527624 22:45034900-45034922 AAGCAGGAAGAAAGGGAGGGAGG + Intergenic
1184639835 22:45864724-45864746 GAGCAGGGAGGGGGAGAGCCTGG - Intergenic
1184697781 22:46149820-46149842 GAGGAGGGTGAAGGGCAACGCGG - Intergenic
1184711039 22:46249753-46249775 GAGCGGGGGGTTGGGGAGCGGGG + Intronic
1184850085 22:47115018-47115040 GAGCAGGGAGTGGTGGGGCGGGG + Intronic
1184912377 22:47544834-47544856 GAGAAGGGAGATGGGGAGCATGG + Intergenic
1184979278 22:48084672-48084694 GTGAAGGGAGAAGGGGAGTGTGG - Intergenic
1185022758 22:48389647-48389669 GAGCAGGGACGAGGGCACCGTGG - Intergenic
1185268599 22:49918192-49918214 GACCAGGGAGGAGGCGGGCGAGG - Intronic
1185281915 22:49975889-49975911 CAGCAGGGAGATAGGGAGGGAGG + Intergenic
1185345193 22:50307780-50307802 GAGGGGGGAGAGGGGGAGGGGGG + Intergenic
1185368267 22:50446765-50446787 GAGCAGGCAGCCGGGGAGTGGGG + Exonic
1185419896 22:50729346-50729368 GGGCAGGGAGAGGGGGTGGGAGG + Intergenic
1203251384 22_KI270733v1_random:120937-120959 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203259430 22_KI270733v1_random:166011-166033 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
949250087 3:1973158-1973180 GAGGAGGGAGAGGAGGAGGGAGG + Intergenic
949364276 3:3263691-3263713 GAGGAGGTAGAAGGGGAGGCAGG + Intergenic
949364379 3:3264812-3264834 GAGGAGGTAGAAGGGGAGGCAGG - Intergenic
950118773 3:10468146-10468168 GGGCAGAGAGGAGGGGAGCAGGG - Intronic
950127704 3:10520296-10520318 GAGCAAGCAGCAGGGGAGGGGGG + Intronic
950282602 3:11720203-11720225 GAGCCGGGGGAAGCGGAGGGCGG - Intronic
950283292 3:11725134-11725156 GAGGAAGGAGAAGAGGAGAGAGG - Intergenic
950327174 3:12121703-12121725 GAGGAGGGAGGAAGGGAGGGAGG + Intronic
950352760 3:12373285-12373307 GGGAAGGGAGAAGGGCAGGGGGG + Intronic
950393066 3:12711877-12711899 GAGCGGGGAGGAGAGGAGAGGGG - Intergenic
950404749 3:12797349-12797371 GGGGAGGGAGACGGGGAGGGAGG - Intronic
950416008 3:12869338-12869360 GAGCAGGCAGTAGGGCAGTGAGG + Intronic
950473916 3:13204015-13204037 GGGCGGGGGGAAGGGGAGCTGGG - Intergenic
950507434 3:13403961-13403983 GAGCAGGCCCCAGGGGAGCGGGG - Intronic
950556887 3:13701368-13701390 GAACAGCGAGAAGGGCAGAGTGG - Intergenic
950725399 3:14913889-14913911 GAGGAGGGAGAGGGGAAACGGGG - Intronic
951443179 3:22746485-22746507 GAGCAGGCAGAAGGGATGGGAGG - Intergenic
951706141 3:25546039-25546061 GGGAGGGGAGAAGGGGAGAGAGG + Intronic
951738065 3:25889700-25889722 CAGTGGGGAGCAGGGGAGCGAGG - Intergenic
952002006 3:28796829-28796851 GAGCAGAGAGAAGAGGGGTGAGG + Intergenic
952195285 3:31068792-31068814 GAGCAGCGAGAAAGAGAGTGAGG - Intergenic
952500936 3:33961345-33961367 GAGCAGCTAAAAGGGGAGCAGGG + Intergenic
952504837 3:33998397-33998419 GAGCTGGGAGCATGGGAGTGGGG + Intergenic
952967568 3:38630757-38630779 GCTAAGGGAGAAGGGGAGGGAGG - Intronic
953834207 3:46329063-46329085 GAGCCGGGGGAGGGGGAGAGCGG + Intergenic
953871290 3:46629692-46629714 GAGCAGGGAGAGGAGGAGAATGG + Intergenic
954259037 3:49425511-49425533 GAGCAGAGAGAAGGGCCGCTGGG + Intronic
954325348 3:49860446-49860468 GAGCAGGGTCCAGGGGAGGGTGG - Intronic
954467866 3:50667425-50667447 GAGCTGGTAGGAGGGGAGCAAGG + Intergenic
954581135 3:51703521-51703543 GAGCTGGGAGGAAGGGAGGGAGG - Intronic
954759116 3:52861251-52861273 GAGAGGGGAGAAGGGGAAGGTGG + Intronic
955300216 3:57771176-57771198 GAGAAGGGAGGAGAGGAGAGGGG - Intronic
955377513 3:58410662-58410684 GAGCTGGGTGAAGGGCAGCTGGG - Intronic
955406495 3:58629011-58629033 GAACAGGGAGAAAAGGAGTGGGG - Intergenic
955616572 3:60814349-60814371 GAGCAGGGAAGAAGGGAGAGGGG - Intronic
955620626 3:60859577-60859599 GAGAAGGGAAAAGGAGAGTGAGG - Intronic
956121097 3:65966613-65966635 GAGCGGGGAGAGTGGGGGCGCGG + Intronic
956161948 3:66364430-66364452 GGGTATGGAGAAAGGGAGCGAGG + Intronic
956432095 3:69197592-69197614 GAGAGGGGAGAGGGGGAGCGGGG + Intronic
956741587 3:72280017-72280039 GAGCAGGGAGGAAGGAGGCGAGG + Intergenic
956779443 3:72592609-72592631 GAGAAGGGAGCAGGGGATGGAGG + Intergenic
957223104 3:77410465-77410487 GAAGAGGGAGAAGGGGAAGGAGG - Intronic
957315458 3:78570324-78570346 GAGCACGGAGAAAGTGAGCCAGG - Intergenic
957356525 3:79094922-79094944 GAGGAGGGAGAGAGGGAGAGAGG - Intronic
957426784 3:80050730-80050752 GAGGAGGTAGAAGGGGAGGCAGG + Intergenic
957445124 3:80307186-80307208 GGGAAGGGAGAGAGGGAGCGAGG - Intergenic
957607690 3:82423824-82423846 GAGAAGGGAGAAGGGCAGCATGG - Intergenic
957916256 3:86692024-86692046 GGGAAGGGAGAAAGGGAGAGAGG + Intergenic
957940102 3:86992586-86992608 GAGCAGAGAGACAGGGAGTGGGG - Intergenic
958431193 3:94043602-94043624 GAGGAGGGGGAGGGGGAGAGGGG - Intronic
958542492 3:95497072-95497094 GAGCAGGGAAAAAGGGAGAGAGG - Intergenic
958878092 3:99638402-99638424 GGGCGGGGGGAGGGGGAGCGCGG - Intergenic
959001758 3:100971997-100972019 GGGCAGGGAGAAGGGCAGCTGGG + Intronic
959704373 3:109325996-109326018 TAGCAGGGAGACAGGGAGTGGGG + Intergenic
959865600 3:111266629-111266651 GAGTTGGGAAAAGGGGAGCTTGG - Intronic
959922098 3:111879550-111879572 GAGGAGGTAGAAGGGGAGGCAGG + Intronic
960313857 3:116151613-116151635 GAGCAGGGTGGAGGAGAGCCAGG + Intronic
960590232 3:119358829-119358851 GAGCTGGGAGAAGGGGAAATGGG + Intronic
960943832 3:122952710-122952732 GAGCAGGGAGGAGGAGAGCCAGG - Intronic
960955469 3:123027754-123027776 GAGCAGGGAGGAGGAGACCGCGG + Intronic
960992921 3:123323527-123323549 GGGCAGGGAGATGGGGAGGAGGG - Intronic
961039358 3:123666355-123666377 GGACAGGGAGAAAGTGAGCGAGG + Intronic
961471770 3:127118554-127118576 CAGCCTGCAGAAGGGGAGCGTGG - Intergenic
961518266 3:127451912-127451934 GAGAATGGAGAAGGGGAGAGGGG - Intergenic
961538828 3:127586852-127586874 GGGCAGGGAGTAGGAGAGTGGGG + Intronic
961660269 3:128464933-128464955 GAGAAGGGGGAAGGGGAGGGAGG - Intronic
962089293 3:132226446-132226468 GAGCAGGCAGTAGGGGAAGGAGG - Intronic
962120661 3:132556955-132556977 GAGCAGAGGAAAGGGGAGGGGGG - Intergenic
962174889 3:133142565-133142587 GAGCAGGGACATGTGGAGTGTGG - Intronic
962258516 3:133887985-133888007 GAGCAGGGAGGAGGGAAGCAGGG - Intronic
962382432 3:134908725-134908747 GAGGAGGGAGAAGGAAAGAGAGG + Intronic
962391281 3:134974908-134974930 GAGAAGGAAGAAGGGCAGGGAGG - Intronic
962559533 3:136591257-136591279 GAGGAGGGAGGAGGGGAGGAGGG + Intronic
962621664 3:137186306-137186328 GAGAAAGGAGAAGGAGAGGGAGG + Intergenic
962745060 3:138390735-138390757 TAGCAGGGAGGAGGGGTGTGTGG - Intronic
963822939 3:149919400-149919422 GGGCATGGAGAAGGGTAGTGAGG - Intronic
963907981 3:150789579-150789601 GAGCATGGAGAAAGGTATCGAGG + Intergenic
963922144 3:150916160-150916182 AGGCAGGGAGAAGGGGAGGAAGG - Intronic
964297309 3:155247780-155247802 GAGGAGGTAGAAGGGGAGGCAGG + Intergenic
964377266 3:156060588-156060610 AAGGAGGGAGAAAGGGAGGGAGG - Intronic
964580762 3:158234669-158234691 GAACAGGGAGAAGAGGATTGGGG - Intronic
964925499 3:161951635-161951657 GAGCAGGAGGCAGGGGAACGTGG + Intergenic
965360836 3:167735665-167735687 GAGGAGGGAGAGGCGGAGCTTGG + Intronic
966123637 3:176550093-176550115 GAGCAGGGAGCAAGGAAGGGTGG - Intergenic
966168465 3:177049324-177049346 GGGCAGGGGGTAGCGGAGCGAGG + Intronic
966305859 3:178533920-178533942 GAGAAGGGAGAAGAGGGGAGGGG - Intronic
966559201 3:181300110-181300132 GGGGAAGGAGAAGGGGAGGGAGG + Intergenic
967635677 3:191799948-191799970 CAGCAGGGAGAAGGGAAAAGGGG + Intergenic
967635678 3:191799955-191799977 GAGAAGGGAAAAGGGGAGTGTGG + Intergenic
967703726 3:192624451-192624473 GAGCAGAGAGAAGAGGAGGAAGG + Intronic
967856603 3:194122653-194122675 GGGCAGGGAGAAGGAGAGGGAGG - Intergenic
967988152 3:195111413-195111435 GAGAGGGGAGATGGGGAGAGAGG + Intronic
968150281 3:196332417-196332439 GAGGAGGGAGAGAGGGAGGGAGG + Intronic
968232482 3:197011947-197011969 GAGCAGGGAGAGGTGCAGGGAGG - Intronic
968262436 3:197335847-197335869 CAGCAAGAAGAAGGGGAGAGGGG + Intergenic
968434306 4:576723-576745 ATGCAGGGAGAGGGGGAGAGGGG + Intergenic
968718470 4:2179805-2179827 GAGCAAGGAGGAGGGGAGGCAGG - Intronic
968781253 4:2583412-2583434 CAGCAGGGGGAAGGGAAGAGAGG - Intronic
968862107 4:3180792-3180814 GTGCAGGGGGATGGGGAGGGAGG + Intronic
968936708 4:3614831-3614853 GGGCAGGGAGATGTGGAGTGAGG - Intergenic
968991648 4:3917357-3917379 GAGGGGGGAGAAAGGGAGGGAGG + Intergenic
969196462 4:5567284-5567306 GACCAGGGTGAGGGGGAGGGTGG - Intronic
969198108 4:5579173-5579195 GAGTAGGGAGAAAGGGAGGTAGG + Intronic
969198755 4:5584884-5584906 GAGCAGTGAGTAGAGGAGGGTGG + Intronic
969228992 4:5816682-5816704 GAGAGGGGAGAAGGGAAGGGAGG - Intronic
969232440 4:5841185-5841207 GAGGAGGGAGGGGTGGAGCGGGG - Intronic
969370307 4:6727617-6727639 GAGGAGGGGGAAGGGGAGGAGGG - Intergenic
969454864 4:7295074-7295096 GAGAAGGGAGAGGGGGAGGAGGG - Intronic
969464302 4:7345797-7345819 GAGCATGGAGTTGGGGAGAGAGG - Intronic
969639352 4:8387784-8387806 GCGCAGGGAGGGGCGGAGCGAGG - Intronic
970413997 4:15838519-15838541 CAGAAGGGAGCAGGGGAGCAGGG - Intronic
970448074 4:16140495-16140517 GAGCTGGGGGAAGGGGTGGGTGG - Intergenic
970546044 4:17131529-17131551 GAGCAGGGCCAAGGGGAGGTTGG - Intergenic
970760558 4:19480939-19480961 GAGGAGGGAGTAAGGGAGGGAGG - Intergenic
970858178 4:20672579-20672601 GAGCTGGGAGAAGGGAAGCCAGG + Intergenic
971174272 4:24265861-24265883 GAGAAGGAAGAAAGGGAGGGAGG + Intergenic
971251267 4:24975330-24975352 GAGAAGGGGGAAGGAGAGGGAGG + Intronic
971352036 4:25863228-25863250 GAGCAGAGAGAAAGGGAAAGGGG - Intronic
971372459 4:26029603-26029625 AGGCAGGGATATGGGGAGCGAGG + Intergenic
971496393 4:27270428-27270450 AAGCAGGGAGAAAGGGATCAAGG - Intergenic
971757225 4:30720294-30720316 GAGGAGAGAGAAAGGGAGGGAGG + Intergenic
971864837 4:32156290-32156312 GGGGAGGGAGGAGGGGAGAGGGG - Intergenic
972766539 4:42156655-42156677 GAGCAAGGAGGAGAGGAGAGAGG + Intergenic
972909881 4:43801272-43801294 GAGCAGGAGGAAGAGGAGAGAGG + Intergenic
973172543 4:47163537-47163559 GAGTGGGGAGAAGGGGAGTGTGG + Intronic
973818980 4:54645946-54645968 CAGCAGGGAGAAGGGGACAGGGG - Intergenic
974005341 4:56551022-56551044 GAGGAGGCAGTAGGGGAGAGGGG - Intronic
974330549 4:60472012-60472034 GAGCAGGGAGGTAGGGAGAGGGG + Intergenic
975217787 4:71776491-71776513 CTGCAGGGAGAAGAGGAGGGAGG + Intronic
975359875 4:73456737-73456759 GGGCAGGGAAAAGGGTAGAGGGG + Intergenic
975758826 4:77597989-77598011 GAGCTTGGAGAAGGGGAGACAGG + Intronic
975887837 4:78986243-78986265 GAGAAGTGAGAAGTGGAGGGAGG - Intergenic
976184174 4:82429208-82429230 GCGCTGGGGGAGGGGGAGCGGGG + Intronic
976266163 4:83186985-83187007 GAGAGGGGAGAAGGAGAGGGAGG + Intergenic
976844020 4:89466184-89466206 GAGCAGGGAGGGAGGAAGCGAGG - Intergenic
977003756 4:91538605-91538627 GGGCAGGGAGAAGGAGAAAGTGG - Intronic
977569200 4:98612228-98612250 GTGAAGGGAGAAGAGGAGTGGGG + Intronic
978194438 4:105954440-105954462 GAACAGGAAGAAGGTGAGAGTGG - Intronic
978638266 4:110837950-110837972 GAACAGGAAGAAGGTGAGCTGGG - Intergenic
978905894 4:114005079-114005101 GAGCAGGGAGCAGGGAAGACTGG - Intergenic
979459718 4:120968134-120968156 GAGGAGGTAGAAGGGGAGGCAGG - Intergenic
979943378 4:126792373-126792395 GAGGAGGGAGATGTGGAGCTAGG - Intergenic
981270927 4:142846590-142846612 GAGGAGGAGGAAGAGGAGCGGGG - Intronic
981345381 4:143669919-143669941 GAGAAGGGAGGAAGGGAGCAGGG - Intronic
981386501 4:144137733-144137755 GAGGAGGGAGAGAGGGAGGGAGG - Intronic
981495756 4:145390540-145390562 AAGGATGGAGAAGGGGAGAGAGG + Intergenic
981504294 4:145482405-145482427 GAGCGCGCGGAAGGGGAGCGCGG - Intronic
981616356 4:146648253-146648275 GGGCGGGGAGGAGGGGAGAGGGG - Intergenic
981964279 4:150581992-150582014 GAGCACGAGGAAGGGGGGCGGGG + Exonic
982358252 4:154491833-154491855 GAGGAGGGAGAGAGGGAGGGGGG + Intergenic
982627740 4:157788711-157788733 GAGCAGGGAGAAGGATAGTGTGG + Intergenic
982841054 4:160187032-160187054 GAATAGAGAGAAGGGGAGCTAGG - Intergenic
983575413 4:169256233-169256255 GAGAAGGAAGAAAGGGAGGGAGG + Intronic
983906201 4:173184613-173184635 GACCAGGGAGAGGGAGAGGGAGG + Intronic
984070380 4:175103515-175103537 GAGTAGGGAGAAGGGAGGAGTGG + Intergenic
984639245 4:182144456-182144478 GGGCGGGGAGAGGGGGAGCGCGG + Intronic
984911438 4:184676933-184676955 GGGAAGGGAGAAGGGGAAGGGGG - Intronic
984914304 4:184707361-184707383 CTGCAGGGGGCAGGGGAGCGGGG - Intronic
984943761 4:184955344-184955366 GGGCAGGGAGAAGGGCAGTCGGG + Intergenic
985216847 4:187662569-187662591 GAGCAGGCAGGAGGGGAAGGAGG - Intergenic
985321865 4:188721650-188721672 GAGAAGGGAGAAGGAGGGGGAGG + Intergenic
985749702 5:1667275-1667297 GAGGGGGGAGGAGGGGAGGGCGG - Intergenic
986127399 5:4895697-4895719 GAGCAGGGATAAGGGGTGTGGGG - Intergenic
986690280 5:10308010-10308032 GTGCAGGGAGAGGGGGTGGGAGG + Exonic
987601725 5:20080714-20080736 GATTAGGAAGAAGGGGAGAGAGG + Intronic
988006493 5:25418479-25418501 GAGCAGGAGGAAGGGGAGGGAGG + Intergenic
988720741 5:33876600-33876622 AAGGAGGGAGGAGGGGAGGGAGG + Intronic
988801199 5:34698158-34698180 GGGAAGGGAGGAGGGGAGGGAGG - Intronic
989076204 5:37564590-37564612 GAGGAGGGAGAGGGAGAGCGAGG + Intronic
989318197 5:40106048-40106070 CACCAGGGAAATGGGGAGCGGGG + Intergenic
990155073 5:52867638-52867660 GAGAAGGGATAGGGGAAGCGAGG - Intronic
990315248 5:54577354-54577376 GAGGTGGGAGGAGGGGAGGGGGG - Intergenic
990437844 5:55811708-55811730 GAGCAGGGAGATGGGAAACTGGG + Intronic
990858969 5:60304267-60304289 GAGCAGAAAGTAGGGGAGAGAGG + Intronic
991095976 5:62739993-62740015 GGGGAGGGACAAGGGGAGGGAGG - Intergenic
991540312 5:67720483-67720505 GAGGAGGGAGAAGAGGAGAGGGG - Intergenic
991690109 5:69217649-69217671 TAGTAGGGAGAAGGGGTGGGCGG + Intergenic
991936976 5:71811497-71811519 GAGAAGGGAGAAGGGAGGCCAGG + Intergenic
992385926 5:76284657-76284679 GGGAAGGGAGAAGGGAAGCAAGG + Intronic
992605137 5:78448025-78448047 GAACGGGGAGAAGGGGAGGAGGG - Intronic
992896090 5:81246268-81246290 GGGCAGGGTGTAGGGGAGCCAGG - Intronic
993373360 5:87119164-87119186 GAGAAGGGAGAAGAGGAAAGCGG + Intergenic
995644980 5:114301529-114301551 TACCAGGGAGAAGGGGAGAATGG - Intergenic
996202860 5:120698160-120698182 GAGCAGGGTGAGGGGTGGCGTGG + Intergenic
997114077 5:131106831-131106853 CTGCAGGGAGGAGGGGAGTGGGG + Intergenic
997180101 5:131819443-131819465 GAGGAGGGACAGGGGGAGGGAGG + Intronic
997271845 5:132546310-132546332 GTGCTGGGAGAATGGGGGCGGGG - Intronic
997297333 5:132776562-132776584 GAGCGGGGCAGAGGGGAGCGGGG + Intronic
997338237 5:133122670-133122692 GAGAAGATAGAAGGGGAGCGAGG - Intergenic
997625887 5:135330345-135330367 TAGTGGGGAGAAGGGGAGTGAGG + Intronic
997729776 5:136160405-136160427 GAAGAGGTAGAAGGGGAGGGTGG - Intronic
997758976 5:136426485-136426507 GAGTAGGCAAAAGGGGAGAGTGG - Intergenic
998022054 5:138777904-138777926 GAGGAGGGAGAGGGGGAGGAGGG + Intronic
998022061 5:138777919-138777941 GAGGAGGGAGAGGGGGAGGAGGG + Intronic
998022068 5:138777934-138777956 GAGGAGGGAGAGGGGGAGGAGGG + Intronic
998130042 5:139647261-139647283 GGGGAGGGAGAGGGGGAGGGCGG - Intergenic
998161502 5:139815186-139815208 GTGGAGGGAGAAGTGGAGGGAGG - Intronic
998267149 5:140674669-140674691 GAGCAGGGAAGAGGTGAGGGAGG - Exonic
998353359 5:141515218-141515240 GAGCAGGGAGGAGGTGACCCAGG + Exonic
998367226 5:141639436-141639458 CAGCAGGGAGGAGGGGAGTGAGG - Exonic
998451216 5:142235821-142235843 GAGCAGGGAGTGGGGGTGGGGGG + Intergenic
998540844 5:142980054-142980076 CTGGAGGGAGAAGGGGAGCGAGG - Intronic
998584743 5:143415347-143415369 GGGCAGGGGGAAGGGGAGGATGG + Intronic
998731864 5:145087133-145087155 GAGGAGGAAGAAAGGGAGCAAGG - Intergenic
998831086 5:146159959-146159981 AACCAGGGAGAATGGGAGGGTGG - Intronic
999114999 5:149155163-149155185 GAGCAGGGAGGAGGGAAAGGAGG - Intronic
999287395 5:150402346-150402368 GAGCAGGGGGCAGGGGAGGGTGG - Intronic
999330645 5:150671681-150671703 AAGCTGGGGGAAGGGGAGCGCGG + Intronic
999390309 5:151184894-151184916 TAGGAGGGAGATGGGGAGCCAGG - Intronic
999551698 5:152694573-152694595 GAGGAGGAAGAAGTGGAGCTTGG - Intergenic
999695516 5:154185479-154185501 GACCAGGAAGAAGGAGAGTGTGG + Intronic
999742674 5:154568521-154568543 GAGATGGGGGAAGGGGAGAGAGG + Intergenic
1000731430 5:164838777-164838799 GGGAGGGGGGAAGGGGAGCGGGG - Intergenic
1000752462 5:165113880-165113902 GAGGAGGTGGAAGGGGAGCCTGG - Intergenic
1000924870 5:167180892-167180914 GAGGAGGTAAAAGGGGAGCCAGG + Intergenic
1001303145 5:170552591-170552613 AGTCAGGGAGAAGGGGAGTGAGG + Intronic
1001370598 5:171196628-171196650 GAGCAGGGGGATGGGGCGAGGGG + Intronic
1001543703 5:172557098-172557120 GAGGAGGGAGGGGGGGAGCTGGG - Intergenic
1001564860 5:172693335-172693357 GAGCTGGGAGTAGGGGAATGGGG + Intergenic
1001826017 5:174745661-174745683 GAGAAGAGAGCAGGGGAGGGAGG - Intergenic
1001854937 5:175002971-175002993 GGGGAGGGAGAAAGGGAGCGAGG - Intergenic
1001893377 5:175358278-175358300 GAGCATGGAGAAGGGGAAGGAGG - Intergenic
1002066628 5:176655092-176655114 GAGCAGGGCAGAGCGGAGCGGGG - Intronic
1002094772 5:176824263-176824285 GATCAGGGACAAGCGGAGGGAGG + Intronic
1002436643 5:179235672-179235694 GAGGAAGGAGAGGGGAAGCGGGG + Intronic
1002518690 5:179777924-179777946 GAGCAGGGAGCAGGGCAGCCTGG + Intronic
1002691513 5:181053489-181053511 GAGAAGAGACAAGGTGAGCGGGG + Exonic
1002835440 6:861517-861539 GGGCAGGCAGAAGGTGTGCGGGG - Intergenic
1002925263 6:1602106-1602128 GAGCAGGGAAAAGGAGAGAGTGG - Intergenic
1002930558 6:1631655-1631677 GAGAAGGAGGAAGGGGAGTGAGG - Intronic
1003088019 6:3076990-3077012 GAGTAGGGAGCAGGGGTGGGTGG + Intronic
1003119972 6:3311220-3311242 GAGCAGGGACTGGGGGAGGGAGG + Intronic
1003123773 6:3339061-3339083 GAGCAGGGTCGAGGGGAGGGAGG + Intronic
1003125030 6:3349155-3349177 GAGCAGGGAGAAGTGCCCCGCGG - Intronic
1003126360 6:3359171-3359193 GGGCACCGAGAAGGAGAGCGAGG + Intronic
1003135439 6:3431408-3431430 GGGAAGGGAGAAAGGGAGGGAGG + Intronic
1003442417 6:6155442-6155464 GAGCAGGGAGAAGGATGGGGAGG + Intronic
1003491749 6:6628289-6628311 GAGAAGGAAGAAGGGGAGGGAGG - Intronic
1003748291 6:9026495-9026517 GCACAGGGAGACGGGGAGCGGGG + Intergenic
1003869388 6:10390218-10390240 GAGCTTAGAGAATGGGAGCGCGG + Intergenic
1003990341 6:11480560-11480582 GGGCAGGGAGAAGGAGTGGGAGG + Intergenic
1004105172 6:12660877-12660899 CAGGAGGGAGAACGGGAGCCAGG + Intergenic
1004273066 6:14212024-14212046 GAGCAGGGAGTAGAGGGGGGCGG - Intergenic
1005008297 6:21311968-21311990 GAGAAGGCAGAAGGGGAGTAGGG - Intergenic
1005132044 6:22520502-22520524 GAGAAGGGAGAAGGGGGAAGGGG + Intergenic
1005133745 6:22542568-22542590 GAGCAGGAAGAAAGAGAGCTGGG - Intergenic
1006167093 6:32071394-32071416 GTGCTGGGAGAAGGGGCGAGGGG - Intronic
1006187103 6:32187788-32187810 GAGGAGGGAGAAGAGCAGTGAGG + Intronic
1006253527 6:32811172-32811194 AAGCAGGGAGAGGGGCAGTGGGG - Intergenic
1006278093 6:33022156-33022178 GATCAGGGAGGAGAGGCGCGGGG + Intergenic
1006303753 6:33207336-33207358 GAGGAGGAGGAAGGGGAGGGGGG + Intergenic
1006304664 6:33211811-33211833 CAGCAGGAAGCAGGGGAGCCAGG + Exonic
1006334830 6:33415036-33415058 GAGGAGGCAGAAGGGGAAAGTGG + Exonic
1006423319 6:33948919-33948941 GTGCAGGAAGACGGGGAGCAGGG + Intergenic
1006614031 6:35312574-35312596 GTGCAGGGCGAAGGGGGGCCTGG + Intronic
1006934064 6:37705353-37705375 GAGAAAGGAGAAGGGGAGGAGGG + Intergenic
1007371184 6:41427855-41427877 GCGCAGGGGCAGGGGGAGCGGGG + Intergenic
1007444505 6:41894994-41895016 GAGCCGGGAGTCGGGGCGCGCGG - Intronic
1007557955 6:42782595-42782617 GAGCGGGGAGAGGGAGAGCCCGG + Intronic
1007585118 6:42984692-42984714 GAAAAAGGAGAAGGTGAGCGTGG + Exonic
1007634171 6:43287945-43287967 GAGCTGGGAAATGGGGAGCCTGG - Exonic
1007722215 6:43891731-43891753 GAGGAGAGAAAAGGGGAGGGTGG + Intergenic
1007808280 6:44467406-44467428 GAAGAGGGAGAAGAGGTGCGTGG + Intergenic
1007927730 6:45663506-45663528 GGGCAGGGAGGAGGGCACCGTGG + Intronic
1007939998 6:45771646-45771668 GGGCAGGCAGAAGGGGAAGGCGG - Intergenic
1008047818 6:46869417-46869439 GAGGAGGTTGGAGGGGAGCGTGG - Intronic
1008050774 6:46898487-46898509 AAGGAGGGAGAAAGGGAGCATGG + Intronic
1008064770 6:47035901-47035923 GAGCAGAGAGAGAGGGAGAGGGG + Intronic
1008461350 6:51777531-51777553 GAGCAGAAAGAAGGGAAGCAGGG + Intronic
1008674838 6:53808153-53808175 AAGCAGGGAGACTGGGAGAGGGG + Intronic
1008979813 6:57470405-57470427 GAGAGGGGAGAGGGGGAGAGGGG - Intronic
1008979820 6:57470420-57470442 GAGAGGGGAGAGGGGGAGAGGGG - Intronic
1008979827 6:57470435-57470457 GAGAGGGGAGAGGGGGAGAGGGG - Intronic
1009441745 6:63688258-63688280 GAGGGGGGAGGAGGGGAGGGGGG - Intronic
1010059262 6:71603891-71603913 GAGGAGGGAGAGGGAGAGGGAGG - Intergenic
1010123282 6:72404889-72404911 GAGCAGGGAGAGGGAGAGGGAGG - Intergenic
1010492646 6:76493548-76493570 AACCAGGGAAATGGGGAGCGGGG - Intergenic
1010577076 6:77544841-77544863 GAGCAGGGAGAAGTGAAAGGGGG + Intergenic
1010687203 6:78867231-78867253 GAGGAAGGAGAAGAGTAGCGAGG - Intergenic
1011105044 6:83770043-83770065 GAGAAGAGAGAAAGGGAGAGAGG + Intergenic
1011402329 6:86977178-86977200 GAGGAGGGAGAGGGGGAAGGGGG - Intronic
1011523644 6:88239051-88239073 ATGCAGGGAGAAGGGGAGTTAGG + Intergenic
1013410163 6:109876707-109876729 AAGCAGGAAGACTGGGAGCGGGG + Intergenic
1013507710 6:110815908-110815930 GAGCAGCGGGACGGGGGGCGGGG - Intronic
1013534183 6:111048320-111048342 GAGCAGGGAGAAGGGGAAATGGG - Intergenic
1014688227 6:124530459-124530481 GAGCAGGTAGAATGGGAGGCAGG + Intronic
1014931344 6:127340371-127340393 GAGGAGGGAGAAAGGGAGAGAGG - Intronic
1014999183 6:128192911-128192933 AAGAAGGGAGAAAGGGAGAGGGG + Intronic
1015097185 6:129429739-129429761 GAATAGGGAGGAAGGGAGCGAGG + Intronic
1015263560 6:131265535-131265557 GAGGAGGGAGTTGGGGAGCTAGG + Intronic
1015263762 6:131268014-131268036 AAGAAGGGAGAAAGGGAGGGAGG + Intronic
1015786057 6:136922352-136922374 GAGCCGGGAGCAGCGGAGTGAGG - Exonic
1017018811 6:150123728-150123750 GGGCAGGGAGAGGGAGAGGGAGG - Intergenic
1017027423 6:150193604-150193626 GGGCTGGGAGAAGGGGAGGAGGG + Intronic
1017103489 6:150867091-150867113 GAGATGGGAGAAGGGGAGTGGGG - Intronic
1017272043 6:152518476-152518498 GCGGAAGGAGAAGGGGAGCAGGG - Intronic
1017637340 6:156456153-156456175 GAGAGGGGAGGAGGGGAGGGAGG - Intergenic
1017721190 6:157244217-157244239 GAGCAGGGGGAAGGAGAGGAGGG - Intergenic
1017786807 6:157763249-157763271 AGGCAGGGAAAAGGGGAGGGCGG + Intronic
1017801483 6:157900084-157900106 GGGCAGGGAGACGGGGAACTAGG - Intronic
1017875373 6:158519933-158519955 GAACAGGAGGAAGGAGAGCGAGG - Intergenic
1017957514 6:159190586-159190608 GAGCAGGGAGACGAGGAGGTAGG + Intronic
1018072565 6:160178320-160178342 GAGAAGGGAGAGGGAGAGGGAGG + Intronic
1018128595 6:160706161-160706183 GAGAAGGGAGAGAGGGAGCAAGG - Intronic
1018163385 6:161069820-161069842 GAGCAGGGAGAAGGTGGGTGAGG + Intronic
1018298643 6:162376817-162376839 GAACAGGGAGAGGGAGAGGGAGG + Intronic
1018383771 6:163284700-163284722 CAGAAGGGAGGCGGGGAGCGGGG - Intronic
1018394855 6:163370292-163370314 CAGCAGGGAGCAAGGGAGCTAGG - Intergenic
1018429789 6:163713721-163713743 GAACAGGGTGAGGGGCAGCGTGG - Intergenic
1018528926 6:164742429-164742451 GAGGAGTGAGAAGGTGAGAGGGG - Intergenic
1018616891 6:165695375-165695397 GAGCTGGGAGAAGGGAACAGAGG - Intronic
1018775447 6:167010501-167010523 GAGTAGGGAGAAGGGAAGTGAGG + Intronic
1018914058 6:168121902-168121924 GGGGAGGGAGAGGGGGAGAGAGG + Intergenic
1018924284 6:168195528-168195550 GAGCAGGGGGAGGAGGAGGGAGG - Intergenic
1019162972 6:170081173-170081195 GAGGAGGGAGAAGAGGAGGAGGG + Intergenic
1019200736 6:170312834-170312856 GAGCAGAGTGAAGGGGTGAGGGG + Intronic
1019215289 6:170439130-170439152 GAAAATGGAGAAGGGGAGCCTGG - Intergenic
1019332333 7:466595-466617 GAGGAGGGTGAAGGAGAGTGAGG - Intergenic
1019351717 7:557096-557118 GAACTGGGAGGAGGGGAGCGCGG + Intronic
1019381792 7:727704-727726 GAGCAGGCAGGTGGGGGGCGGGG - Intronic
1019392598 7:797398-797420 GTGCAGGGAGGAGGGCAGCAGGG - Intergenic
1019410939 7:906539-906561 GAGAAGGGAGAAAGGGAGAAAGG + Intronic
1019410951 7:906594-906616 GAGAAGGGAGAAAGGGAGAAAGG + Intronic
1019475394 7:1241718-1241740 GAGCTGGGAGGAGCGGGGCGCGG + Intergenic
1019503791 7:1380402-1380424 AAGCAGGCAGGAGGGGACCGAGG + Intergenic
1019517572 7:1446572-1446594 GAGGGGGGAGGAGGGGAGAGGGG + Intronic
1019652252 7:2166341-2166363 GAGCTGGGAGAAAGAGTGCGAGG - Intronic
1019660166 7:2219680-2219702 GGGCAGGGGGAAGAGGAGCAGGG + Intronic
1019779296 7:2930107-2930129 GAGAAAGGAGAAGGGGGCCGGGG + Intronic
1019899387 7:4008060-4008082 GAGCAGGGGAAAGGGCAACGGGG - Intronic
1020080164 7:5282635-5282657 GAGGAGGTAGAAGGGGAGGGAGG + Intronic
1020361704 7:7333745-7333767 GAGCAGGGAGGTAGGGAGGGGGG - Intergenic
1020473785 7:8570738-8570760 GAGCAGAGAGAAGTGGAGTAGGG + Intronic
1021315714 7:19145115-19145137 GAGGAGGAGGAAGAGGAGCGCGG - Exonic
1021380462 7:19959762-19959784 GAGCAGGAAGAAGAGGCGAGGGG - Intergenic
1021408804 7:20304825-20304847 GAGCAGGGAGAAGGTGAGTTGGG - Intergenic
1021563486 7:21992537-21992559 GAGCTGGGATAAGGGGAGATGGG + Intergenic
1021695240 7:23269913-23269935 GGGCACAGAGAAGGGGAGAGAGG - Intronic
1021758691 7:23881952-23881974 GAGCAGGAGGAAGGGGGGCAGGG + Intergenic
1021795928 7:24254284-24254306 GAGAAGGGGGAAGGGGTGCAAGG - Intergenic
1022092079 7:27114138-27114160 CCGGAGGGAGAAGGGGAGCTCGG + Intronic
1023024633 7:36039409-36039431 CAGCAGGAAGCAGGGGAGAGCGG - Intergenic
1023170483 7:37386250-37386272 GAGCAGGTAGCTGGGGAGGGAGG + Intronic
1023777393 7:43620853-43620875 GACCTGGGAGAAGAGGAGGGCGG + Intronic
1023809668 7:43902108-43902130 GAGAAGGGAGGAGGAGAGGGAGG + Intronic
1023841645 7:44101665-44101687 GAACAGGGAGACAGGGAGCATGG - Intergenic
1024120392 7:46231270-46231292 TAGCAGGGTGGAGGGGAGCCTGG + Intergenic
1024363462 7:48493971-48493993 TAGCAGTGAGAAGGTGAGTGTGG - Intronic
1024621214 7:51159079-51159101 GAGCTTGGAGGAGGGCAGCGGGG + Intronic
1024797597 7:53036783-53036805 GGGCAGGAAGAAGGGCAGGGAGG - Exonic
1025117165 7:56268302-56268324 AAGCAGGGAGGAAGGGAGGGAGG - Intergenic
1025198749 7:56949563-56949585 GAGGAGGTAGAAGGGGAGGGAGG - Intergenic
1025198773 7:56949639-56949661 GAGGAGGGAGAAGGGGTGGGAGG - Intergenic
1025673173 7:63627294-63627316 GAGGAGGGAGAAGGGGTGGGAGG + Intergenic
1025673197 7:63627370-63627392 GAGGAGGTAGAAGGGGAGGGAGG + Intergenic
1025887749 7:65614420-65614442 GAGGAGGAAGAAGGGGAAGGAGG - Intergenic
1025970738 7:66322405-66322427 GAGCAGCAAGGAGGGGAGTGGGG - Intronic
1025976145 7:66371560-66371582 AAGGAGGGAGAAAGGGAGGGAGG + Intronic
1026035126 7:66825148-66825170 GGGCAGGGACAAGGGAAGGGAGG - Intergenic
1026162646 7:67883267-67883289 AAGGAGGGAGACGGGGAGGGAGG - Intergenic
1026191911 7:68136505-68136527 GAGGAGGGAGGAGGGGAAGGAGG + Intergenic
1026191919 7:68136524-68136546 GAGGAGGGAGGAGGGGAAGGAGG + Intergenic
1026191927 7:68136543-68136565 GAGGAGGGAGGAGGGGAAGGAGG + Intergenic
1026360974 7:69600178-69600200 GCGCAGGGGAAAGGCGAGCGAGG - Intronic
1026432668 7:70362658-70362680 GAGGAGAGAGAAAGGGAGGGAGG - Intronic
1026479337 7:70764823-70764845 GGGCAGGGAGAGGGGGAACGGGG - Exonic
1026494213 7:70888469-70888491 GAGAAGGGAGAAAGGGAGGGAGG + Intergenic
1026643810 7:72150640-72150662 GAGCAGAGAGAACGTGAGAGGGG + Intronic
1026662814 7:72317150-72317172 AAGAAGGGAGCAGGGGAGGGAGG + Intronic
1026905063 7:74058087-74058109 GAGGAGGGAGAAGGAGAAGGAGG - Intronic
1026907810 7:74072784-74072806 GAGAAGGCCGAAGGGGAGCCAGG - Intergenic
1027222666 7:76223925-76223947 GAGAAGGGAGAGGGGGAGGGGGG - Intronic
1027222713 7:76224043-76224065 GAGAAGGGAGAGGGAGAGAGGGG - Intronic
1027397163 7:77767816-77767838 GGGGAGGGAGAAGGGGGGAGGGG - Intronic
1027486759 7:78771165-78771187 GAGAGGGGAGAAGGAGAGAGAGG - Intronic
1027545947 7:79527861-79527883 GAGAAGGAAGAAGAGGAGGGAGG - Intergenic
1028112173 7:86954127-86954149 TAGGAGGGAGAAGGGGATGGTGG - Intronic
1028223131 7:88219837-88219859 GCGCAGGGAGAAGCCGAGGGCGG + Intronic
1028427979 7:90712298-90712320 GGGCAGGGGGAAGGGGAATGGGG - Intronic
1028680837 7:93529286-93529308 GAGCAGGAACAAGGAGAGAGTGG - Intronic
1029129937 7:98322294-98322316 GAGCTGGGACAAGGGAAGCCTGG - Intronic
1029232033 7:99078502-99078524 GAGGAGGGTGCAGGGGAGGGGGG - Intronic
1029409506 7:100399669-100399691 TGGAAGGGAGAAGGGGAGTGTGG + Intronic
1029482907 7:100823770-100823792 GAGCATGGTGAAGCGCAGCGTGG + Exonic
1029708167 7:102286352-102286374 CAGCAGGGACAATGGGAGCCTGG - Intronic
1029726350 7:102408174-102408196 AAGCAAGAAGAAGGGGAGTGAGG + Intronic
1029981765 7:104885771-104885793 GGGTGGGGAGAAGGGGAGGGGGG - Intronic
1030270221 7:107661825-107661847 GCGTAGAGAGAAGCGGAGCGGGG + Intronic
1030471673 7:109971714-109971736 GAGAAGGGAGAATGGGAGAATGG + Intergenic
1030553671 7:110996362-110996384 GAGCAGAGAGAACGAGAGGGGGG + Intronic
1030566474 7:111164100-111164122 GGGGAGGGAGAAGGGGAGGGAGG + Intronic
1031209790 7:118808372-118808394 GAGGAGGTGGAAGGGGAGAGAGG + Intergenic
1031219364 7:118945578-118945600 TGGAAGGGAGAAGGGGAGTGCGG + Intergenic
1031323851 7:120366925-120366947 AAGAAGGGAGAAAGGGAGGGAGG - Intronic
1031540617 7:122990858-122990880 GAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1032339121 7:131054542-131054564 GAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1032504213 7:132423763-132423785 CAGGAGAGAGAAGGGGAGGGAGG - Intronic
1032783705 7:135184522-135184544 CAAGAGGGAGAAGGGGAGTGAGG + Exonic
1032801052 7:135317579-135317601 GAGCAGGAAGAAGGGCTGCGGGG - Intergenic
1033164163 7:139024987-139025009 GAGCAGGGAGGAAGGGAGAAGGG + Intergenic
1033456899 7:141511324-141511346 AAGCTGAGAGAAGGGGAGGGGGG + Intergenic
1033644261 7:143288563-143288585 GAGCCCAGGGAAGGGGAGCGTGG + Intronic
1033648610 7:143323289-143323311 GCCCTGGGAGAGGGGGAGCGAGG - Exonic
1033755919 7:144398418-144398440 GGGCATGGAGAAGGGGAAAGTGG + Exonic
1034065799 7:148135851-148135873 GAGCAGAGGGGAGGGGAGGGGGG + Intronic
1034214712 7:149396465-149396487 GAGCAGTGAGAAGGGTAGTGTGG + Intergenic
1034404186 7:150891299-150891321 GAGGAAGGAGAAAGGGAGAGAGG + Intergenic
1034413308 7:150952449-150952471 GAGCAGGTCGAAGGGGATGGCGG + Exonic
1034422333 7:150996320-150996342 GGGCAGGGAGGAGGGGTGCAGGG - Intronic
1034439872 7:151081141-151081163 GAGGCTGGTGAAGGGGAGCGGGG - Exonic
1034491735 7:151396490-151396512 GAGCAGCGGGAAGGGGATGGGGG + Intronic
1034566572 7:151920318-151920340 GAGCAGGGAGAAGGCTTGCAGGG + Intergenic
1034918833 7:155062279-155062301 AAGCCAGGAGAAGGGGAGGGAGG + Intergenic
1034975738 7:155448486-155448508 GAGCAGGGAGCAGGGGGAGGTGG + Intergenic
1034989117 7:155536471-155536493 GAGGAGGAAGAAGTGGAGTGTGG - Intergenic
1035079006 7:156200745-156200767 GAGCAGGGCAGTGGGGAGCGTGG + Intergenic
1035237673 7:157509216-157509238 GAGGAGGGAGAGGGAGAGAGGGG + Intergenic
1035280635 7:157776126-157776148 GAGGAGGGAGGAGGAGAGGGAGG - Intronic
1035287251 7:157814375-157814397 GGGCAGGGAGAAGGGTGGGGAGG + Intronic
1035366444 7:158351867-158351889 GAGCAGACAGGAGGGGAGCTGGG - Intronic
1035375617 7:158404937-158404959 GAGCTGGGAGCTGGGGAGCTGGG - Intronic
1035389635 7:158496475-158496497 GGGAAGGGGGAAGGGGAGCAGGG - Intronic
1035389712 7:158496666-158496688 GGGAAGGGGGAAGGGGAGCAGGG - Intronic
1035476884 7:159149997-159150019 GAGCATGGAGAAGGGGAGAGGGG + Intergenic
1035677460 8:1465427-1465449 GAGCAGAGGGAAGGGGCGTGGGG + Intergenic
1036561679 8:9904383-9904405 CAGCAGGGAGGGCGGGAGCGAGG + Intergenic
1036589701 8:10157750-10157772 GGGCAGAGAGAGGGGGAGAGAGG - Intronic
1036767409 8:11557590-11557612 CAGCAGGGATCAAGGGAGCGAGG + Intronic
1036815222 8:11897261-11897283 GGGCAGGGTGCAGGGGGGCGGGG + Intergenic
1037721068 8:21444544-21444566 AGGCAGGGACAAGGGGAGCCAGG + Intergenic
1037753443 8:21697049-21697071 GAGGAGAGGGAAGGGGACCGAGG + Intronic
1037769131 8:21788898-21788920 GAGCAGGGAGAGTGGGAGAAGGG - Intronic
1037804328 8:22050646-22050668 GAGAAGGGAGAGGGAGAGGGAGG + Intronic
1037829423 8:22179078-22179100 GAGCAGAGTGAAGGGGAGGCAGG - Intronic
1038150961 8:24942150-24942172 GGGGAAGGAGAAGGGGAGGGAGG - Intergenic
1038506827 8:28091871-28091893 GAGCAGACAGAAGGGGAAAGAGG + Intronic
1038524446 8:28261119-28261141 AAGGAGGGAGAAGGGAAGAGGGG - Intergenic
1038573655 8:28685400-28685422 GAAGAGGGAGAAGGGGAGGGGGG - Intronic
1039048571 8:33472736-33472758 GAGCCCGGAGAAGGAGCGCGGGG - Intronic
1039182026 8:34877784-34877806 CATGAGGGAGAAGGGGAGAGGGG + Intergenic
1039317333 8:36387917-36387939 GAGGAGGGAGAAGGAGAAGGAGG - Intergenic
1039435671 8:37557644-37557666 GATCAGGGAGAAGGGCGGGGAGG - Intergenic
1039477080 8:37844734-37844756 GGGCAAGGAGAAGGGGAGGTGGG - Exonic
1039538925 8:38345329-38345351 GAGCAGGGAGAGGGAGGGAGAGG + Intronic
1039884069 8:41645641-41645663 GTGCAGGGAGAGGGGAGGCGGGG - Exonic
1040951386 8:52941205-52941227 CAGCAGGGAGCAGGGCAGGGAGG - Intergenic
1041636651 8:60153088-60153110 GATCAGGGAGGAGGGGACAGAGG + Intergenic
1041721971 8:60984086-60984108 GAGGAAGGAGCAGGGGAGGGAGG - Intergenic
1041767324 8:61432919-61432941 GAGCAAGTAGGAGGGGAACGAGG + Intronic
1041846144 8:62331037-62331059 GAGGAGGTAGAAGAGGAGGGAGG - Intronic
1042170861 8:65989641-65989663 GAGCAGGGAAAAGGGTAGAGAGG - Intergenic
1042382440 8:68133095-68133117 GAGAAGGCAGAAGGGGAAGGAGG + Intronic
1042397794 8:68311803-68311825 GAGAAGGAAGAAGAGGAGGGGGG - Intronic
1043387240 8:79760313-79760335 GAGCAGTGAGGAGGGGCGAGTGG + Intergenic
1043388343 8:79768611-79768633 GAGCCGGGAGAGGGGGCGCCGGG + Intergenic
1043472793 8:80578621-80578643 GAGCAGGGAGAAGGGGCGCAGGG - Intergenic
1043472798 8:80578636-80578658 GAGCAGGGAGAAGGGGAGCAGGG - Intergenic
1043744358 8:83855075-83855097 GAGCAGGGAGAGAGGGAGGAAGG + Intergenic
1043958724 8:86390715-86390737 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1044306277 8:90645206-90645228 GAGCAGCGAGAAGCTGAGCGCGG - Exonic
1044542141 8:93420005-93420027 GAGGAGAGAGAAGGGGAGAAAGG - Intergenic
1044586026 8:93869799-93869821 AAGAAGGGAGAAGGGGAGGCCGG - Intronic
1044737681 8:95296061-95296083 TAGCAGGCAGATGGGGAGGGGGG - Intergenic
1045032840 8:98154050-98154072 CAGCAGTAAGAAGGGGAGAGAGG + Intronic
1045277590 8:100721663-100721685 GAGCCGGGGGGAGGGGAGCGGGG + Exonic
1045344097 8:101279237-101279259 GAGGAGGGAGGAAGGGAGGGGGG + Intergenic
1045409651 8:101904298-101904320 AAGGAGGGATTAGGGGAGCGGGG - Intronic
1045654395 8:104371901-104371923 TAGCAGTGAATAGGGGAGCGAGG + Intronic
1045737943 8:105318547-105318569 CAGCGAGGAGAGGGGGAGCGCGG - Intronic
1046069381 8:109232224-109232246 GAGCAGGGTAAAGGGCAGTGTGG - Intergenic
1046701473 8:117405649-117405671 GATCAGAGACAAGGGGAGCTGGG + Intergenic
1046889645 8:119408423-119408445 GAGAAGGGAGGCGGGGAGCAAGG + Intergenic
1046964334 8:120147014-120147036 AAGGAGGGAGAAAGGGAGAGAGG - Intronic
1047356694 8:124129036-124129058 GAGCAGAGAGGAGGGAAGCTGGG + Intergenic
1048224490 8:132571553-132571575 GAGCAGGGAGGAGGAGAGACAGG + Intergenic
1048363187 8:133715440-133715462 GAAAAGGGAGAGGGGGAGAGAGG - Intergenic
1048451079 8:134534586-134534608 GAGAAGGGAGAGAGGGAGAGAGG + Intronic
1048761948 8:137804952-137804974 GAGGAGGGAGAGAGGGACCGAGG + Intergenic
1048779892 8:137989269-137989291 GGGAAGGGAGAAAGGGAGAGAGG - Intergenic
1048836911 8:138528171-138528193 GAACAGGGAGGAGAGGAGGGTGG + Intergenic
1048968805 8:139632661-139632683 GAGCGGGGGGAATGGGAGCAGGG - Intronic
1049018945 8:139940879-139940901 GGCCAGGGTGAAGGGGAGCTGGG + Intronic
1049032621 8:140048841-140048863 GAGCTGGGAGTAGGGGAGCAGGG - Intronic
1049214642 8:141402085-141402107 GAGAAGGGAGTTGGGGAGAGGGG + Intronic
1049273224 8:141707186-141707208 GAGGAGGGAGAAGGCAAGTGGGG - Intergenic
1049356819 8:142193137-142193159 GAGCAGGGAGAAGGGAGGAGCGG + Intergenic
1049358723 8:142201682-142201704 CAGCAGGGAGAGGGGGGCCGGGG + Intergenic
1049442430 8:142615437-142615459 GGGAAAGGAGAAGGGGAGGGAGG + Intergenic
1049540810 8:143207997-143208019 AAGCAAGGAGGAGGGGAGGGAGG - Intergenic
1049762354 8:144337102-144337124 GAGCTGGGGGAGGGGGAGGGAGG + Intergenic
1050005253 9:1122780-1122802 GGGGAGGGATAAGGGGAGTGTGG - Intergenic
1050090707 9:2015183-2015205 GGGCAGGGAGGAGCGGCGCGCGG + Intergenic
1050224257 9:3433237-3433259 GAGGAGGTAGAAGGGGAGGCAGG - Intronic
1050796795 9:9556360-9556382 GAGGAGGTAGAAGGGGAAGGAGG + Intronic
1050930014 9:11310983-11311005 GAGCAGGGAGGAATAGAGCGGGG + Intergenic
1051250049 9:15150455-15150477 GAATAGGGAGAAGGTGAGTGTGG + Intergenic
1051388645 9:16539579-16539601 GAGAAGGGAGGGAGGGAGCGAGG + Intronic
1051388655 9:16539616-16539638 GAGAAGGGAGGGAGGGAGCGAGG + Intronic
1051602505 9:18889473-18889495 GGGCAGGGAGAAGGTGACAGGGG - Intronic
1051845933 9:21451215-21451237 GGGCAGGCAGAAGAGGAGGGGGG - Intergenic
1052077268 9:24158772-24158794 GAGGAGGGAGAGGGGAAGAGAGG - Intergenic
1052106367 9:24522067-24522089 AAGGAGGGAGAAAGGGAGGGAGG - Intergenic
1052359568 9:27539651-27539673 GTGGAGGGAGAAGGGGAGGGTGG - Intergenic
1052510118 9:29406751-29406773 AAGAAGGGAGAAAGGGAGGGAGG - Intergenic
1052531204 9:29686339-29686361 GGGCAGGGAGTGGGGGAGAGGGG + Intergenic
1052729699 9:32270958-32270980 GAGAAAGGAGAAGGGGATCTTGG - Intergenic
1053169567 9:35869020-35869042 GAGGAGGGAGATGGGGTGGGAGG + Intergenic
1053265879 9:36713124-36713146 GAGCTGGGAGGAGGGGAGAATGG - Intergenic
1053303020 9:36965057-36965079 GAGCAAGGAGAAGGGGTGTGGGG - Intronic
1053453741 9:38214715-38214737 GAGGAAGGAGAAGGGGAAAGGGG + Intergenic
1054455175 9:65426796-65426818 GAGCAGGGAGCAGGGGCTCTTGG - Intergenic
1055397786 9:75892160-75892182 GGGCAGGCAGCAGGGGCGCGGGG + Intronic
1055424528 9:76180609-76180631 GAGGAGGGAGAAGGTGGGTGGGG - Intronic
1055441936 9:76345120-76345142 GAGCAGGGAGAGAAGGAGTGGGG - Intronic
1056285094 9:85079551-85079573 GAGCAGGCAGTAGGGGAGGGAGG - Intergenic
1056774025 9:89498348-89498370 AAGTGGGGAGAAGGGGAGAGAGG - Intergenic
1057197833 9:93124874-93124896 GAGCTGGGAGATGGGGCGCGAGG - Intronic
1057203501 9:93156602-93156624 CAGCAGGGAGAAGGGAACCCAGG - Intergenic
1057258433 9:93569243-93569265 GAGCAGGGAGAAGGAATGCAGGG - Intergenic
1057387137 9:94614186-94614208 GAGCAGGGGGAGGAGGAGGGAGG + Intronic
1057435499 9:95036645-95036667 GAGGAGGAAGAAGAGGAGGGCGG - Intronic
1057498969 9:95581836-95581858 GAGCTGGGAAAAGGGAAGTGAGG - Intergenic
1057510894 9:95678719-95678741 GTGCAGGGAGAATGGGTGCAGGG + Intergenic
1057944572 9:99314160-99314182 GAGGAGGGAGGAAGGGAGGGAGG - Intergenic
1058689168 9:107504769-107504791 AGGAAGGGAGAAGGGGAGGGAGG + Intergenic
1058877700 9:109258798-109258820 AGGCAGGGAGGAGGGGTGCGAGG + Intronic
1058972259 9:110094579-110094601 GGGCAGGAAGAAAGGGAGTGGGG + Intronic
1059635057 9:116162143-116162165 GAGCATGGAGAAGGGGCAAGTGG + Intronic
1059752143 9:117257987-117258009 GAGCAGTGACAAGGGGACCCAGG - Intronic
1060059820 9:120449112-120449134 GAGCAGGGTGAAGTGGAAGGGGG - Intronic
1060188569 9:121578350-121578372 GAGGAGGGAAGAGGGGAGCAGGG - Intronic
1060291946 9:122311336-122311358 GAGAAGGGAGAAAGGGAGGGAGG - Intronic
1060369833 9:123058047-123058069 GAGAGGGGAGAGGGGGAGAGGGG + Intronic
1060374821 9:123108528-123108550 GAACTGGGAGAGGGGGAGGGAGG - Intergenic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1060442697 9:123656257-123656279 GAGCAGGGGGCAGGGGAGCTAGG + Intronic
1061056466 9:128225366-128225388 GAGCAGGGAGCTGGAGAGGGAGG + Intronic
1061232198 9:129321437-129321459 GTGAAGGAAGGAGGGGAGCGGGG - Intergenic
1061432558 9:130540461-130540483 GAGAAGGGAGGAAGGGAGGGAGG + Intergenic
1061495408 9:130971078-130971100 GAGGAGGGAGGAAGGGAGGGAGG + Intergenic
1061544358 9:131295656-131295678 GGGCTGGGGGAAGGGGAGTGGGG - Intronic
1061651454 9:132053698-132053720 GAGCAGGAAGATGGGGAGTGTGG - Intronic
1061662583 9:132139993-132140015 CAGGAGGGAGAAGGGAAGTGGGG - Intergenic
1061680898 9:132242044-132242066 GAGCAGGGTGGCGGGGCGCGGGG - Exonic
1061806975 9:133142141-133142163 GAGTGGGGAGATGGGGAGGGGGG + Intronic
1061933733 9:133846337-133846359 TAGCAGGAAGAGGGTGAGCGGGG - Intronic
1061947106 9:133914641-133914663 AAGCAGGAAGCAGGGGAGGGGGG + Intronic
1062080846 9:134622615-134622637 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062080877 9:134622714-134622736 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062080908 9:134622815-134622837 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062191406 9:135249650-135249672 GGGGAGGGAGAGGGGGAGGGAGG + Intergenic
1062346819 9:136118804-136118826 GAGCAGGGGGAAGGGAAGTGCGG - Exonic
1062365770 9:136208264-136208286 GAGCGGGGGGAGGGGGAGCGAGG + Exonic
1062452586 9:136621806-136621828 GAGCAGGGGGAAGGTGAGGCTGG - Intergenic
1062564526 9:137158265-137158287 GAGCAGGGAGAAGGAGCAGGGGG + Intronic
1062638409 9:137503584-137503606 GAGGAGGGAGAAGGAGAAGGAGG + Intronic
1062638422 9:137503626-137503648 GAGGAGGGAGAAGGAGAAGGGGG + Intronic
1203467786 Un_GL000220v1:104088-104110 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1203475611 Un_GL000220v1:148064-148086 GAGCAGGGAGGGAGGGAGGGAGG - Intergenic
1185459855 X:328914-328936 GAGGAGGGGGAGGGGGAGAGAGG - Intergenic
1185467000 X:361087-361109 GAGGGGAGAGAAGGGGAGGGTGG + Intronic
1185567451 X:1106477-1106499 GAGGAGAGAGAAGGAGAGAGAGG + Intergenic
1185608463 X:1380503-1380525 GAGGAGGGGGAAGGGAAGAGGGG + Intronic
1185640651 X:1588146-1588168 GAGCAGAGGAAAGGGGAGGGGGG - Intergenic
1185662005 X:1735500-1735522 GAGGAGGGAGAAGAGGAGGAGGG - Intergenic
1185669760 X:1798522-1798544 GAGGAGGGAGGAGAGGAGAGAGG - Intergenic
1185756925 X:2659757-2659779 GGGGAGGGGGAAGGGGAGGGGGG - Intergenic
1186391534 X:9164645-9164667 GAGCAGGGGCAAGGGGAGTGGGG + Intergenic
1186430099 X:9497880-9497902 GAGGAGGAAGGAGGGGAGGGAGG - Intronic
1187247687 X:17567667-17567689 GAGCAGGGAGAAGAAGAGAGAGG + Intronic
1187309065 X:18123131-18123153 GTACAAGGAGAAGGGGAGTGGGG - Intergenic
1187460025 X:19478107-19478129 GAGGGGGGAGAGGGGGAGAGGGG + Intronic
1187541402 X:20199309-20199331 AAGCAGGGAGAAGGGTACAGGGG + Intronic
1188673255 X:32906301-32906323 CAGAAGGCAGACGGGGAGCGAGG - Intronic
1188990388 X:36811811-36811833 TAGGAGGGAGAATGAGAGCGTGG + Intergenic
1189125815 X:38445073-38445095 GAGGAGGTAGGAGGGGAGCAGGG - Intronic
1189213729 X:39305795-39305817 AAGCAGTGAGAAAGGGAGAGAGG + Intergenic
1189240319 X:39519710-39519732 GGGCAGGGAGCCGGGGAGGGAGG - Intergenic
1189364368 X:40376921-40376943 GAGCTAGGGGAAGGGGAGCCAGG + Intergenic
1189612687 X:42753974-42753996 GAGTGGAGAGAAGGGGAGGGGGG + Intergenic
1189736474 X:44074679-44074701 GAGCAGGGAGAAGGGAGGGGAGG + Intergenic
1189758096 X:44292783-44292805 GAGCAGGAAGAAAAGGAGTGGGG - Intronic
1189911286 X:45812846-45812868 GAGCAGAAAGAAGAGGAGGGAGG + Intergenic
1190157882 X:48008350-48008372 GGGCAGGGAGAAGGGAGGCAGGG - Intronic
1190173654 X:48131235-48131257 GGGCAGGGAGAAGGGAGGCAGGG - Intronic
1190662077 X:52663966-52663988 GAGCAGGGTGGTGGGGAGCAGGG + Intronic
1190845096 X:54183577-54183599 TAGCTGGAGGAAGGGGAGCGAGG + Intergenic
1190885758 X:54530032-54530054 GAGGAGGGAGAAGGAGGACGGGG - Intergenic
1190905598 X:54724216-54724238 GAGCAGGGAGGGAGGGAGAGGGG - Intergenic
1191712238 X:64162419-64162441 GAGTAGGGAGGAGGGGAGAATGG - Intergenic
1191768034 X:64722157-64722179 GAGCAGGAAGCAGGGCAGCCTGG + Intergenic
1192053213 X:67746110-67746132 AAGGAGGGAGAAAGGGAGAGTGG - Intergenic
1193072882 X:77324869-77324891 GAGGTGGGAGAAGGGGGGGGAGG + Intergenic
1194174492 X:90629492-90629514 GGGCGGGGAGGAGGGGAGCAGGG - Intergenic
1194240172 X:91435568-91435590 GCTCAGAGAGATGGGGAGCGGGG + Exonic
1194328380 X:92550087-92550109 GCGTAGGGAGAAGAGGAGAGAGG - Intronic
1194453927 X:94079517-94079539 AAGCAGGGAGGAGGAGAGGGAGG - Intergenic
1194875903 X:99187527-99187549 GCGCAGGGAGGAGAGGAGAGAGG - Intergenic
1195116855 X:101707722-101707744 GAGCAGGAAGAAGAGGAGGAAGG + Intergenic
1195446726 X:104960529-104960551 GAGTATGGGGAAGGGGAGCAGGG + Intronic
1195610853 X:106864330-106864352 GAGCAGAGAGGAGGGAAGCTGGG - Intronic
1195993908 X:110712296-110712318 GAATAGGTAGAAGAGGAGCGGGG + Intronic
1195995941 X:110731799-110731821 GAGCTGGGGGAAGGGGAGAATGG + Intronic
1196429334 X:115606070-115606092 CAGCAGGGATAAGGGGGGCGGGG + Intronic
1197020979 X:121688368-121688390 GGGTAGGGAGAAGGGTAGCTAGG - Intergenic
1197146315 X:123176398-123176420 GATGAGGGAGGAGGGGAGTGAGG - Intergenic
1197153178 X:123242264-123242286 GAGCAGGGAGAGGGTGAGATGGG - Intronic
1197187231 X:123601391-123601413 AAGGAGGGAGTAGGGGAGGGAGG + Intronic
1197728594 X:129792585-129792607 GAGAAGGGAGCAAGGGAGAGAGG - Intronic
1197757008 X:130002553-130002575 GGGGAGGGAGAAGGGGAAGGAGG + Intronic
1198167024 X:134068019-134068041 AAGCAGGGAGAAAGAGAGGGAGG - Intergenic
1198708829 X:139479122-139479144 GAGAATGGAGAAAGGGAGAGAGG - Intergenic
1198934856 X:141895152-141895174 GGGCAGGAAGAAGTGGAGTGCGG + Intronic
1199411444 X:147528550-147528572 GAGAAGGGAGAGGGGGAGGGGGG - Intergenic
1199474504 X:148230955-148230977 GAGAGGGGAGAAGGAGAGGGAGG - Intergenic
1200086785 X:153611042-153611064 GAGCAGGGAGCAGCCGAGCAAGG - Intergenic
1200137808 X:153883427-153883449 GAGGAGAGAGCAGGGGGGCGGGG + Intronic
1200364008 X:155641854-155641876 GGGAAGGGAGAGAGGGAGCGAGG + Intronic
1200392574 X:155958593-155958615 GGGAAGGGAGAGAGGGAGCGAGG + Intergenic
1200637087 Y:5669310-5669332 GGGTAGGGAGAAGAGGAGAGAGG - Intronic
1200884837 Y:8257078-8257100 GAGAAGGGAGAGAGGGAGGGAGG + Intergenic
1201549931 Y:15209221-15209243 GAGCAGGGAGAGGAGGGGAGGGG + Intergenic
1202372134 Y:24205758-24205780 CAGCAGGGAGAGGCGGAGCTGGG - Intergenic
1202498651 Y:25464358-25464380 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic