ID: 1071503515

View in Genome Browser
Species Human (GRCh38)
Location 10:86219542-86219564
Sequence AGAGCAGGGAGAAGGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1898
Summary {0: 1, 1: 1, 2: 12, 3: 181, 4: 1703}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503515_1071503522 2 Left 1071503515 10:86219542-86219564 CCCGCTCCCCTTCTCCCTGCTCT 0: 1
1: 1
2: 12
3: 181
4: 1703
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503515_1071503526 12 Left 1071503515 10:86219542-86219564 CCCGCTCCCCTTCTCCCTGCTCT 0: 1
1: 1
2: 12
3: 181
4: 1703
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503515 Original CRISPR AGAGCAGGGAGAAGGGGAGC GGG (reversed) Intronic
900114496 1:1022716-1022738 AGAGCTGGGAGGAGGGGAGGAGG - Intronic
900119348 1:1041871-1041893 TGTGCAGGGAGCAGGGGAGCAGG - Intronic
900226175 1:1534569-1534591 AGAGGAGGGAGGAGGGAACCTGG + Exonic
900391494 1:2435930-2435952 AGAGGAGGGAGGAAGGGAGGAGG - Intronic
900391558 1:2436114-2436136 GGAGCAGGGAGGAAGGGAGGAGG - Intronic
900391573 1:2436158-2436180 GGAGCAGGGAGGAAGGGAGGAGG - Intronic
900391599 1:2436244-2436266 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
900391681 1:2436478-2436500 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
900427392 1:2586839-2586861 GGAACAGGGAGTCGGGGAGCCGG + Exonic
900540633 1:3200955-3200977 AGAAGAGGGAGAAGAGGAGGAGG + Intronic
900590068 1:3455414-3455436 TGAGAAGGGAGATGGGGAGGGGG + Intronic
900701225 1:4049742-4049764 AGAGGGGGGAGAAGGAGAGAGGG + Intergenic
900725934 1:4216360-4216382 AGAGATGAGAGAAGGGGAGGTGG - Intergenic
900844827 1:5088865-5088887 AGAGGAGGAAGAAGAGGAGTTGG - Intergenic
900875297 1:5338287-5338309 GGAGAGGGGAGAAGAGGAGCTGG - Intergenic
901155872 1:7137823-7137845 AGAGGAGGGAGATGGAGAGAAGG - Intronic
901224160 1:7602026-7602048 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
901224165 1:7602041-7602063 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
901269639 1:7941997-7942019 AGAAGAGGGAGAAGAGGAGGAGG + Intronic
901299097 1:8185681-8185703 AGAGCATGGACCATGGGAGCGGG - Intergenic
901387588 1:8921324-8921346 ACAGCTGGGAGAAGGGGTGATGG - Intergenic
901469204 1:9443925-9443947 AGAGGAGGGGTAAGGGGAGAAGG - Intergenic
901471699 1:9461117-9461139 AGAGGGAGGAGAAGGGGAGATGG - Intergenic
901509410 1:9708923-9708945 GGGGAAGGGAGAAGGGGACCTGG + Intronic
901623927 1:10612697-10612719 AGTGCAGAGAGACGGGGACCTGG - Intronic
901651863 1:10747555-10747577 AGAGTGGGGAGAAGGTGAGGTGG + Intronic
901860323 1:12070166-12070188 GGAGCAGGCAGGATGGGAGCAGG + Intronic
901876441 1:12169453-12169475 AGAGCTGGGGGCCGGGGAGCTGG + Intronic
902163397 1:14550755-14550777 GGAGTAGGGGGAAGGGGAGAGGG - Intergenic
902219881 1:14958089-14958111 GGAGCAGGCAGAGGGGGAGCAGG - Intronic
902360942 1:15942322-15942344 AGTGCAGGAAGAAGGTGAGGGGG - Exonic
902976616 1:20093169-20093191 AGAGGAGGAAGAAGAGGAGGAGG - Intergenic
903031160 1:20465320-20465342 AGAGGAGGGAGGAGGGAAGTGGG - Intergenic
903103221 1:21052540-21052562 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
903210300 1:21814549-21814571 AGACCAGGAAGAAGCGGAACTGG - Exonic
903366266 1:22807131-22807153 AGAGGAGACAGAAGGGGAGAAGG - Intronic
903385593 1:22924240-22924262 AGAGCTGGGAGTTGGGGACCTGG - Intergenic
903423322 1:23234469-23234491 AGAGCAGGGAGGAAAGGAGGGGG - Intergenic
903773377 1:25778063-25778085 TGGGCAGGGAGAAGGGGCGTGGG - Intronic
903838741 1:26223226-26223248 AGACCAGGAAGAAGGTAAGCAGG + Intergenic
904254731 1:29247753-29247775 TGATCAGGGAGATGGGGAGTGGG + Intronic
904438452 1:30514477-30514499 AGAGCAGTGAGACGGGAAGTGGG - Intergenic
904440262 1:30525361-30525383 AGAGTAGGAGGAAGGGGAGGAGG + Intergenic
904496202 1:30888250-30888272 GGAGCAGGGACAGGGAGAGCAGG + Intronic
904535794 1:31198690-31198712 AGGGCAGGGGGAAGGGCAGCAGG - Intronic
904686810 1:32266674-32266696 GGAGGAGGGGGAAGGGGAGGGGG - Intronic
904686833 1:32266716-32266738 GGAGGAGGGGGAAGGGGAGGGGG - Intronic
904686858 1:32266763-32266785 GGAGGAGGGGGAAGGGGAGGGGG - Intronic
904699625 1:32350865-32350887 AGTGCAGGGAGTCGGGGACCAGG - Intergenic
904920123 1:34000924-34000946 AGAGGAGGTAGAAGGGGAGGTGG + Intronic
904920152 1:34001027-34001049 AGAGGAGGGAGAGGAGGAGGAGG + Intronic
904971546 1:34422978-34423000 AGAACACAGAGCAGGGGAGCTGG + Intergenic
905276060 1:36819007-36819029 ACAGCAGGGAGCAGGAGGGCAGG - Intronic
905644754 1:39617377-39617399 CCACCAGGGGGAAGGGGAGCGGG - Intergenic
905943889 1:41885714-41885736 AGAGGAGGGGGAAGGGAAGGAGG - Intronic
905966376 1:42100873-42100895 AAAGAAGGGAGGAGGGGAGAGGG + Intergenic
906117651 1:43366935-43366957 AGAGCAGGGCCCAGGGCAGCAGG + Intronic
906127803 1:43438218-43438240 ACAGCTTGGGGAAGGGGAGCTGG + Intronic
906192304 1:43905977-43905999 AGAGTGGCGGGAAGGGGAGCAGG - Intronic
906192447 1:43906483-43906505 AGAGTGGCGGGAAGGGGAGCAGG - Intronic
906308675 1:44738056-44738078 AGACCGGGGAGAGGGGGAGGGGG - Intergenic
906438893 1:45822916-45822938 TGAGCAGTGAGACGGGGAACAGG - Intronic
906495231 1:46301013-46301035 AGGGGAGGGAGAAGGGGAAAGGG + Intronic
906552044 1:46673208-46673230 AGTGCAGGTTGCAGGGGAGCAGG - Exonic
906567931 1:46813788-46813810 AGGGCAGGGAGAAGAAGAGCAGG + Intronic
906922078 1:50075476-50075498 AGAGGAAGGAGAAGGGGAAGTGG + Intronic
906937606 1:50227697-50227719 GGAGCAGAGAGCAGAGGAGCAGG - Intergenic
906939707 1:50245340-50245362 AGGGCAGGGGGAAGACGAGCTGG + Intergenic
906956638 1:50380960-50380982 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
907317684 1:53582898-53582920 GGAGCAGGTAGAAGGGGTACTGG + Intronic
907386325 1:54127933-54127955 AGAGCAGGGTGAAGAGGAACGGG - Intergenic
907420163 1:54341845-54341867 AGAGCAGGGAGAGAGAGAGGGGG + Intronic
907586371 1:55621315-55621337 ATTGCAGAGAGAAGGGGAGGAGG - Intergenic
907654434 1:56327727-56327749 AGAGGAGGCAGCAGGGGATCAGG + Intergenic
907947734 1:59151158-59151180 AGGGGAGGGAGAGGGGGAGTTGG + Intergenic
908048462 1:60199606-60199628 AGAGCAGGGAGACTGTGAGGAGG - Intergenic
908528241 1:65008609-65008631 AGGGGAAGGGGAAGGGGAGCAGG - Intergenic
908724765 1:67163689-67163711 AGAGCAGGAGCAAGAGGAGCAGG - Intronic
908820342 1:68078986-68079008 AGAGCAGAGAGGAGTGAAGCTGG - Intergenic
909015553 1:70376309-70376331 AGAGGAGGGGGAAGGAGAGCAGG + Intronic
909061423 1:70882822-70882844 AGAGCAGAGAGAAGCAAAGCTGG - Intronic
909893308 1:81035285-81035307 GGGGCAGGGAGAAGGAGAGTGGG + Intergenic
910295078 1:85636405-85636427 AGAGCAGGAGCAAGGGGCGCTGG - Intergenic
910361615 1:86418039-86418061 AGAGCAGGTAGAAGGGCAAGAGG - Intergenic
910602064 1:89043001-89043023 AGAGAAGAGAGAAGGAGAGAAGG - Intergenic
910856853 1:91704359-91704381 AGAAAAGGGAGAAGTGGGGCAGG + Intronic
911202001 1:95054352-95054374 AGAGCAGGAGGAAGGGGTGGAGG - Intronic
911255021 1:95623129-95623151 AGGACAGGGAGAAGGGGAAATGG - Intergenic
911987657 1:104650428-104650450 AGAGCAAGGAGGCGGGGGGCAGG - Intergenic
912028784 1:105212728-105212750 GGGGCAGTGAGAAGGGGGGCAGG + Intergenic
912177419 1:107177297-107177319 AGAGTGGGGAGAAGGAGACCAGG - Intronic
912370221 1:109168017-109168039 AGGGCAGGGGGCAGGGCAGCAGG - Intronic
912372773 1:109186715-109186737 ACAGGAGGGAGAAGAGCAGCAGG - Intronic
912544812 1:110443059-110443081 AGAGGAGGCTGAAGGAGAGCAGG + Intergenic
912589170 1:110797315-110797337 AGAGGAGAGAGAAGGGGAGGAGG + Intergenic
912661561 1:111535986-111536008 AGAGAAGGGAGGAGAGGAGGGGG - Intronic
912904495 1:113689606-113689628 GGGGCAGGGAGAAGGGATGCAGG + Intergenic
912925885 1:113912621-113912643 AGAAGAGGGAGAAGGGGACATGG - Exonic
912939635 1:114033500-114033522 AGAGAAAGGAGAAGGGTACCTGG - Intergenic
913380079 1:118201147-118201169 AGAGGAGGGAGAGGGGGAGGAGG - Intergenic
913391436 1:118317601-118317623 AAAGCAGGGAGGAAGGAAGCAGG - Intergenic
913690736 1:121277653-121277675 AGAGCTGAGAGATGGGGAGAAGG - Intronic
913969451 1:143403418-143403440 AGGGCAGGGAGCAGGGTAGAGGG - Intergenic
914017671 1:143835514-143835536 AGAGAAGGGAGAAGGCAAGGGGG - Intergenic
914146803 1:145002305-145002327 AGAGCTGAGAGATGGGGAGAAGG + Intronic
914656281 1:149744049-149744071 AGAGAAGGGAGAAGGCAAGGGGG - Intergenic
914974792 1:152351475-152351497 ACAGCTGGAAGAAGGGGATCTGG - Exonic
915264864 1:154709540-154709562 AGAGAAGAATGAAGGGGAGCAGG + Intronic
915267263 1:154727964-154727986 AGAGGAGGGAGAATGGAACCTGG - Intronic
915516916 1:156418870-156418892 GGATTAGGGAGAAAGGGAGCAGG - Intronic
915643370 1:157247617-157247639 GGAGGAGGGAGAAGGGCACCAGG - Intergenic
915974299 1:160375013-160375035 AGAGGAGGGAGCAGGGGACCAGG + Intergenic
915979029 1:160408703-160408725 AGAGCAGGGAGCCCAGGAGCTGG - Intronic
916166382 1:161970308-161970330 GGAGCCGGGAGAAGGAGAGAGGG + Intergenic
916694259 1:167220804-167220826 AGAGGAGGGAGGAGGCAAGCAGG + Intergenic
916944424 1:169711673-169711695 AGGGGAGGGAAAAGGGGAGGAGG - Exonic
917231275 1:172840587-172840609 AGAGGAGGGAGAGGAGGAGAAGG - Intergenic
917678204 1:177340243-177340265 AGAGGAGGGAGAAGAGGAGGAGG + Intergenic
917784706 1:178441943-178441965 GCAGAAGGCAGAAGGGGAGCAGG + Intronic
917853260 1:179082621-179082643 AGCGCAGGGATCAGGGGAGGCGG - Intronic
918074298 1:181158964-181158986 GGAGCAGGGTGCAGGGGAGGGGG + Intergenic
918094685 1:181325096-181325118 GTAGCAGGGAGAAGGGGAGCAGG - Intergenic
918241635 1:182625390-182625412 AGGGTGGGGAGGAGGGGAGCAGG - Intergenic
918319230 1:183349076-183349098 AGATCAGAGAGCAGGTGAGCTGG - Intronic
918434651 1:184499092-184499114 AGAGGAGGCAGAAGAGGAGGAGG - Intronic
918543528 1:185657581-185657603 GGAGAAGGGAAAAGGGGAGAGGG - Intergenic
918586356 1:186193251-186193273 AGGGGAGGGAGAAGGGAAGGAGG + Intergenic
919060973 1:192632310-192632332 AAAGCAGGGAGAAGGAATGCAGG + Intergenic
919755605 1:201064251-201064273 AGAGGAGGGGGCTGGGGAGCAGG + Intronic
919770974 1:201158400-201158422 AGAGCAGGGTGATGGTGAGGAGG + Intronic
919887445 1:201945300-201945322 AGAGGAGGGAAAAGGGGTGACGG - Intronic
919928915 1:202208706-202208728 AGGGCAGGCAGAGGGGGAGGTGG - Intronic
920065878 1:203269350-203269372 TGGGCAGAGAGAAGGGCAGCTGG - Intronic
920094433 1:203477007-203477029 AGAGGAATGAGCAGGGGAGCAGG - Intronic
920101331 1:203518742-203518764 AGGGCTGGGCTAAGGGGAGCTGG - Intergenic
920144072 1:203842593-203842615 AGACCGGGGAGAGGGGGAGGGGG + Intronic
920209767 1:204319832-204319854 AGAGAAGGGAGAAAGGGACAGGG + Intronic
920303657 1:205005067-205005089 AGAGCAGGGAGCAGGGCCTCAGG + Intronic
920478057 1:206296142-206296164 AGAGCTGAGAGATGGGGAGAAGG - Intronic
920540497 1:206774384-206774406 GAAGCAGAGAGAAGGGGACCAGG + Intergenic
920648445 1:207819853-207819875 AGAGGAGGGAGAGGTGGAGTGGG - Intergenic
920742434 1:208594093-208594115 AGAGAAGGGAGAAGGGGAGATGG - Intergenic
921013497 1:211165803-211165825 AGAGCATGAAAAAGGGTAGCTGG + Intergenic
921055804 1:211541617-211541639 AGAGCAGGGAAAGGGGGATCAGG - Intergenic
921142884 1:212322262-212322284 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
921529676 1:216265899-216265921 ATAGCAGGGAGAAGGGGATAGGG + Intronic
921671351 1:217927266-217927288 AGAGCAAAGAGAAGGAGAGTGGG + Intergenic
921839409 1:219812416-219812438 AGAGCAAGGATGAGGGGATCTGG + Intronic
922178338 1:223214633-223214655 AGAGCTGGCAGGAGTGGAGCTGG + Intergenic
922179003 1:223219101-223219123 TTAGCAAGGAGAAAGGGAGCTGG + Intergenic
922723194 1:227909562-227909584 AGGGGAGGGAGAAGGGAAGAAGG + Intergenic
922783988 1:228274035-228274057 AGTGCAGGTGGAAGGTGAGCCGG + Exonic
922799702 1:228359665-228359687 AGAGCAGCGGGAAGGTGAGCGGG - Intronic
922825606 1:228515669-228515691 GGAGCAGAGAGAAAGGGAGAGGG - Intergenic
923087574 1:230713113-230713135 TAAGGAGGGAAAAGGGGAGCTGG - Intronic
923150042 1:231224706-231224728 ACCACAGGGAGAAGGTGAGCTGG - Intronic
923219713 1:231882028-231882050 ACAGCAGGGAGGAGTGGAGATGG - Intronic
923271468 1:232358893-232358915 ACAACTGGGAGTAGGGGAGCTGG + Intergenic
923472316 1:234302957-234302979 AGAGTAGGCAGATGTGGAGCTGG - Intronic
923532404 1:234821888-234821910 AGAGCAAGGAGAATGTGAGTGGG - Intergenic
924021590 1:239789549-239789571 GGAGGAAGGTGAAGGGGAGCTGG + Intronic
924574721 1:245269283-245269305 AGAGCAGGGAGGAGGGGGAGAGG - Intronic
924798418 1:247309647-247309669 AGAGTAGGGGGAAGGGTTGCTGG - Intronic
924897729 1:248360890-248360912 ATAGCAGGTAGAGGGGAAGCTGG + Intergenic
1063011618 10:2027223-2027245 AGAGCAGCCAGAAGGGGTCCTGG - Intergenic
1063286252 10:4692081-4692103 AGGGGAAGGAGAAGGGGAACGGG + Intergenic
1063412064 10:5843938-5843960 AGAGAAGAGAGAAGGAGAGAAGG - Intergenic
1063427086 10:5958946-5958968 ACAGGAGGAAGAAGGGAAGCAGG - Intronic
1063603735 10:7505498-7505520 AGAGCAGGAGGAAGAGGAGGAGG - Intergenic
1063917614 10:10899759-10899781 AGAGCAGGAGGAAGGGGTGGTGG + Intergenic
1063925074 10:10969593-10969615 AGAGAATGGGGAAGGGGAGAGGG - Intergenic
1063984190 10:11483625-11483647 AGGGGAGGGAGAGGGGGAGGGGG + Intronic
1064130135 10:12702079-12702101 AGGGCAGGGAGTGGGGGTGCTGG + Intronic
1064446026 10:15393731-15393753 AGAGCATGGGGGAGGAGAGCCGG - Intergenic
1064504682 10:16015762-16015784 AGGACTGGGAGAAGGGGAGAAGG + Intergenic
1064536337 10:16361272-16361294 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1064894780 10:20222980-20223002 AGAGGAGGAAGAAGAGGAGAAGG + Intronic
1065407753 10:25388640-25388662 AGGGCGGGCAGAAGTGGAGCTGG + Intronic
1065550446 10:26863927-26863949 GGAGGAGGGAGAGAGGGAGCGGG + Intergenic
1065610046 10:27463804-27463826 AAAACAGGGAGATGGGGACCTGG + Intergenic
1065667206 10:28075092-28075114 GGAGCAGGAAGAAGGGGAAGAGG + Intronic
1065867035 10:29923231-29923253 AGAGCAGGAAGAAAGTGTGCTGG - Intergenic
1065949146 10:30636119-30636141 AGAGCTGGGAAAAGGGGAAATGG - Intergenic
1066194291 10:33083824-33083846 AGAGCAGTGAGACGGGGGGAGGG - Intergenic
1066242983 10:33555833-33555855 GTAGAAGGGAGAAGGGGAGCAGG - Intergenic
1066263536 10:33752581-33752603 AGAGAAGGAAGAAGAGGAGAAGG - Intergenic
1066438808 10:35418189-35418211 ACAGCAGGGAGCAGGGAAGTAGG + Intronic
1066497544 10:35956787-35956809 AGAAGAGGGAGAAAGGGAGGGGG - Intergenic
1066625198 10:37398855-37398877 AGAGGAGGGAGAAAGGGAGGGGG - Intergenic
1066681542 10:37940255-37940277 GGATCAGGGAGAAAGGTAGCTGG - Intergenic
1067018490 10:42775216-42775238 AGAGCAGGGAGAATGGGCCAAGG - Intergenic
1067091352 10:43267097-43267119 AGCGCGGGGAGCGGGGGAGCGGG + Intergenic
1067452382 10:46390291-46390313 ACAGCAGGAGGAAGGCGAGCTGG - Intronic
1067525544 10:47036189-47036211 GGAGCAGTGAGAAAGGGAGAGGG - Intergenic
1067526577 10:47042949-47042971 AGGGAAGGGAAATGGGGAGCGGG + Intergenic
1067534095 10:47095385-47095407 AGAGTAGGGCGAAGGGCAGAGGG - Intergenic
1067545432 10:47189401-47189423 AAAGCAGGGAGAAGGGGTGGAGG + Intergenic
1067584852 10:47469464-47469486 ACAGCAGGAGGAAGGCGAGCTGG + Intronic
1067783619 10:49227016-49227038 AGAGCAGGTGGAAGGAGAGTGGG + Intergenic
1067789618 10:49277853-49277875 AGAGGAGGCAGATGGGGAGAGGG + Intergenic
1067854432 10:49780101-49780123 AAAGAAGGGAGAAGGAGAGAAGG - Intergenic
1068499544 10:57826109-57826131 AGAGGAGGGTGAAAGGGAGGGGG + Intergenic
1068841154 10:61615777-61615799 AGAGCAGGGAGAGAGGGAGAGGG - Intergenic
1068845446 10:61666582-61666604 ACAGAAGGGAGAGGAGGAGCAGG - Intronic
1068891354 10:62151294-62151316 AGAGCAGGAGGAAGGGGATGGGG - Intergenic
1069266367 10:66463340-66463362 GGAGGAAGGTGAAGGGGAGCAGG - Intronic
1069474013 10:68717513-68717535 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
1069545055 10:69321611-69321633 AGAGGTAGGAGAAGGGAAGCTGG + Intronic
1069692086 10:70360377-70360399 GGAGGAGGGAGATGGGGAGGAGG - Intronic
1069824081 10:71244668-71244690 AGAGGAGGGAGGAGGGAAGGCGG + Intronic
1069878621 10:71578176-71578198 GGAACAGGGAGAAGAGGTGCTGG + Intronic
1070373887 10:75810416-75810438 AGTGGAGGGAGAAGGTGTGCAGG + Intronic
1070671246 10:78378817-78378839 ATAGCAGGGAGGAGGAGAGGTGG - Intergenic
1070715737 10:78719740-78719762 AGATGAGGGAGAAGTTGAGCTGG + Intergenic
1070765559 10:79054167-79054189 AGAGCAGTGCGCAGGGCAGCTGG - Intergenic
1070827403 10:79399250-79399272 AGGGCAGGGCCAAGGGGAGAAGG + Intronic
1070966260 10:80533273-80533295 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1070966265 10:80533288-80533310 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1070966270 10:80533303-80533325 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1070966275 10:80533318-80533340 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1070966280 10:80533333-80533355 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1070966285 10:80533348-80533370 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1071503515 10:86219542-86219564 AGAGCAGGGAGAAGGGGAGCGGG - Intronic
1071722402 10:88160316-88160338 AAAACAGGGAGAGGGGGAGTTGG + Intergenic
1071758392 10:88572101-88572123 AGAGGTGGGAGTAGGGGAGGTGG - Intronic
1072066059 10:91872713-91872735 GGAGAAGGGAGAAGGAGAGGAGG + Intergenic
1072192614 10:93088724-93088746 TCAGCAGGGAGAAGGGGAATGGG + Intergenic
1072221427 10:93330770-93330792 AGTGCAAGGAGAAGGGGAGGAGG - Intronic
1072628388 10:97129030-97129052 AGAGCAGGAAGCAGAGAAGCTGG - Intronic
1072695303 10:97599043-97599065 AGAGCAGGCAGAAGGAGGCCTGG - Intronic
1073283847 10:102375323-102375345 AGGGCAGGGAGCGGGGAAGCGGG - Intronic
1073531015 10:104232107-104232129 AGAGGAGGGAGGAGGGGACTTGG + Intronic
1073537535 10:104291330-104291352 AGAGGATGGTGAAGGTGAGCTGG + Intronic
1073597740 10:104817457-104817479 AGAGGAGGAAGAAGGAGAGGAGG - Intronic
1073597743 10:104817472-104817494 AGAGGAGGGAGAAGGAGAGGAGG - Intronic
1073641594 10:105258052-105258074 TAAGCAGGAAGAAGGGGGGCAGG - Intronic
1074080731 10:110166261-110166283 TGAGCAGGGAGGAGAGGAGGAGG - Intergenic
1074139525 10:110659793-110659815 AGAGGAAGGGGAAGGGGAACGGG - Intronic
1074441969 10:113485790-113485812 AGAGCATGGAAAAGAAGAGCTGG - Intergenic
1074848537 10:117420342-117420364 AGAGTTGGGAGAAGGCAAGCTGG - Intergenic
1074908637 10:117887144-117887166 CCAGGAGGGAGAAGGGGAGAGGG - Intergenic
1074945453 10:118276729-118276751 AGTGCAGGCAGATGGAGAGCTGG - Intergenic
1075066372 10:119291605-119291627 AGAGGAGGAAGAAGAGGAGGAGG - Intronic
1075117604 10:119640034-119640056 AGAGCAGGGAACTGGGAAGCTGG + Intergenic
1075284505 10:121171840-121171862 AGGGAAGGGAGAAGGGGAAGGGG + Intergenic
1075347556 10:121695193-121695215 AGAGCAGGGAGCAGCCTAGCTGG + Intergenic
1075575066 10:123572045-123572067 AGAGAAGGGAGAAAGGGAAAAGG + Intergenic
1075587278 10:123666950-123666972 AGAGCACGACGAAGGAGAGCAGG - Exonic
1075647924 10:124108637-124108659 GGAGGAAGGCGAAGGGGAGCTGG - Intergenic
1075715138 10:124551399-124551421 AGAGCCTGGGGAAGGGGTGCTGG - Intronic
1075993042 10:126854114-126854136 AGAGAAGAGAGAAAGGGGGCAGG + Intergenic
1076076386 10:127537186-127537208 GGAGCAGGAAGGAGGGAAGCAGG + Intergenic
1076150584 10:128159237-128159259 AGAGCAGGGCAAAGGGGAAATGG + Intergenic
1076292919 10:129361480-129361502 AGAGCCGGGAGCTGGGCAGCCGG - Intergenic
1076318846 10:129564121-129564143 AGGGGAGGAAGAAGGGGAGGAGG - Intronic
1076318978 10:129564499-129564521 AGTGGAGGAAGAAGGGGAGGAGG - Intronic
1076337546 10:129718553-129718575 AGAGAAGTGAGAAGGTGAGGGGG - Intronic
1076364185 10:129911421-129911443 AGAGCAGAGGGAGGTGGAGCAGG - Intronic
1076408258 10:130227700-130227722 AGGACAGGGAGAAGAGGAGGAGG + Intergenic
1076442154 10:130487400-130487422 AGCGAAGGGAGATGGGGAGGGGG - Intergenic
1076446324 10:130516637-130516659 AGAGTGGGGAGAAGGGAGGCAGG + Intergenic
1076457553 10:130611276-130611298 AGACCAGGGAGAAGAAGAGGAGG + Intergenic
1076478793 10:130770292-130770314 AGGGCGGGGAGCAGGGGGGCAGG - Intergenic
1076480030 10:130778956-130778978 AGGATAGGGACAAGGGGAGCAGG - Intergenic
1076516174 10:131045541-131045563 AAAGGAGGGAGAGGGGGAGGAGG + Intergenic
1076719719 10:132387732-132387754 AGAGCAGGAACCAGGGGAGGGGG - Intergenic
1076738301 10:132468425-132468447 CGGGGAGGGAGAAGGGGAGGAGG + Intergenic
1076802274 10:132836105-132836127 AGGGGAGGGGGAGGGGGAGCAGG - Intronic
1076819928 10:132933202-132933224 AGAGCAGGGGGAGGAGGAGGTGG - Intronic
1076902767 10:133347943-133347965 AGAGGAGGGGGAAGAGGAGGAGG - Intronic
1076921694 10:133457637-133457659 AGGGCAGGGAGAAGGGGGGTGGG + Intergenic
1077199514 11:1298499-1298521 AGAGCAAGGAGATGGAGCGCTGG - Intronic
1077461988 11:2715363-2715385 AGAGCAGGCAGGAGTGGGGCAGG + Intronic
1077538910 11:3137470-3137492 GGTGCGGGGAGCAGGGGAGCAGG + Intronic
1077886692 11:6392206-6392228 AGTGAAGGGAGAAGGGAACCTGG + Intronic
1078025231 11:7688712-7688734 AGAGCAGGCAGAAGATGAGGTGG - Intergenic
1078153754 11:8780592-8780614 AGACCAGGGAGAAAGAGAGTTGG + Intronic
1078329549 11:10408289-10408311 AGTGCAAGGAGAAATGGAGCGGG + Intronic
1078503953 11:11915338-11915360 GGAGCAGGGAGAGGAGAAGCAGG + Intronic
1078525866 11:12100812-12100834 AGAGGAGGGGGAATGGGAACTGG - Intronic
1078804842 11:14688175-14688197 AGAAGAGGGAGAGGGGGAGAGGG - Intronic
1079020416 11:16906303-16906325 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1079173747 11:18120454-18120476 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1079359496 11:19758642-19758664 TGAGCAGGTTGCAGGGGAGCGGG + Intronic
1079401898 11:20112605-20112627 AGAGCAGGGAGACGCGGAGCAGG - Intronic
1079470443 11:20773126-20773148 AGAGCATTGAGCAGGTGAGCAGG - Intronic
1079558810 11:21795163-21795185 AGAGCTGGGGGAAGGGGATGGGG - Intergenic
1079669803 11:23154421-23154443 AGAGCAGGGAGAAGGTATGGAGG - Intergenic
1079810954 11:24999380-24999402 GGAGCAGGAAGATGGGGAGGAGG + Intronic
1080192409 11:29568024-29568046 AGAGGAGGAAGAAGTGGAGGAGG + Intergenic
1080377108 11:31725440-31725462 AGGGCAGAGAGAAGGGGTGGTGG - Intronic
1080463852 11:32478946-32478968 AGAGCAGGGTTGAGGGGAGCTGG + Intergenic
1080617825 11:33960299-33960321 AGAGAAGGGAGAGGGGTGGCAGG + Intergenic
1081234985 11:40636381-40636403 AGAGCAAGTAAAAGTGGAGCTGG + Intronic
1081286670 11:41278973-41278995 AGAACAGGGAGGATGGGAGAGGG - Intronic
1081546541 11:44075872-44075894 AGAGCAGGAAGAAAGGGATGTGG + Intronic
1081716796 11:45256225-45256247 AGAGGAGGGAGGAAGGGAGAAGG - Intronic
1081734925 11:45396027-45396049 AGAGCAGAGAGAAATGAAGCTGG + Intergenic
1081820102 11:45984632-45984654 AGAGAAGGGAGACGGAGAGACGG + Intronic
1081856549 11:46307820-46307842 AGAGCATGGAGCATGGGCGCTGG + Exonic
1081968906 11:47185453-47185475 AGAGCGGGGGGGAGGGGAGGGGG + Intronic
1082132439 11:48506533-48506555 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1082565867 11:54677082-54677104 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1082748859 11:56996888-56996910 ATAGCAGGGATAAGGGGAGAAGG + Intergenic
1082883534 11:58061096-58061118 AAAGCAGGAAGAAGATGAGCAGG - Intronic
1082996868 11:59262038-59262060 AGAGCAATGGGTAGGGGAGCGGG + Intergenic
1083445025 11:62702630-62702652 AGAGAAGGGAGGAGGGCAGGAGG - Intronic
1083539346 11:63501577-63501599 AAAGCAGGAAGGAGGGGGGCAGG - Intergenic
1083581482 11:63827928-63827950 AGAGCAGAGAGGAAGGGAGGGGG - Intergenic
1083603055 11:63960919-63960941 ACAGCTGGGAGATCGGGAGCAGG + Intergenic
1083745979 11:64736719-64736741 GGGGCAGGGAGGTGGGGAGCTGG - Intronic
1083855780 11:65392376-65392398 AGAGCAGGGAGATGTGGATCAGG + Intronic
1083887274 11:65579041-65579063 AGGGGAGGGAGAAAGGGAGCAGG - Intronic
1084525522 11:69695484-69695506 AAAGCAGGGAGAGGGGATGCAGG + Intergenic
1084563592 11:69917569-69917591 AGAGAAGAGAGAAGGGGAGGGGG - Intergenic
1084584352 11:70048670-70048692 AGAGTGGGGAGAGGGGGAGAAGG - Intergenic
1084653728 11:70503440-70503462 AGAGCAGGGAGGGAGGGAGTGGG - Intronic
1084773371 11:71358482-71358504 AGAGCTGGGAGGAGCGCAGCTGG + Intergenic
1084961918 11:72721339-72721361 AGACCAGGGTGATGGGGAGATGG - Intronic
1085022507 11:73218303-73218325 AGCGCAGGGAGGTGGGTAGCCGG + Exonic
1085318729 11:75561860-75561882 AGAGCGGGGAGAAGGGGAGATGG + Intergenic
1085454349 11:76657232-76657254 TGAGCACAGAGAAGGGGAGGGGG + Intergenic
1085515907 11:77111924-77111946 GGAGCAGGGAGCAGGGGTGGGGG + Intronic
1085560279 11:77466155-77466177 AGGGCAGGGAGTAGGTGAGAAGG + Intronic
1085784843 11:79440214-79440236 AGGGCAGGGAGGTGGGAAGCGGG - Intronic
1086486646 11:87310476-87310498 AGAGGAGGGAGGGAGGGAGCAGG + Intronic
1086518679 11:87645888-87645910 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1087104748 11:94398324-94398346 AGGGGAGGGAGAAGCGGAGGTGG - Intronic
1087600655 11:100310884-100310906 AGCACAGGGAGAGTGGGAGCAGG + Intronic
1088074685 11:105832380-105832402 ACAGCAGGGAGAAAGTGAGAAGG - Intronic
1088339317 11:108745102-108745124 AGAGGAAGGGGAAGGGGAGGGGG - Intronic
1088339327 11:108745120-108745142 GGAGAAGGGAGAAGGGGAAGAGG - Intronic
1088348688 11:108860506-108860528 AGAGGAGGAAGATGGGGAGGAGG + Intronic
1088386478 11:109263439-109263461 AGAGTAAGGAGAAGAGGAGAAGG - Intergenic
1088879418 11:113961906-113961928 GGTGGAGGGTGAAGGGGAGCAGG + Intergenic
1088891078 11:114044692-114044714 AGAGGAGGGAGTAGGAGAGGAGG - Intergenic
1089015759 11:115163916-115163938 AGGTCAGGGAGAAGCAGAGCAGG + Intergenic
1089083690 11:115798957-115798979 GGAGCAGGGAGGATGGGAGCAGG - Intergenic
1089123196 11:116155560-116155582 AGAGGAGGAAGAAGGAGAGGAGG + Intergenic
1089123214 11:116155659-116155681 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1089123385 11:116158575-116158597 ATAGAGGGGAGCAGGGGAGCAGG - Intergenic
1089165982 11:116477006-116477028 AGAGCAGGGAGAATGGCAGAGGG + Intergenic
1089455321 11:118622398-118622420 AGAGCGGGCAGGAGGGCAGCAGG - Intronic
1089497601 11:118915691-118915713 CAGGCAGGGAGAAGGGGACCTGG - Intronic
1089567957 11:119382001-119382023 AGCCCAGTGAGAAGGGGAGTGGG - Intergenic
1089572439 11:119419434-119419456 GGAGGAGGGAGAGGGAGAGCAGG + Exonic
1089610808 11:119667485-119667507 AGTGCAGGGTGCAGGGGAACGGG + Intronic
1089640157 11:119842859-119842881 AGGGCATGGAGAGGGGGACCTGG - Intergenic
1089659078 11:119974233-119974255 AGAGCAGGGGAGAGGGCAGCTGG + Intergenic
1089667416 11:120029323-120029345 AGTCCAGGGAGCAGGGCAGCAGG + Intergenic
1089910947 11:122100479-122100501 AGAGGACGGAGAACGGGGGCGGG + Intergenic
1090001771 11:122967274-122967296 AGAACAGGGAGAACAGGAGGAGG + Intergenic
1090167832 11:124570188-124570210 AGAGGAGAAAGAGGGGGAGCTGG - Exonic
1090376478 11:126293066-126293088 ACAGGAGGGAGAAGGGGAACGGG + Exonic
1090414085 11:126528815-126528837 AGAGGAGGAAGCAGGGGAGGAGG + Intronic
1090575627 11:128099713-128099735 AGAGCAGCAAGAAGTGGAGCAGG - Intergenic
1090640049 11:128722338-128722360 GGAGAAGGGAGAAGGGCAGGAGG + Intronic
1090661901 11:128888441-128888463 ACAGCTCGGAGAAGAGGAGCTGG - Intergenic
1090761469 11:129840415-129840437 AGTGCAGGGAGGAGGGAAGCCGG + Intronic
1090860321 11:130647286-130647308 AGTGGAAGGTGAAGGGGAGCAGG + Intergenic
1091193220 11:133711623-133711645 AGAGCAGGGAGGATGGGGGATGG - Intergenic
1091328147 11:134707673-134707695 AAAGTAGGGAGAAGGTGAGAGGG + Intergenic
1091349774 11:134883725-134883747 AAAGGCAGGAGAAGGGGAGCTGG + Intergenic
1091353957 11:134921386-134921408 AGAGCAGGGACAGTAGGAGCAGG - Intergenic
1091404708 12:202008-202030 AGAGCAGGGGGAGGAAGAGCTGG - Intronic
1091406125 12:210664-210686 ACAACAGAGAGAAGAGGAGCTGG - Intronic
1091412932 12:256069-256091 AGAGCTGGGTAAAGGGGATCAGG - Intronic
1091446705 12:547911-547933 AGAGCAAGGAGAAGGGATGAGGG + Intronic
1091460960 12:643123-643145 GGCGCAGGCAGCAGGGGAGCCGG - Intronic
1091685857 12:2561677-2561699 AGTGTAGGGAGAAGGGCAGGTGG + Intronic
1091756507 12:3055916-3055938 AGAGGAGGGAGCAGGGCAGAGGG - Intergenic
1091797448 12:3305418-3305440 AGAATAGGGAGCAGGGGAGGGGG - Intergenic
1091818900 12:3459696-3459718 GGAGCAGGGAGAAGGGCAGGGGG + Intronic
1091829494 12:3539674-3539696 GGAGCAGGGAGAAGGAGATGGGG - Intronic
1091961067 12:4694824-4694846 AGAGCGGTGAGAAGTGGAGGAGG + Intronic
1091995895 12:4993753-4993775 AGACCAGGGAGACTGGGAGCTGG - Intergenic
1091999820 12:5022884-5022906 AAAGCAGGGACCAGGGGAGCCGG - Intergenic
1092142448 12:6193278-6193300 AGAACAGGGGTAAGGGGAGTTGG + Intergenic
1092850183 12:12619057-12619079 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1092993340 12:13924524-13924546 ACAGCAGGGATAGAGGGAGCTGG + Intronic
1092999527 12:13981694-13981716 GGAGCCGGGGGAAGGGAAGCGGG + Intergenic
1093282752 12:17215821-17215843 GGAGCAGGGAGGAAGGAAGCAGG - Intergenic
1093441304 12:19199975-19199997 AGTATAGGGGGAAGGGGAGCTGG + Intronic
1093563897 12:20578739-20578761 AGACCAGGGAGAGTGGGACCAGG - Intronic
1093719521 12:22422991-22423013 AGAGGATGGAGAAGGGGAGGAGG + Intronic
1093720018 12:22429631-22429653 AGAGGATGGAGAAGGGGAGGAGG + Intronic
1094627089 12:32134512-32134534 AGAGCAGAGTGAAAGTGAGCAGG + Intronic
1095222002 12:39626617-39626639 AGGACATGGAGAAGGGGAGGAGG - Intronic
1095271628 12:40225356-40225378 TGAGCAGGGTCAAGGGGAGGAGG - Intronic
1095422309 12:42037901-42037923 AGGGCAGGGAGCAGGGAAGTGGG + Intergenic
1095660246 12:44724240-44724262 AGATGGGGGAGAAAGGGAGCAGG + Intronic
1095806684 12:46327411-46327433 AGCACTGGGAGTAGGGGAGCAGG - Intergenic
1095944307 12:47745444-47745466 AGAGCAGGCAGGAGGTGGGCAGG - Intronic
1095944395 12:47745878-47745900 TGAGCAAGGAGAAGCGGAGGTGG + Intronic
1095982861 12:47982773-47982795 TGAGCAGGGAGAAGAGGAGCGGG - Intronic
1095998018 12:48105851-48105873 ACAGCAGGGGGGAGGGGAGGTGG + Intronic
1096077019 12:48812377-48812399 TGAGCAGGGAGAAGGGATGAAGG + Intergenic
1096102377 12:48977921-48977943 AGAGAAGGAAAAAGGGGAGACGG - Intergenic
1096103601 12:48983964-48983986 AGAGGAGGGAATAGGGGAGAAGG - Intergenic
1096192249 12:49627540-49627562 AGAGCTGAGAGAAGGTGAGTAGG + Intronic
1096193926 12:49636777-49636799 AGAGGAGGAGGAACGGGAGCGGG + Exonic
1096478782 12:51924340-51924362 AGAGTGGGGAGAAGGGCAGTGGG + Intergenic
1096486214 12:51983262-51983284 ACAGCAGGAAGGAGGAGAGCAGG - Intronic
1096489574 12:52006493-52006515 AGGGCAGGGAGAGCGGCAGCGGG - Intergenic
1096556818 12:52408979-52409001 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1096556823 12:52408994-52409016 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1096558594 12:52419486-52419508 AGGGCAGGGAGGAGAGGAACAGG + Intergenic
1096722595 12:53534469-53534491 AGAGCAGGGAGAAGTAGTGAAGG - Intronic
1096724784 12:53552809-53552831 AACGCAGGGAGAAGAGGAGATGG + Intronic
1097057189 12:56257377-56257399 AGAGCAGGGAGTATGGGCGCGGG + Intronic
1097094513 12:56535697-56535719 AGGGCAGGGAGGAGAAGAGCAGG - Intronic
1097102119 12:56597185-56597207 AGAGTAGGGAGGAGGGGTTCTGG - Exonic
1097124971 12:56766786-56766808 AGAGAAGGGAGAGGAGGAGCTGG + Intronic
1097173197 12:57128698-57128720 AGAGCAGCGAGGAGTGAAGCGGG + Exonic
1097220813 12:57449926-57449948 AGAGCAGAGACAGGGGGCGCCGG - Exonic
1097573166 12:61357179-61357201 GGAGCAGTGAGGAGGGCAGCGGG - Intergenic
1097791673 12:63821920-63821942 GGAGCTGGGGGAAGGTGAGCGGG - Intergenic
1098285386 12:68901874-68901896 AGAGGAGAGAGAAGGGGAGAGGG + Intronic
1098305601 12:69099501-69099523 AGAAGATGGAGAAGAGGAGCAGG + Intergenic
1098883553 12:75941014-75941036 AGAGGGGGGAGAGGGGGAGGGGG - Intergenic
1099661483 12:85568603-85568625 TGAGCAGGGAGGAAGGGAGAGGG + Intergenic
1099879600 12:88451842-88451864 AGAGCAGGGAGAGTGGGAGAGGG - Intergenic
1099959201 12:89380464-89380486 AGAGAAGGAAGCAGGGGAGGAGG - Intergenic
1100089504 12:90953737-90953759 GGAGGAGGGAGAGGAGGAGCTGG - Exonic
1100154437 12:91781205-91781227 AGGAAAGGGAGAAGGGGAGAAGG - Intergenic
1100174418 12:92013145-92013167 AGAGAGGGGAGAAGGTGGGCAGG - Intronic
1100848406 12:98683864-98683886 AGAGGAGGGAGAAAAGGTGCTGG + Intronic
1101488517 12:105190709-105190731 AGAGGAGGGAGGCGGGGTGCCGG - Intronic
1101732653 12:107439549-107439571 AGGGCAGGGGGAAGGAGAGGTGG - Intronic
1101774410 12:107780568-107780590 AGTGAAGGGAGAAAGAGAGCTGG + Intergenic
1101864653 12:108511557-108511579 GTAGCAGGGAGAAGGGCTGCTGG + Intergenic
1101973586 12:109335300-109335322 AGAGCAGGGAGCAGGTGTGGGGG + Intergenic
1102334705 12:112068268-112068290 AGAGATGGGAGAGGGGGAGGTGG + Intronic
1102391386 12:112551718-112551740 AGTGCAGGGAGGAGAGGAGATGG + Intergenic
1102394375 12:112574616-112574638 AGAGGAGGGAGAAGGGGTGGTGG + Intronic
1102394383 12:112574637-112574659 GGAGGAGGGAGAAGGGGTGGTGG + Intronic
1102492970 12:113299833-113299855 AGTTCAGGTAGAAGAGGAGCAGG + Exonic
1102581294 12:113889962-113889984 GGAGCAGGGAGCTGGGGAGCTGG - Intronic
1102691635 12:114765934-114765956 AGAGGAGGGGGAAGGGCGGCAGG - Intergenic
1102737862 12:115179166-115179188 GGAGAAGGGAGAAGGGAAGGAGG + Intergenic
1102851212 12:116246843-116246865 AGAGGAGGGAGGTGGGGAGGTGG + Intronic
1102904449 12:116663331-116663353 AGAGCAGGGAGAGGTGGGGAGGG - Intergenic
1102980535 12:117237480-117237502 AGTACAGGGAGAAGGGGAAGAGG + Intronic
1103038940 12:117678812-117678834 ACAGCTGGTACAAGGGGAGCAGG - Intronic
1103174985 12:118855252-118855274 ATAGCAGGGAACAGGGAAGCAGG - Intergenic
1103225236 12:119281846-119281868 AGAGTAGTGAAAAGGGGACCAGG - Intergenic
1103322843 12:120101862-120101884 AGAGCGGGAAGAAGGTGAACTGG - Intronic
1103500950 12:121400874-121400896 AGAAAAGGGGAAAGGGGAGCGGG + Intronic
1103566653 12:121819540-121819562 AGAGGAGGAAGAAGAGGAGGAGG + Exonic
1103667981 12:122586024-122586046 AAAGGAGGGAGCTGGGGAGCTGG + Intronic
1103896623 12:124277691-124277713 AGAGAGGGGAGAAGGGGAGAAGG - Intronic
1103975632 12:124700937-124700959 AGTGTGGGGTGAAGGGGAGCGGG + Intergenic
1104205934 12:126638424-126638446 AGAGCAGGAGGAAGGGTGGCAGG + Intergenic
1104278553 12:127352919-127352941 GGAGGAGGGAGGAAGGGAGCTGG - Intergenic
1104379928 12:128298474-128298496 AGAGCTGGGTGAAGGGGACTTGG - Intronic
1104418988 12:128619645-128619667 AGCGCAGGGAGGAGGGGATTAGG - Intronic
1104528653 12:129548362-129548384 AGGGCAGGGAGGAGGCGAACAGG - Intronic
1104584947 12:130040721-130040743 AGAACAGGGAGAAATGGAGAAGG + Intergenic
1104683972 12:130772330-130772352 GGAGAAAGGGGAAGGGGAGCAGG + Intergenic
1104711946 12:130993586-130993608 AGAGCCGGGAGTGGTGGAGCTGG - Intronic
1104766336 12:131332793-131332815 AGAACAGAGAGGAGGTGAGCAGG + Intergenic
1104813071 12:131629804-131629826 AGAACAGAGAGGAGGTGAGCAGG - Intergenic
1104913573 12:132252078-132252100 GGAGAAAGGAGCAGGGGAGCAGG + Intronic
1105021280 12:132818104-132818126 AGAGCATGGAGGAGTGGAGGGGG - Intronic
1105059545 12:133136183-133136205 AGAGGAGAGAGAAGGGGGGAAGG - Intronic
1105209542 13:18249799-18249821 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1105318225 13:19288801-19288823 GGTGGAGGGGGAAGGGGAGCAGG - Intergenic
1105724723 13:23151314-23151336 AGAATGGGGAGAAGGGGAGAAGG - Intergenic
1106243046 13:27925336-27925358 AGAGGAGGGAAAAGAGGAGGGGG - Exonic
1106243084 13:27925460-27925482 AGAGGAGGGAGAAGAAGAGGAGG - Exonic
1106243109 13:27925560-27925582 AGAGGAGGGAGAAGAAGAGGAGG - Exonic
1106352196 13:28942802-28942824 ACAGCAGGGAGGAGGGAAGATGG + Intronic
1106374917 13:29176857-29176879 AGAGGAGGGAGGAGGGATGCAGG - Intronic
1106508540 13:30392914-30392936 AGGAAAGGGAGGAGGGGAGCAGG - Intergenic
1106590077 13:31091436-31091458 AGAGCAGGGATGCCGGGAGCGGG - Intergenic
1106861205 13:33910872-33910894 AGAGCAGGAGGAAGTGGGGCAGG + Intronic
1106909708 13:34450510-34450532 AGAGGAGTGAGATTGGGAGCTGG - Intergenic
1107197523 13:37670762-37670784 TGGGCAGGGAGAAGGTGAGAAGG - Intronic
1107379022 13:39835785-39835807 ATTTCTGGGAGAAGGGGAGCAGG - Intergenic
1107399191 13:40052189-40052211 AGAGCAGAGAGGAAGGGAGAGGG + Intergenic
1107695361 13:42994308-42994330 GCAGCAGAGAGAAGGGGAGATGG + Intergenic
1107804584 13:44142036-44142058 AGAGCTGGGGGAGGCGGAGCGGG - Intergenic
1107864011 13:44686076-44686098 GGAGGAAGGTGAAGGGGAGCTGG + Intergenic
1107932289 13:45316257-45316279 AGAGGAGGAAGAGGGGGAGGAGG + Intergenic
1108171101 13:47742877-47742899 AGTGCAGGGTGGAGGGGAGGTGG + Intergenic
1108185261 13:47882277-47882299 AGAGCAGGGAGAAGGCATGGGGG - Intergenic
1108787713 13:53926240-53926262 AGGTCAGGGATAAGGGGACCAGG + Intergenic
1109049323 13:57458277-57458299 AGAGCAAGGAGAAGGGATGAGGG + Intergenic
1109895105 13:68676771-68676793 AGGGGAGGGGGAAGGGGAGAGGG - Intergenic
1110706885 13:78607610-78607632 AGGGCAGACAGCAGGGGAGCAGG + Intergenic
1111093437 13:83477377-83477399 AGAGGAGGGAGAAGAGGAAAAGG + Intergenic
1111131413 13:83981551-83981573 AGCTGAGGGAGAGGGGGAGCGGG - Intergenic
1111236696 13:85418416-85418438 AGAGCAGGAGGAAAGAGAGCTGG + Intergenic
1111292532 13:86187200-86187222 ACTGTAGGGAGAAGGGGACCTGG - Intergenic
1111757906 13:92421824-92421846 AGAGCAGGAGGAAGGTGAGCAGG + Intronic
1112358692 13:98696717-98696739 AGAGGTGGGAGAAGGGGTGAGGG + Intronic
1112404195 13:99103639-99103661 AAAGGAGGGAGGAGGGGAGGAGG - Intergenic
1112424474 13:99285275-99285297 AGAGGAGGAAGAGGAGGAGCAGG - Intronic
1112622640 13:101067286-101067308 AGAGGAGGGGGAAGAGGAGGGGG + Intronic
1112622645 13:101067298-101067320 AGAGGAGGGGGAAGAGGAGGGGG + Intronic
1112622650 13:101067310-101067332 AGAGGAGGGGGAAGAGGAGGGGG + Intronic
1113201057 13:107867577-107867599 GGAGGAGGGAGAAGGCGCGCGGG + Intergenic
1113373475 13:109742947-109742969 AGAGGAAGGAGAAGGGGAAGAGG + Intergenic
1113541756 13:111115110-111115132 AGGGAAAGGGGAAGGGGAGCGGG - Intronic
1113755380 13:112807830-112807852 GGAGCAGAGAGAAGGGGCGCGGG + Intronic
1113791573 13:113031599-113031621 GGAGCTGGGAGATGGGGAGGAGG + Intronic
1113796597 13:113061879-113061901 AGAGGAGGAGGAAGGGGAGGAGG - Intronic
1114140373 14:19902282-19902304 AGAGCAGAAGCAAGGGGAGCAGG - Intergenic
1114383562 14:22233506-22233528 ACAGAAGGCAAAAGGGGAGCAGG + Intergenic
1114488588 14:23080680-23080702 AGAGGAGGAAGAAGAGGAGGAGG - Exonic
1114563974 14:23614605-23614627 AGGGCAGGGTGATGGGGATCTGG + Intergenic
1114674440 14:24430993-24431015 AGAGCAGGGCCGAGGAGAGCAGG + Intronic
1115474834 14:33802891-33802913 AGAGGAGGGAGAGGGGGAGATGG - Intronic
1115534101 14:34356505-34356527 CAAGAAGGCAGAAGGGGAGCTGG - Intronic
1115778002 14:36737405-36737427 TGAGCAGAGAGAAGGGAAGTAGG - Intronic
1116019216 14:39441114-39441136 AGGCCAGGGAGAGTGGGAGCAGG - Intergenic
1116081997 14:40186283-40186305 ATAGCAGGGCAGAGGGGAGCAGG - Intergenic
1117010796 14:51468293-51468315 AGAGATGGGAGAGGGGGAGGGGG + Intergenic
1117853560 14:60002924-60002946 TGACAAGGGAGTAGGGGAGCTGG + Intronic
1118108496 14:62689013-62689035 TGAGCTGGGAGCAGGAGAGCAGG - Intergenic
1118264971 14:64286197-64286219 AGAGGAGAGAGAATGGTAGCTGG + Intronic
1118331124 14:64816834-64816856 GGGGCAGGGAGAATGGGTGCTGG + Intronic
1118420296 14:65594694-65594716 AGGGGAGCGAGAAAGGGAGCGGG + Intronic
1118491368 14:66263799-66263821 GAAGCAGGGAGCAGGGGAGGTGG + Intergenic
1118538877 14:66801562-66801584 AGAGTGGGGAGAGGGGCAGCGGG - Intronic
1118574630 14:67229908-67229930 ACAGCAGGGAGAGGAGGAGGAGG - Intergenic
1118747550 14:68785176-68785198 CAAGCTGGTAGAAGGGGAGCTGG + Intergenic
1118979122 14:70701776-70701798 AGAGGAGGAGGAAGGGGAGGAGG + Intergenic
1119036270 14:71232441-71232463 AGAGAAGTGAGAAGGAGAGAAGG + Intergenic
1119348206 14:73943586-73943608 AGAGGGAGGAGAAGTGGAGCAGG - Intronic
1119432204 14:74575731-74575753 ACAGCAGGGAGATGGGGCGTGGG + Intronic
1119823977 14:77641922-77641944 CGAGAAGGGAGAGCGGGAGCCGG + Intergenic
1119859111 14:77923897-77923919 GGAGCAGGGAGAGGGGAGGCGGG + Intronic
1120170727 14:81245267-81245289 AGGGGAGGGGGAAGGGGAGGGGG + Intergenic
1120170734 14:81245279-81245301 AGGGGAGGGGGAAGGGGAGGGGG + Intergenic
1120218099 14:81702489-81702511 AGAGAAGGGGGAATGGGTGCTGG + Intergenic
1120509972 14:85401322-85401344 AGAGCAGAGGTAAGGGGAGAGGG + Intergenic
1121103409 14:91264857-91264879 TGGGAAGGGAGATGGGGAGCAGG + Intergenic
1121117864 14:91356295-91356317 AGGGCTGGGGGACGGGGAGCTGG - Intronic
1121334871 14:93071078-93071100 AGAGCAGGGAGTTGGGCTGCAGG - Intronic
1121421802 14:93821181-93821203 GGGGCAGGGAGATGGGGACCAGG - Intergenic
1121453529 14:94024311-94024333 ACAACAGGGAGAAGGGGTGCAGG + Intergenic
1121681064 14:95793023-95793045 AGAGCAGGAGCAAGGGGCGCGGG - Intergenic
1121698556 14:95933271-95933293 CCAGCAGGGAGACAGGGAGCTGG - Intergenic
1121734940 14:96211652-96211674 GGAGGAGGGAGAAGGGAAGTGGG - Intronic
1121774737 14:96583201-96583223 AGGGCAGGGAGAAGGTGGGGAGG - Intergenic
1122078049 14:99248153-99248175 AGAGCAGGGAGGGAGGGAGGAGG - Intronic
1122081523 14:99270745-99270767 AGCGGAGGGGGAGGGGGAGCCGG - Intronic
1122089831 14:99330834-99330856 AGGGCAGGGAGAAGCACAGCCGG - Intergenic
1122322208 14:100861918-100861940 AGAGGAGGAAGAAGAGGAGGAGG - Intergenic
1122363851 14:101183057-101183079 AGGGCAGGGAGAGACGGAGCTGG - Intergenic
1122414546 14:101542678-101542700 AGCCCAGGAAGTAGGGGAGCGGG - Intergenic
1122417705 14:101558216-101558238 AGGGCAGGCAGAAAGGGAGGTGG + Intergenic
1122419836 14:101568528-101568550 GGAGCCGGGGGAAGGGGAGAAGG + Intergenic
1122447743 14:101781697-101781719 GGAGCCCGGAGGAGGGGAGCCGG + Intronic
1122814517 14:104305960-104305982 AGAGCAGAGTGCTGGGGAGCTGG - Intergenic
1123164772 14:106315667-106315689 GCAGCAGGGAGAGGGTGAGCAGG - Intergenic
1123418977 15:20115698-20115720 AGAGCAGGAAGCAGGGGCGGGGG - Intergenic
1123446887 15:20337809-20337831 AGAGCAGGAAGCAGGGGCGGGGG + Intergenic
1123528198 15:21122241-21122263 AGAGCAGGAAGCAGGGGCGGGGG - Intergenic
1123699449 15:22903606-22903628 AGAGCAGGGAGACAGGGACCTGG + Intronic
1123762339 15:23442538-23442560 AGAGCAGGCAGAAGAGCAGCTGG + Intronic
1124010701 15:25836286-25836308 ATAGCTGGGAAAAGAGGAGCAGG - Intronic
1124070470 15:26388311-26388333 AGAGCAGTGGGGAGGAGAGCTGG - Intergenic
1124156608 15:27231444-27231466 GGGGTAGGGAGAAGAGGAGCAGG + Intronic
1124182603 15:27490898-27490920 AGAGCAGTGTGAAGGGGGGGTGG - Intronic
1124245634 15:28069426-28069448 AGACCGGGGAGAGGGGGAGGGGG - Intronic
1124378152 15:29141596-29141618 GGAGCAGGGAGAGTGGGTGCTGG - Intronic
1124511083 15:30326501-30326523 AGTGGAAGGTGAAGGGGAGCAGG - Intergenic
1124531896 15:30516030-30516052 AGAGCAGGCAGAGGAGTAGCTGG - Intergenic
1124636324 15:31367130-31367152 AGAGAAGGGAGAACGGGTGGAGG - Intronic
1124731831 15:32204264-32204286 AGTGGAAGGTGAAGGGGAGCAGG + Intergenic
1124766758 15:32491615-32491637 AGAGCAGGCAGAGGAGTAGCTGG + Intergenic
1124879169 15:33625675-33625697 AGGGAAAGGAGAAGGGGAGAAGG + Intronic
1124957726 15:34370755-34370777 GGAGGAGGAAGAAGGGGAGGAGG - Intergenic
1125752239 15:42036778-42036800 GGAGCCGGGAGCCGGGGAGCAGG + Intronic
1125764867 15:42127804-42127826 AAAGCAGGGAGAAAGGAAGGGGG - Intergenic
1126122459 15:45265837-45265859 AGAGCAGAGAGAAGATGAGCTGG + Intronic
1126319593 15:47407888-47407910 AAAGGAGGGAGAAGGGGTGAGGG - Intronic
1126413650 15:48396367-48396389 AGAGGAGGGAGATGGGGGGCAGG + Intergenic
1126560040 15:50033705-50033727 AGAGAAAGGAGAAGGGGAGCAGG - Intronic
1126778432 15:52119022-52119044 AGAGCTGGGGGAAGGGGAATGGG + Exonic
1127117876 15:55744885-55744907 GGAACAGGGAGAAGGGGAAGGGG - Intergenic
1127260450 15:57323281-57323303 AGAGCATGGGGAAGGGGTGTTGG + Intergenic
1127556075 15:60088971-60088993 GGAGCAGGGAGGAGAGGAGAAGG + Intergenic
1127586405 15:60382115-60382137 AGAGAAGGAAGAAAGGGAGAAGG + Intronic
1127897539 15:63315588-63315610 AGAAAAGGGAGGAGGGGGGCTGG + Intergenic
1127910231 15:63410709-63410731 GAAGCAGGGAGCAGGTGAGCAGG - Intergenic
1128134747 15:65254542-65254564 ACAGTAGAGAGGAGGGGAGCGGG + Intronic
1128186953 15:65650750-65650772 AGAGCAGGAGGAAGAGGAGGAGG + Exonic
1128186959 15:65650777-65650799 AGAGCAGGAGGAAGAGGAGGAGG + Exonic
1128251683 15:66168151-66168173 TGAGCAAGGAGAAGACGAGCTGG - Intronic
1128326159 15:66725595-66725617 AGAGCAGGGAGAAGCTGGGCTGG + Intronic
1128498214 15:68210264-68210286 ACAGGTGGGAGAAAGGGAGCCGG - Intronic
1128562562 15:68678270-68678292 AGAGCAGGGGGAGGAGGAGGAGG + Intronic
1128637792 15:69314294-69314316 ACAGGAGGGAGAAGGGCAGCTGG - Intronic
1128705016 15:69832273-69832295 AGGGAAGGGAGAAGGGAAGGGGG + Intergenic
1128731805 15:70026370-70026392 AGAGCAGGGAGAATGGGGGGTGG - Intergenic
1128806421 15:70534339-70534361 AGAGGAAGGTGAAGGGGAGGGGG + Intergenic
1129057989 15:72835734-72835756 GGAGGAGGGGGAAGAGGAGCAGG + Intergenic
1129712162 15:77825945-77825967 AGAGCAGGGAGAGGGAGAGAGGG + Intergenic
1129736402 15:77967803-77967825 AGAGTGGGGAGAAGTGGGGCAGG - Intergenic
1129854227 15:78812180-78812202 AGCACAGGGGGAAGGGGAGCCGG - Intronic
1130270710 15:82445529-82445551 GCAGCAGGGAGAGGCGGAGCTGG + Intergenic
1130381298 15:83374509-83374531 TGTGAAGGGAGAAAGGGAGCAGG - Intergenic
1130656421 15:85794698-85794720 AGCGCAGGGAGCGGGGGCGCGGG + Intronic
1130699614 15:86165358-86165380 GGGGCAGGGAGAAGAGAAGCAGG - Intronic
1130968023 15:88711424-88711446 AGAGCTGGGAGCAAGGGGGCAGG + Intergenic
1130969115 15:88718478-88718500 AGAGCAGGGAGAGGGGAAGAAGG - Intergenic
1130990834 15:88874771-88874793 AGTGCAGGGACAGGGGGAGAAGG + Exonic
1131370165 15:91874411-91874433 AGGGCTGGGGGAAGGGGAGTGGG - Intronic
1131465724 15:92653708-92653730 AGAGGAAGGAGGATGGGAGCTGG + Intronic
1131542059 15:93282910-93282932 AGAGCAGAGAGAAGTGATGCAGG - Intergenic
1131597441 15:93812883-93812905 AGAACAGAGAGAAGAGAAGCTGG + Intergenic
1131620396 15:94062109-94062131 AGAGCAGGAAGAAGAGGGGCAGG - Intergenic
1131823906 15:96301061-96301083 ATATCAGGGAGAAGGGGAAAAGG - Intergenic
1131951224 15:97683709-97683731 AGAGAAGGGGGAGGGGGAGGGGG + Intergenic
1132050550 15:98604576-98604598 AGACCTGGGAGAAGGAGAGAAGG + Intergenic
1132114628 15:99126370-99126392 AGTCCAGGGTGAAGAGGAGCAGG - Intronic
1132242358 15:100267671-100267693 AGAGAAGGGAGACAGGGAGGGGG - Intronic
1132514116 16:358350-358372 AGGCCTGGGGGAAGGGGAGCAGG + Intergenic
1132523054 16:400281-400303 AGAGCAGTGAGCTGGTGAGCTGG + Exonic
1132563623 16:610408-610430 AGAGCAGGGGGAAGGGTGGCAGG + Intronic
1132579175 16:677345-677367 AGAGCAGGCTGATGCGGAGCAGG - Exonic
1132716480 16:1292631-1292653 AGAGAGGGGAGAGGGGGAGGGGG - Intergenic
1132926027 16:2429530-2429552 AGGGCAGGCAGAAGGGGTGTGGG - Intronic
1132941415 16:2510248-2510270 AGACCAAGGAGAAGGAGATCTGG + Intronic
1133006394 16:2883792-2883814 AGAGGAGAGAGCCGGGGAGCTGG + Intronic
1133026310 16:2990359-2990381 AGAGATGGGAGTGGGGGAGCTGG + Intergenic
1133081026 16:3320362-3320384 AGAGCTTGGAAAAGGGCAGCTGG + Intergenic
1133115735 16:3577093-3577115 AGGGGAGGGAGAAGGGATGCTGG - Intronic
1133383447 16:5349904-5349926 AGCACAGGGAGAGTGGGAGCCGG - Intergenic
1133392399 16:5420929-5420951 AAAGCAGGAGGAAGGGGAGGGGG - Intergenic
1133568815 16:7021990-7022012 AGGGGAGGGAGAGGGGGAGGGGG - Intronic
1133568843 16:7022042-7022064 AGGGGAGGGGGAAGGGGAGGGGG - Intronic
1134049954 16:11130559-11130581 AGAGTAGTGACACGGGGAGCCGG + Intronic
1134179463 16:12035893-12035915 TGAGCAGGAAGAAAGGGAACGGG - Intronic
1134233745 16:12449613-12449635 AGAGCAGGGAGATGCACAGCTGG - Intronic
1134291027 16:12902782-12902804 GGAACACGGAGAAGGGGCGCTGG + Intronic
1134331251 16:13252958-13252980 AGAGGAGTGAGAAGAGGAGTTGG - Intergenic
1134379204 16:13708668-13708690 AGAGCAGGGAGCAGGCAAACAGG - Intergenic
1134379377 16:13710011-13710033 GGTGGAGGGTGAAGGGGAGCAGG - Intergenic
1134578213 16:15349690-15349712 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1134724378 16:16407856-16407878 AGAGGAGGAAGAAGAGGAGGAGG - Intergenic
1134752052 16:16633043-16633065 AGAATAGGGAGATGGGGAGAGGG - Intergenic
1134943053 16:18304003-18304025 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1135108086 16:19668390-19668412 AGAGCAGGAAGGATGGGAGGTGG - Intronic
1135161788 16:20102829-20102851 GGAACAGGAAGAAGAGGAGCAGG - Intergenic
1136036484 16:27544439-27544461 AGAGCAGGGGTAGAGGGAGCTGG + Intronic
1136041652 16:27584183-27584205 ACAGGAAGGAGAAGGGGAGAAGG - Intronic
1136454221 16:30371231-30371253 ACAGCACGGAGAAGGGGCGGGGG + Intronic
1136468349 16:30460677-30460699 AGAGGAAGGGGAAGGGGAGGGGG + Intergenic
1136550650 16:30980705-30980727 ACGGCAGGGAGGAGGTGAGCAGG - Intronic
1136605507 16:31331007-31331029 AGAGGAGGGAGAAGAGGTGGGGG + Intronic
1136779521 16:32887496-32887518 AGAGAAGAGAGAAGAGGACCCGG + Intergenic
1136891095 16:33974022-33974044 AGAGAAGAGAGAAGAGGACCCGG - Intergenic
1137357799 16:47783346-47783368 AGAGCTGCCAGATGGGGAGCTGG - Intergenic
1137386505 16:48047512-48047534 AGAGGAGGAAGAAGAGGAGAAGG + Intergenic
1137457983 16:48632812-48632834 AAAGCAGGAAGAAGGGAAGAGGG - Intergenic
1137705167 16:50530393-50530415 TGAGCAGGGAACAAGGGAGCTGG + Intergenic
1137725884 16:50656318-50656340 AGTGGAAGGTGAAGGGGAGCGGG - Intergenic
1137978828 16:53053201-53053223 GGAGCAGGAGGAAGAGGAGCAGG - Intergenic
1138277437 16:55746036-55746058 AGGGCAGGCAGAAGGAGAGAGGG + Intergenic
1138316875 16:56077792-56077814 ATGGAAGGGAAAAGGGGAGCAGG - Intergenic
1138358578 16:56406085-56406107 AGAGGGGGGAGAGGGGGAGAGGG + Intronic
1138381809 16:56607883-56607905 AGAGCAGGGTGAATGCGACCAGG - Intergenic
1138554654 16:57764470-57764492 GGAGCTGGGGGAAGGGCAGCAGG - Intronic
1138699508 16:58847055-58847077 AGAGGAGGGAGAGGGGGAGGGGG + Intergenic
1138742619 16:59328485-59328507 AGAGGAGGGAGGAAGGGAGAGGG - Intergenic
1138857226 16:60708626-60708648 AGAACATGGAGGAGTGGAGCTGG + Intergenic
1139004225 16:62551398-62551420 AGGGAAGGGAGAAGGAGAGGAGG - Intergenic
1139180180 16:64737891-64737913 GGTGGAAGGAGAAGGGGAGCAGG - Intergenic
1139196247 16:64921646-64921668 AGAGGAAGAAGAAGGGGAGGAGG - Intergenic
1139196277 16:64921817-64921839 AGAGGAAGAAGAAGGGGAGGAGG - Intergenic
1139285109 16:65805778-65805800 AGAGAAGGAAGAAGAGGAGGAGG - Intergenic
1139285114 16:65805813-65805835 AGAGAAGGAAGAAGAGGAGGAGG - Intergenic
1139517023 16:67458234-67458256 AGAGCAGGAAGCTGGGGAGGAGG - Intronic
1139591690 16:67936550-67936572 AGATGAGGGAGACGGGGACCAGG - Intronic
1139652113 16:68367670-68367692 TGAGGAGGGAGAAGCGGGGCGGG - Intronic
1139718571 16:68834252-68834274 ATGGCAGGGAGTTGGGGAGCTGG - Exonic
1139764821 16:69218896-69218918 AAAGCAGGAAGAAGGGGAAAGGG + Intronic
1140048217 16:71456693-71456715 AAAACATTGAGAAGGGGAGCTGG - Intronic
1140104437 16:71946819-71946841 GGAGGAGGGAGAAGGGGATGAGG + Intronic
1140281505 16:73559000-73559022 AGAGAAGGGAGAGGAGGAGGTGG - Intergenic
1140677992 16:77352677-77352699 AGAGGAGGAAGAAGAGGAACAGG + Intronic
1140962005 16:79924321-79924343 AGAGCAAAGGGAAGGGGAGGTGG + Intergenic
1141223349 16:82091907-82091929 AGAGCAGGCACCAGGGGACCAGG - Intronic
1141224450 16:82101690-82101712 AGAGCAAGGAGAAGAGAAGGCGG + Intergenic
1141225010 16:82106562-82106584 AGGGCAGGGTGGAAGGGAGCAGG + Intergenic
1141641625 16:85344812-85344834 AGAGAAGGGAGGGGAGGAGCCGG + Intergenic
1141669905 16:85486194-85486216 AGTACAGAGAGAAGGGGAGAGGG - Intergenic
1141819288 16:86434015-86434037 AGAGGATGGAGGATGGGAGCTGG - Intergenic
1141831110 16:86510450-86510472 GGAGGAGGGCGAAGGGGAGGGGG - Intergenic
1141900394 16:86986965-86986987 AGGGGAGGGGGAGGGGGAGCAGG + Intergenic
1141998303 16:87648660-87648682 TGGGCTGGGAGAGGGGGAGCTGG + Intronic
1142016776 16:87753039-87753061 GGAGCAGGGACAAGGGGCACAGG + Intronic
1142151951 16:88516487-88516509 AGAGGAGGGAAGAGTGGAGCGGG - Intronic
1142186171 16:88695687-88695709 AGAGTAGTGGGAAGGGGAGGTGG + Intergenic
1142246435 16:88972282-88972304 AGAGCAGGGAGCAGGGGCTCTGG - Intronic
1142251443 16:88993765-88993787 GGAGGAGGGAGGAGGGGAGAGGG - Intergenic
1142359470 16:89619514-89619536 AGAGAGGGGAGCAGGGGGGCAGG - Intronic
1142407461 16:89898726-89898748 AGAGCAGAGCAAAGGGGAACAGG - Intronic
1203081937 16_KI270728v1_random:1149584-1149606 AGAGAAGAGAGAAGAGGACCCGG + Intergenic
1142712006 17:1728454-1728476 AGAGGAGGAGGAGGGGGAGCAGG + Exonic
1142980688 17:3669311-3669333 AGAGCAGGACGGAGGCGAGCAGG - Exonic
1143029402 17:3959539-3959561 AGAGGGGGGATGAGGGGAGCAGG - Intronic
1143089387 17:4439936-4439958 AGAGCAGGGGGAGGTGGGGCTGG + Intronic
1143540054 17:7563304-7563326 AGAGGAGGAAGAAGAGGAGGAGG + Exonic
1143691246 17:8568015-8568037 AAGGCAGGGGGAAGGGGAGAGGG - Intronic
1144206059 17:12980241-12980263 AGACCAAGGAGAAGGGAAGCAGG - Intronic
1144207215 17:12987756-12987778 GGATGAGGGAGAAGGGGAGCGGG - Intronic
1144209729 17:13003911-13003933 AGAGGAAGGAGAGAGGGAGCAGG - Intronic
1144495746 17:15743614-15743636 AGAGGAGGAAGAAGAGGTGCAGG - Intronic
1144580560 17:16456658-16456680 AGAGCAGCGAGGAGGGAAGGAGG + Intronic
1144581371 17:16461307-16461329 AGAGCAGGACGAAGGGGTGTGGG - Intronic
1144632741 17:16882324-16882346 AGAGGAGGAAGAAGAGGTGCAGG + Intergenic
1144638449 17:16925210-16925232 AGAGGAGGAAGAAGAGGTGCAGG + Intergenic
1144657677 17:17047927-17047949 TGGGCAGGCAAAAGGGGAGCAGG + Intronic
1144686445 17:17229099-17229121 GGAGCAGTGAGCAGGGGAGAAGG + Intronic
1144761722 17:17710997-17711019 AGAGAAGGGAGCAGGGGAGGGGG - Intronic
1144853664 17:18256774-18256796 AGAGCTGGAAGAAAGGGAGTGGG - Intronic
1144910067 17:18673069-18673091 AGAGAAGAGAGAAGGAGAGTTGG + Intronic
1145158863 17:20560825-20560847 AGAGCAGAGAGAAAGAGAGATGG - Intergenic
1145221629 17:21094212-21094234 GGAGGAGGGAGAGGGGGAGGAGG + Intergenic
1145814744 17:27787627-27787649 AGAGCAGGAGGAAGGGCAGGAGG + Intronic
1146307662 17:31742960-31742982 CGATCAGGGAGAATGGAAGCTGG + Intergenic
1146403655 17:32519409-32519431 GAAGCAGGGAGGAGGGGAGGCGG + Intronic
1146566808 17:33920554-33920576 AGAGAAGGGAGACAGGGAGGGGG + Intronic
1146670850 17:34736503-34736525 AGGAGAGGGAGAAGGGGAGGAGG + Intergenic
1147245205 17:39115679-39115701 GGAGGAAGGAGAAGGGAAGCTGG + Intronic
1147322325 17:39653711-39653733 AGAGCAGGGAGATGAAGAGCAGG - Exonic
1147339918 17:39747120-39747142 AGAGCTAGGAGAAGGAGAGGGGG - Exonic
1147458517 17:40553700-40553722 AGGGCAGGGAGGAGGGGAGAGGG + Intergenic
1147890837 17:43715633-43715655 AAAGTAGTGAGAAGTGGAGCTGG + Intergenic
1147930509 17:43977610-43977632 AGAGTAGGGTGAAGGTAAGCAGG - Intronic
1147935464 17:44008098-44008120 AGAGCAGGGTGTAGGGGTGAGGG - Intronic
1148157602 17:45432591-45432613 AGCGCGGAGACAAGGGGAGCAGG + Intronic
1148189191 17:45666899-45666921 AGACCAGGGAGCGGGGGAGGAGG + Intergenic
1148242078 17:46006428-46006450 TGAGGAGGGTGGAGGGGAGCAGG + Intronic
1148374605 17:47131531-47131553 AGGGGAGGGAGAAGGGGAAAGGG + Intronic
1148457802 17:47820313-47820335 AGAGCAGGGAGCAGGGTGGAAGG + Exonic
1148462551 17:47846932-47846954 GGAGCAGAGAGAAGTGGGGCCGG - Exonic
1148647794 17:49229351-49229373 AGAGCAGGGAGAAGGGCTTCTGG + Intronic
1148674796 17:49438938-49438960 AGTGCAGGGGGACGGGGAGGGGG + Intronic
1148677547 17:49453954-49453976 AGAGGAGAAGGAAGGGGAGCTGG - Intronic
1148684718 17:49495122-49495144 AAGGCAGGGAGAAGCGCAGCGGG + Intergenic
1148746271 17:49920099-49920121 AGGGCAGAGGGAGGGGGAGCTGG - Intergenic
1148760952 17:49999719-49999741 ATGGCAGGGAGAAGGGAAGGGGG + Intergenic
1148767158 17:50046125-50046147 AGAGAAAGGGGAAGGGGAACGGG + Intergenic
1148781319 17:50123676-50123698 GGAGCAGGAAGAGGGGGAGGAGG - Intronic
1148858141 17:50590376-50590398 ACACCAGGGAGAGGAGGAGCAGG - Intronic
1148866025 17:50629135-50629157 GGAGCGGGGAGAGGGGGTGCTGG - Intergenic
1148984960 17:51613315-51613337 AGAGGGGGGAGAAGAGGAGGGGG - Intergenic
1149315136 17:55431865-55431887 AGGGCAGGGGGAGGGGGAGGGGG + Intergenic
1149441602 17:56678856-56678878 GGAGGAGGGGGGAGGGGAGCCGG - Intergenic
1149864891 17:60145850-60145872 AGAGCACTGGGAAGTGGAGCAGG + Intergenic
1150907511 17:69353842-69353864 GGAGCAGGCAGATGGGGAGAGGG + Intergenic
1151011350 17:70501047-70501069 AAAGCAGAGAGGAGGGGAGGAGG + Intergenic
1151116473 17:71740970-71740992 AGAGCTGGGGGAAGGGGAGAGGG - Intergenic
1151159265 17:72151029-72151051 AGAACAGAGAGGAGGGGAGGAGG + Intergenic
1151375163 17:73683520-73683542 AGAGTAGGGGGCAGGGCAGCAGG - Intergenic
1151390552 17:73784186-73784208 TGGGCACGGGGAAGGGGAGCTGG + Intergenic
1151454555 17:74218199-74218221 GGAGGAGGGAAAAGAGGAGCAGG - Intronic
1151716364 17:75833047-75833069 TGGGGAGGGAGATGGGGAGCAGG + Intronic
1151888067 17:76934921-76934943 AGAGGAGGAAGGAGGGGAGATGG + Intronic
1151896385 17:76983405-76983427 GGAGAAGGGAGGAGGGCAGCGGG - Intergenic
1152282116 17:79390941-79390963 AGAGAAGGGAGAAGCAGAGCTGG - Intronic
1152515347 17:80820388-80820410 ACAGCACGGAGAAGGGGCACGGG - Intronic
1152598425 17:81249417-81249439 AGAGGAGGGAGAAGGAGGGAGGG + Intronic
1152638637 17:81440419-81440441 AAACAAGGGGGAAGGGGAGCGGG - Intronic
1152658296 17:81530153-81530175 AGGGCAGGGAGCTGGGGATCGGG + Intronic
1152779239 17:82219106-82219128 TGGGCAGGGAGGAGAGGAGCAGG + Intergenic
1152844896 17:82593647-82593669 AGAGCAGGACACAGGGGAGCCGG + Intronic
1152939715 17:83161779-83161801 AGGGAAGGGAGATGGGGAGAGGG - Intergenic
1153042869 18:830466-830488 AGACCAAAGACAAGGGGAGCTGG + Intergenic
1153772517 18:8426837-8426859 AGTGCAAGGAAAAGGGGAGATGG - Intergenic
1153852119 18:9104694-9104716 GGGGGAGGGAGAAGGGGAGACGG - Intronic
1153951490 18:10061375-10061397 GGAGCAGGGAGAGGGGGAAAAGG - Intergenic
1155021087 18:21897635-21897657 AAAGCAGGGAGGAGGGAAGCAGG - Intergenic
1155043648 18:22085578-22085600 AGAAAAGGGAGAAGAGGGGCTGG - Intergenic
1155066532 18:22273754-22273776 GGAGGAGGGAGGAGGGGAGGAGG - Intergenic
1155067519 18:22280452-22280474 CAAGCAGGGAGAAGGGGAGAAGG + Intergenic
1155519902 18:26657094-26657116 AGAGCAGGGCGGAGCAGAGCGGG - Intronic
1155549483 18:26949827-26949849 ACAGCAGAGAGAAGGCGAGGTGG + Intronic
1155605642 18:27602470-27602492 AGGGCAGGGACAGGGGGAGATGG + Intergenic
1156022101 18:32611546-32611568 AGAGCAAGGAGAGAGGGAGCGGG - Intergenic
1156090819 18:33466630-33466652 AGAGCAGGAAAAAGGGGGGTGGG - Intergenic
1156367451 18:36442145-36442167 GAATCTGGGAGAAGGGGAGCAGG - Intronic
1156968518 18:43126685-43126707 AGAGCAGGTATAAGGCAAGCAGG + Intergenic
1157049498 18:44145302-44145324 AGAGCAGGGACAAGCTGAGAGGG + Intergenic
1157124022 18:44938060-44938082 GAAGCAGGGAGTGGGGGAGCAGG + Intronic
1157138403 18:45081674-45081696 AGAGCTGGAGGAAGGAGAGCTGG - Intergenic
1157333318 18:46719346-46719368 AGAGGAGTGAGAAAGGGAGTAGG + Intronic
1157470149 18:47982587-47982609 AGAAGGGGGAGAAGGGGAGAAGG + Intergenic
1157804833 18:50650330-50650352 AGAGGAGAGAGAAAGGGAGGGGG - Intronic
1157968704 18:52240209-52240231 AGAGGTGGGAGAAAGAGAGCTGG + Intergenic
1158235012 18:55302699-55302721 AGGGCATGAAGAAGGGGAGGTGG + Intronic
1158397220 18:57088768-57088790 AGGACAGGGAGAAAAGGAGCTGG + Intergenic
1158423140 18:57313553-57313575 AGAGGAGGAGGAAGGGGAGGAGG + Intergenic
1158610454 18:58935352-58935374 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1158610487 18:58935435-58935457 GGAGGAGGGAGAAGGGGAGAGGG - Intronic
1158684959 18:59605168-59605190 ACAGCAGGGAGAAATGGAGAAGG + Intronic
1158855720 18:61541922-61541944 AGAACAGAGAGCAGGAGAGCGGG + Intronic
1159550868 18:69894566-69894588 AGGGGAGGGAGATGGGGAGGGGG + Intronic
1160005738 18:75067909-75067931 GACGCAGGGGGAAGGGGAGCGGG + Intergenic
1160182041 18:76644898-76644920 AGACCAGGGAGAGGGAGAGGGGG - Intergenic
1160307960 18:77758637-77758659 TGAGCAGGTAGAAGGGCATCTGG + Intergenic
1160373015 18:78390330-78390352 AGAGGAGGGAGAGAGGGAGGAGG + Intergenic
1160382565 18:78471769-78471791 AGGGCATGGGGGAGGGGAGCTGG + Intergenic
1160413580 18:78691015-78691037 TGAGCAGAGAGGAGAGGAGCTGG - Intergenic
1160430956 18:78812270-78812292 GGAGGTGGGAGAAGGGGGGCCGG - Intergenic
1160533347 18:79577944-79577966 AGAGAAGGGAGATGAGGAGTAGG - Intergenic
1160615559 18:80124658-80124680 AGGGCAGGGAGAAGGGCTGAAGG - Intronic
1160695137 19:480234-480256 TGAGCAAGGAGAAGAGGAGCCGG + Intergenic
1160916847 19:1500822-1500844 GGAGGAGGGAGGAGGGGAGGAGG + Intergenic
1160916859 19:1500844-1500866 GGAGGAGGGAGGAGGGGAGGGGG + Intergenic
1160969081 19:1759471-1759493 TGAGCAGGGAGAGGAGGAGGAGG + Intronic
1161030779 19:2056822-2056844 AGAGGAGGGGGAAGGGGAGGAGG - Intergenic
1161093847 19:2377494-2377516 AGGGGAGGGGGAAGGGGAGAGGG - Intergenic
1161125478 19:2554965-2554987 AGAGCTGGTAAAAGGGGATCTGG + Intronic
1161203574 19:3029014-3029036 GGAGGAGGGAGAAGCGGCGCGGG + Exonic
1161225940 19:3146027-3146049 GGAGCACGGAGAAGGGGCGGGGG - Intronic
1161267393 19:3370620-3370642 AGAGAAGAGAGAAGGAGAGAGGG - Intronic
1161292835 19:3504775-3504797 AGGGCTGGGAGAGGGGGATCAGG - Intergenic
1161403962 19:4081669-4081691 AGAGCAGGGAGGAGGGAGGAGGG - Intergenic
1161469332 19:4448412-4448434 AGTGCTGGGAGGAGGGAAGCAGG + Exonic
1161504050 19:4634484-4634506 AGAGGAGGGAGAGAGGGAGAGGG + Intergenic
1161611790 19:5247378-5247400 AGGACAGGGGGAAGGGGAGGAGG + Intronic
1161619687 19:5291532-5291554 AGAGCAGCGAGCACAGGAGCTGG - Intronic
1161783217 19:6307293-6307315 AGAGAGGGGAGAGGGGGACCAGG + Intronic
1161820863 19:6530790-6530812 ACAGCAGGGAGAAAGGAACCTGG + Intergenic
1161915482 19:7225037-7225059 AGAGGAGAGAGGAGGGGAGAGGG + Intronic
1162038148 19:7953489-7953511 AGAGGAGGGGGAGGGGGAGGAGG - Intergenic
1162162769 19:8731100-8731122 CCACCAGGGAGAAGAGGAGCTGG - Exonic
1162307768 19:9885771-9885793 AGGGCAGGGGTGAGGGGAGCAGG - Intronic
1162326024 19:10000079-10000101 AGGGCAGGGAGAAGAGAAGAGGG - Intronic
1162531054 19:11236738-11236760 AGGGCAGGCAAGAGGGGAGCAGG + Intronic
1162931970 19:13962015-13962037 AGAGCAGCGAGCCGCGGAGCCGG - Exonic
1162959927 19:14119621-14119643 AGGGCACAGAGAGGGGGAGCGGG + Exonic
1163104725 19:15116619-15116641 CGAGCAGGCAGACGGGAAGCAGG + Intronic
1163173529 19:15549210-15549232 AGGGCAGGGAGGAGTGGGGCAGG - Intronic
1163213923 19:15862470-15862492 AGGGGAGGGAGAGGGGGAGGGGG + Intergenic
1163277591 19:16295099-16295121 AGAGGAGGGGGAGGGGGAGGGGG + Intergenic
1163593195 19:18205560-18205582 AGGGCAGGGAGAATGGGAGGTGG - Intergenic
1163667254 19:18609103-18609125 AGAGGAGGGGGAAGAGGAGAGGG - Intronic
1163786762 19:19278830-19278852 GAAGCAGGAAGGAGGGGAGCAGG + Intronic
1164109158 19:22138200-22138222 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1164489483 19:28693410-28693432 ACAGAAGGCAGAGGGGGAGCTGG - Intergenic
1164567665 19:29339487-29339509 AGAGGAGGAAGAAGGGGAAGTGG + Intergenic
1164680550 19:30131187-30131209 GGGGAAGGGAGAAGGGGAGGGGG - Intergenic
1164681041 19:30133936-30133958 TGAGCAGGGAGCTGGGGAGAGGG + Intergenic
1164748076 19:30630653-30630675 AGAGCAGGCAGAAGGGAGGTCGG - Intronic
1164833423 19:31340523-31340545 CGGGCAGGGAGGAGGGGAGAGGG + Intronic
1164947942 19:32311903-32311925 ACTGCAGGGATAAGGGGAGCTGG - Intergenic
1165156077 19:33788893-33788915 AGAGAAGGGTGACAGGGAGCTGG + Intergenic
1165157389 19:33796645-33796667 AGAGGAGGGAGGAGAGGAGGTGG + Intronic
1165293040 19:34904759-34904781 AGAGAAGAGAGAAGGGAAACTGG + Intergenic
1165476149 19:36032291-36032313 AGAGGAGGAAGAAGAGGAGGAGG - Exonic
1165494299 19:36142609-36142631 AGAGCAGGGGGAGGGGAACCCGG - Intronic
1165673981 19:37705823-37705845 AGAGAAGGGAGCAGGGGTGGGGG - Intronic
1165940075 19:39410482-39410504 AGAGAAGGGAGACGGGAAGGAGG - Intergenic
1166199954 19:41231053-41231075 AGAGTTGGGAGGTGGGGAGCTGG + Intronic
1166321683 19:42022752-42022774 AGAGCAGGGAGAGAGGAGGCAGG + Intronic
1166338381 19:42122483-42122505 TGGGCAGGGAGCAGGGGGGCAGG - Intronic
1166652168 19:44582769-44582791 AGAGTAAGGGGAAGGGGAGGAGG + Intergenic
1166672412 19:44718875-44718897 AGAGCAGGGAGGAGGGAAGGGGG + Intergenic
1166790447 19:45395896-45395918 AGGGAAGGGAGAAGGGGATCGGG + Intronic
1167041944 19:47027697-47027719 GGGGCAGAGAGAAGGGGACCAGG - Intronic
1167048991 19:47067477-47067499 GGAGGAGGAGGAAGGGGAGCGGG - Exonic
1167191244 19:47991601-47991623 AGAGGAGGAAGAGGGGGAGGAGG - Intronic
1167356359 19:49006671-49006693 AGAGCTGGACGAAGGGGACCAGG - Intronic
1167418508 19:49389641-49389663 AGAGCAGGCACTGGGGGAGCTGG + Intronic
1167465865 19:49650976-49650998 AGATGAGGGAGAAGGGGAAGGGG - Exonic
1167573433 19:50305183-50305205 AGAGGAGGGAGACTGGAAGCTGG + Intronic
1167601419 19:50457217-50457239 AGAGCACGGAGGAGAGGAGGAGG - Intronic
1168100922 19:54140508-54140530 GGACCAGAGAGAAGGGAAGCTGG - Intronic
1168149111 19:54435598-54435620 ACAGCAGGGAGAAGAGTAGCAGG - Exonic
1168333843 19:55585866-55585888 GGAGCCGGGAGGAGGGGGGCGGG + Intergenic
1168389403 19:55993551-55993573 AGAGGAGGGGGAGGGGGAGGGGG - Intergenic
1168478825 19:56699738-56699760 AGAGAATGGAGAAGGTGACCTGG + Intergenic
1168525770 19:57087765-57087787 AGAGAGGGGAGAGGGGGAGGGGG + Intergenic
925032373 2:660876-660898 AGAGCAGGGGAACGAGGAGCGGG + Intergenic
925146026 2:1584164-1584186 AGGGCAGGAAGGAGGGAAGCAGG - Intergenic
925321187 2:2970400-2970422 AGAGCAGAGTGAAGAGGTGCAGG - Intergenic
925716231 2:6786608-6786630 AGAGGAGAGAGTAGGGGAGCAGG - Intergenic
925733485 2:6940892-6940914 GGAGCAGGGAGGAGAGGAGCAGG - Intronic
925807098 2:7661209-7661231 GGGGAAGGGAAAAGGGGAGCAGG + Intergenic
925988593 2:9235590-9235612 GGAGGAGGGAGAACTGGAGCTGG + Intronic
926005869 2:9373172-9373194 AGAGCGGGCAGAACTGGAGCCGG + Intronic
926082287 2:9997325-9997347 AAAGCAGGGAGATGGGGCGTGGG + Intronic
926138187 2:10352266-10352288 AGAACAGTGAGATGGGGAGAGGG - Intronic
926294964 2:11562494-11562516 AGAAGAGGGAGAAGGAGGGCTGG + Exonic
926977084 2:18525953-18525975 AGAGGAGGAGGAAGGGGAGCAGG - Intergenic
927232140 2:20834612-20834634 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
927232147 2:20834624-20834646 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
927232154 2:20834636-20834658 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
927689561 2:25198171-25198193 AGGAAGGGGAGAAGGGGAGCGGG + Intergenic
927881392 2:26692557-26692579 CGAGGAGGGAGGAGGGGGGCTGG - Intergenic
927892806 2:26763024-26763046 AAAGCCGGGAGGAGGGGAGAGGG - Intergenic
927935577 2:27074188-27074210 AGACCTGGGAGAAGGGGAACTGG + Intergenic
928093443 2:28390518-28390540 AGAGGCGGGGGAAGGGGAGCGGG - Intergenic
928105807 2:28470005-28470027 GGAGGAGGGAGAAGGGGAAGTGG + Intronic
928105818 2:28470033-28470055 AGAGGAGGGGGAAGGGGAGGAGG + Intronic
928105829 2:28470063-28470085 AGAGGAGGAGGAAGGGGAGGAGG + Intronic
928373197 2:30756110-30756132 AGAGCAGGGACTGGGGGAGACGG - Intronic
928619184 2:33071547-33071569 GGAACAGGGGGAAGGGAAGCAGG + Intronic
928958666 2:36898885-36898907 AGAGAAGGGAGAAGGGGAAGAGG + Intronic
929121069 2:38484488-38484510 GGAGCGGGGAGAGGGGCAGCAGG - Intergenic
929123788 2:38504485-38504507 TGAGAAGGGGGAAGGGGAGGTGG - Intergenic
929237138 2:39617322-39617344 AGAGGAGGAAGAGGAGGAGCTGG - Intergenic
929246688 2:39710039-39710061 AGAACAGGGAGAGGTGGAGCTGG - Intronic
929442400 2:41974214-41974236 AGGGCAGGGAGAGGAGGAGAGGG + Intergenic
929444479 2:41991897-41991919 AAAGGAGGGAGAAGGGGAAGGGG + Intergenic
929444501 2:41991947-41991969 AGGGGAGGGAGAAGAGGAGGGGG + Intergenic
929553022 2:42906296-42906318 GGCCCAGGGAGAAGGAGAGCAGG - Intergenic
929887507 2:45892015-45892037 AGAGCAGGGCCAAGGTAAGCAGG - Intronic
929941645 2:46338477-46338499 AAAGCAGGGAGAAAGCCAGCGGG - Intronic
930068640 2:47347566-47347588 TGAGCAGGGAGATGGAGAGGTGG - Intronic
930136263 2:47906185-47906207 AGAGAAGGGAGGGAGGGAGCAGG + Intergenic
930302207 2:49630629-49630651 AGGGCAGAGAGAAGGGGAAGGGG + Intergenic
930316814 2:49806738-49806760 AAAGCAGGGAGAGGTGGAGAGGG + Intergenic
930416414 2:51095620-51095642 AGAACAGGAAGAAGTGGAGGAGG + Intergenic
931107994 2:59078762-59078784 GGAGGAGGGAGAAGGAGAGTTGG - Intergenic
931549786 2:63430220-63430242 AGAGCAGGGAGAGAGGGAGGAGG + Intronic
931604986 2:64043229-64043251 AAGGCAGGGAGGAAGGGAGCTGG + Intergenic
932400642 2:71478907-71478929 AGAGCCTGGAGAAGAGGAGGAGG - Intronic
932477095 2:72013132-72013154 AGTGCTGGGGGAAGGGAAGCGGG + Intergenic
932866201 2:75345595-75345617 GGAGCAGAGAGCAGTGGAGCGGG + Intergenic
932903923 2:75729678-75729700 AGTGGAAGGTGAAGGGGAGCAGG - Intergenic
933263614 2:80156950-80156972 AAAGAAGGGAGAAGGAGAACTGG + Intronic
933277959 2:80303111-80303133 AGTGCAGGGAGATGAGGCGCGGG + Exonic
933283608 2:80359562-80359584 AGAGCAGGAGGAAGAGGGGCAGG - Intronic
933658666 2:84908921-84908943 AGAGAAGTGAGAATGAGAGCAGG + Intergenic
933734771 2:85486985-85487007 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
933734776 2:85487000-85487022 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
933849749 2:86356367-86356389 GGAGCAGGGCCAGGGGGAGCAGG + Intergenic
934066988 2:88349984-88350006 AGACCAGGGTGAAGGGAAGGAGG + Intergenic
934174142 2:89564321-89564343 AGGGCAGGGAGCAGGGTAGAGGG - Intergenic
934284458 2:91638670-91638692 AGGGCAGGGAGCAGGGTAGAGGG - Intergenic
935062526 2:99620851-99620873 AGAAGAGGGAGAAGAGGAGGAGG - Intronic
935070468 2:99689389-99689411 AGAACAGGGAGAAGGGCATCAGG - Intronic
935272765 2:101449344-101449366 AGAGCAGGGAGAGGCTGAGGAGG + Intronic
935538771 2:104325568-104325590 AGAGGAGGGAGAGGGAGAGAAGG - Intergenic
935543386 2:104375731-104375753 AGAGCAGGAGAAAGGGGAGGAGG + Intergenic
935636014 2:105250566-105250588 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
935636019 2:105250581-105250603 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
935636024 2:105250596-105250618 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
935652306 2:105392708-105392730 AGAGTAAAGAGAAGGGGAGAAGG + Intronic
935740562 2:106143844-106143866 AGACCAGGCAGAAGGGAAGCTGG - Intronic
935778925 2:106494807-106494829 ACACCAGAGACAAGGGGAGCTGG - Intergenic
935931545 2:108132451-108132473 AGAGCAGGAGCAAGGGGAGAGGG + Intergenic
936075626 2:109399909-109399931 AGCGCAGGGAGAAATGGAGTGGG - Intronic
936094849 2:109523726-109523748 AGTTCAGGGAGATGGGGTGCAGG - Intergenic
936140417 2:109935409-109935431 AGATCAAGGGGGAGGGGAGCAGG + Intergenic
936177107 2:110233354-110233376 AGATCAAGGGGGAGGGGAGCAGG + Intergenic
936204278 2:110436077-110436099 AGATCAAGGGGGAGGGGAGCAGG - Intronic
936443404 2:112576012-112576034 AGAGCAGGGTGTAGGGAACCTGG - Exonic
936665549 2:114591095-114591117 AGAGCAGGGAGAAGGGTTAGTGG + Intronic
936669432 2:114639497-114639519 AGAGTAGGGAGAGAGGGAGGGGG + Intronic
936671459 2:114662063-114662085 AGAGCAGAGGGAGGGGCAGCCGG - Intronic
936985813 2:118310615-118310637 AGCGCAGGAAGAAGGGGTGAGGG + Intergenic
937098077 2:119248583-119248605 AGAGCTGGAAGGAGGGGAGAGGG + Intronic
937322496 2:120969350-120969372 ACAGAAGGGAGAAGGGTGGCTGG - Intronic
937437095 2:121889601-121889623 AAACCAGGGAGAAGAGAAGCAGG - Intergenic
937504098 2:122516794-122516816 AGAGCAGGTAGCAGGGCAGCAGG - Intergenic
937631509 2:124107107-124107129 AGCTCAGGGAGAAAGAGAGCTGG + Intronic
937735020 2:125277778-125277800 AGACCAGGGAGAGGGAGAGGGGG + Intergenic
937777541 2:125797319-125797341 AGAGGAGGGGGAGGGGGAGGGGG + Intergenic
937972826 2:127563983-127564005 TGAGCAGGGAGAAAGAGAGATGG + Intronic
937990224 2:127658081-127658103 AGAGCAGGCAAGAGGGTAGCTGG + Intronic
938079082 2:128359735-128359757 ACAGAAGGGGAAAGGGGAGCAGG - Intergenic
938293450 2:130162414-130162436 AGAGCAGGGAGTGAAGGAGCAGG + Intronic
938463102 2:131510547-131510569 AGAGCAGGGAGGGAAGGAGCAGG - Intergenic
938657339 2:133447624-133447646 AGAGAAGGGGGAAGGGGAAGGGG - Intronic
938939960 2:136161521-136161543 AGAGCAGGGATGAGGGGAGGGGG - Intergenic
939125511 2:138172948-138172970 AGAGCAGGAGGAAAGGGGGCAGG - Intergenic
939428249 2:142069054-142069076 AGAGAAGGGAGAAGGGTGGAGGG - Intronic
940025673 2:149204749-149204771 GGAGCAGTGAGAAGGACAGCAGG - Intronic
940202756 2:151169078-151169100 AGGGCAGAGTGAAGGGAAGCAGG - Intergenic
940586475 2:155658455-155658477 AGGGGAGGGGGAAGGGGAGGGGG + Intergenic
940586482 2:155658467-155658489 AGGGGAGGGGGAAGGGGAGGGGG + Intergenic
940586487 2:155658479-155658501 AGGGGAGGGGGAAGGGGAGAGGG + Intergenic
940639554 2:156332573-156332595 AGAGCTGGGCGAAGGGAACCCGG + Exonic
940697717 2:157000561-157000583 TGACCAGAGAGAAGGGGAGAGGG - Intergenic
940719596 2:157267607-157267629 ACGGCAGGGAGAAGAGGAGGAGG - Intronic
940775031 2:157876130-157876152 AGAGGAGGAGGAAGGGGAGGAGG + Intergenic
940789311 2:158015235-158015257 AGAGCTGGGAAAGGGGGAGTGGG - Intronic
941121441 2:161535134-161535156 AGAGCAGGGAGGATGGAAGTGGG + Intronic
941420897 2:165281967-165281989 TGGGCAGGGAGCAGGGGTGCAGG - Intronic
941493359 2:166170165-166170187 AGAGTCGGGAGAAAGGGAGGTGG + Intergenic
942133696 2:172905078-172905100 CGAGAAAGGAGAAAGGGAGCAGG - Intronic
942758280 2:179367400-179367422 AGAGAAGGGAGAAGGTGATTCGG - Intergenic
943005565 2:182385716-182385738 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005570 2:182385731-182385753 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005575 2:182385746-182385768 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005580 2:182385761-182385783 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005585 2:182385776-182385798 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005590 2:182385791-182385813 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005595 2:182385806-182385828 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005600 2:182385821-182385843 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943005605 2:182385836-182385858 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
943073985 2:183172787-183172809 AGAGCAGAGAGGAGCGAAGCTGG - Intergenic
943516249 2:188890898-188890920 GGAGCAGGGTGCAGCGGAGCAGG - Intergenic
943921503 2:193713208-193713230 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
943921510 2:193713220-193713242 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
943921517 2:193713232-193713254 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
944328786 2:198440638-198440660 AGAACAGGGAAAAGGTGAGATGG + Intronic
944535364 2:200704391-200704413 GGAGCAGAGAGCAGGGGAGATGG + Intergenic
944853610 2:203744840-203744862 GCAGAAGGGGGAAGGGGAGCTGG - Intergenic
945080803 2:206085343-206085365 AGACCCGGGGGAAGGGGAGCCGG + Intronic
945111123 2:206360761-206360783 AGAGCAGGGAGTGGGGGAGAAGG + Intergenic
945131327 2:206575886-206575908 TGAGTAAGGAGTAGGGGAGCTGG + Intronic
945990089 2:216388757-216388779 AGAGAAGGAAGAAGGAGAGGAGG - Intergenic
946057853 2:216917285-216917307 AAAGCAGAAAGAAGGGGAGTGGG - Intergenic
946103037 2:217343483-217343505 GGGGCAGGGAGAAGGGAGGCAGG - Intronic
946115501 2:217458478-217458500 AAATCAAAGAGAAGGGGAGCAGG - Intronic
946135611 2:217644529-217644551 AGAACAGGGAGAAGAAGGGCAGG - Intronic
946160681 2:217834257-217834279 AGAGGAGGGAGAACTGGAGCTGG - Intronic
946175187 2:217918282-217918304 ACACCAGGGAGCGGGGGAGCTGG + Intronic
946183915 2:217966039-217966061 AGAGCAGAGAGAAGGGCAAATGG - Intronic
946228881 2:218279528-218279550 ATGGCAGGGAGCATGGGAGCGGG - Intronic
946427736 2:219608390-219608412 AGAGGAGGAAGAAGAGGAGCAGG + Exonic
946710383 2:222499400-222499422 ACTGCAGGGAGCAGGGGAGCAGG - Intronic
946734394 2:222740052-222740074 AGCGGAAGGTGAAGGGGAGCTGG + Intergenic
946832650 2:223741831-223741853 AGAGGAGGAGGAAGGGGAGGAGG - Intergenic
946916107 2:224523872-224523894 AGAGAAGGTAGAATGGTAGCTGG + Intronic
947175554 2:227363476-227363498 AGAGAAAGGAGAAGGGAAGGAGG - Exonic
947833380 2:233158003-233158025 AGAGGAGGAAGAAGAGGAGAAGG + Intronic
947936569 2:234009642-234009664 AGAGCAAGGGGAAAGGGAGAAGG - Intronic
947999383 2:234555281-234555303 AGAGCAGGAAGGAGGGTAGTTGG + Intergenic
948017955 2:234705478-234705500 AGAGCAGGAGGAAGAGGAGAGGG - Intergenic
948025492 2:234772859-234772881 ACAGCAGGGAGGACGGCAGCAGG + Intergenic
948101211 2:235374739-235374761 AGGGGAGGGAGAAGGGGAGATGG - Intergenic
948109183 2:235440624-235440646 AGACCCGGGAGACGGGGAGGAGG + Intergenic
948316669 2:237032414-237032436 AGAGCAAGGAGAAGGTGACTTGG - Intergenic
948335113 2:237201497-237201519 AGGGAAGGGGGAAGGGAAGCAGG + Intergenic
948534552 2:238636257-238636279 AGACCAGGAAGAATTGGAGCAGG + Intergenic
948581659 2:238991310-238991332 AGAGCAAGGAAGAGGGGAGGAGG - Intergenic
948696766 2:239736763-239736785 AGGGCAGGGAGGCGGGCAGCAGG + Intergenic
948815549 2:240508381-240508403 AAAGCAGGGAGCAGAGGTGCTGG + Intronic
948857906 2:240738827-240738849 AGAGAAGGAAGAGGGGAAGCTGG - Intronic
949008769 2:241666871-241666893 AGAACTGGGAGAAGGGGACGGGG - Intronic
1169045899 20:2534445-2534467 AGAGCAGGGTAAAGGGCTGCTGG + Intergenic
1169064915 20:2689734-2689756 GGAGCTGGGAGACAGGGAGCTGG + Intergenic
1169214417 20:3785190-3785212 AGAGGAGGAGGAAGGGGAGGAGG - Exonic
1169254334 20:4085667-4085689 AGAGCACGGGGCTGGGGAGCTGG - Intergenic
1169504899 20:6198866-6198888 AGAGAAGGGAGCAGGGGGGCTGG + Intergenic
1169859170 20:10133298-10133320 ACAGCAGGGAGTAGGGAAGAAGG - Intergenic
1170165222 20:13355064-13355086 AGGGAAAGGAAAAGGGGAGCAGG + Intergenic
1170618636 20:17975652-17975674 AAATCAGGGAAAAGGGGAGGGGG - Intronic
1170733824 20:18996383-18996405 AGAGAAGGGGGAGGGGGTGCAGG + Intergenic
1170740884 20:19054950-19054972 AGAGGAGGGAGAAGGGCCACTGG - Intergenic
1170759068 20:19233501-19233523 AGAGTAGGAAGGAGGGGAGGAGG + Intronic
1170765324 20:19285027-19285049 AGGGCAGAGGGAAGGGGAGGAGG - Intronic
1170813194 20:19691388-19691410 AGACCAGGGAGTATGTGAGCAGG + Intronic
1170888823 20:20363157-20363179 AGAGCAGGGAGAAGAGTGGGGGG + Intergenic
1171128141 20:22622945-22622967 AGAGCGGGGAGGAAGGAAGCAGG + Intergenic
1171290697 20:23981466-23981488 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1171941144 20:31331003-31331025 AGGGCAGGGGGAGGGGGAGAAGG + Intergenic
1172003295 20:31798510-31798532 AGAGCAGAAAAAAGAGGAGCTGG + Exonic
1172030059 20:31975372-31975394 AGAGCAAGGGGGTGGGGAGCAGG - Intronic
1172281861 20:33713460-33713482 AGAGCAGGGAAAAAGGGAAAGGG - Intronic
1172292111 20:33784060-33784082 GGAGGAGGGAGATGGGGAGGAGG - Intronic
1172369701 20:34379486-34379508 AGAGCAGGGAGGAGGTGAAATGG - Intronic
1172408017 20:34703880-34703902 AGAGCAGGAATAAGGGCAGTGGG + Intronic
1172432960 20:34907787-34907809 AGAACAGGGAGAGAGGAAGCTGG - Intronic
1172465207 20:35151366-35151388 AGAGGAGGGGGATGGGGAGGGGG + Intergenic
1172619044 20:36307448-36307470 AGCGGAGGAAGAAGGGGAGAAGG - Intronic
1172623855 20:36336426-36336448 AGAGCAGGGAGAAGGGTGAGAGG - Intronic
1172694359 20:36811944-36811966 AGAGCAAGGAGAAGCTCAGCAGG + Intronic
1172720781 20:36999429-36999451 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1172720791 20:36999457-36999479 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1172771006 20:37382667-37382689 ACAGCGGGGAGAGGTGGAGCAGG + Exonic
1173030460 20:39353861-39353883 ATAGAAGGCATAAGGGGAGCAGG + Intergenic
1173032418 20:39374299-39374321 AGAACAGAGAGAAGGGGATGTGG - Intergenic
1173084917 20:39906626-39906648 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1173225054 20:41157680-41157702 AGAGAAGGGAGCCGGGGAGGTGG + Intronic
1173658184 20:44715414-44715436 AGAGGAGGGAGAAGGCCAGGAGG - Exonic
1174243799 20:49160848-49160870 AGGGCAGGGAGAAGAGGTGATGG - Intronic
1174256222 20:49257626-49257648 TGAGGAGGAAGAAGGGGAGGAGG - Exonic
1174364282 20:50047074-50047096 AGAAAAGGGAGCAAGGGAGCAGG - Intergenic
1174738002 20:52984047-52984069 AGAGCAGGAAGAAGGGAAGCTGG + Intronic
1175207177 20:57320042-57320064 AGAGAAAGGAGAAGGGGAAATGG + Intergenic
1175221929 20:57422196-57422218 GGAGCAGGGAACAGGGGAGGGGG - Intergenic
1175237268 20:57523878-57523900 ACAGCAGCAAGAAGGGGTGCAGG - Exonic
1175356468 20:58372947-58372969 AGAGCAGGGAGCAGAGAGGCTGG + Intergenic
1175442790 20:59002847-59002869 GGAGCGGGGAGAAGGAAAGCTGG - Intronic
1175487347 20:59355621-59355643 AGAGAGGGGAGAGGGGGAGAGGG - Intergenic
1175487438 20:59355874-59355896 AGAGAGGGGAGAAGGAGAGAGGG - Intergenic
1175491542 20:59383907-59383929 TGAGCAGGGAGGAGGTGAGCAGG + Intergenic
1175491558 20:59383978-59384000 TGAGCAGGGAGAAGATGAGCAGG + Intergenic
1175491605 20:59384111-59384133 TGAGCAGGGAGGAGGTGAGCAGG + Intergenic
1175491645 20:59384282-59384304 TGAGCAGGGAGGAGGCGAGCAGG + Intergenic
1175672315 20:60915537-60915559 AGGGCAGGGAGGAGGGGCGATGG - Intergenic
1175712340 20:61231402-61231424 ACAGCATGGGGAATGGGAGCAGG - Intergenic
1175730952 20:61353646-61353668 AGAGGAGGAAGAAGAGGAGGAGG - Intronic
1175782603 20:61693020-61693042 AGAGGAGGGAGAATGCCAGCTGG + Intronic
1175975207 20:62707560-62707582 GGAGGAGGGAGCAGGGGAGGGGG + Intergenic
1175986968 20:62768860-62768882 ATTGCAGGGAGTTGGGGAGCTGG - Intergenic
1176057158 20:63154876-63154898 AGAAGAGGGAGAAGGGGAGAGGG - Intergenic
1176057266 20:63155350-63155372 AGGGGAGGGAGGAGGCGAGCAGG + Intergenic
1176100673 20:63363068-63363090 AGAGCAAGGAGAGGAGGAGGAGG - Intronic
1176115082 20:63428677-63428699 ACAGCAGGGAGGAGGGAAGAGGG + Intronic
1176142471 20:63550888-63550910 AGACCAGGGGGATGGGGTGCAGG + Intronic
1176239010 20:64067382-64067404 AGTGCCGGGAGAGGGGAAGCGGG + Intronic
1176383955 21:6127758-6127780 AGAGAAGAGAGAGGGGGAGAGGG + Intergenic
1176719009 21:10378471-10378493 AAATCAGGGAGGTGGGGAGCTGG - Intergenic
1177972033 21:27801894-27801916 AGATCAGGCAGAAGCGGGGCTGG + Intergenic
1178498176 21:33104338-33104360 AAAGCAGGGAAGTGGGGAGCAGG + Intergenic
1178663085 21:34522947-34522969 ACGGCAGGGAGAGGGGTAGCTGG - Intronic
1178795935 21:35744387-35744409 AAAGCAGGGAGGAAGGGAGGGGG - Intronic
1179084953 21:38207877-38207899 AGAGTAGAGAGGAGGGGAGGAGG - Intronic
1179171452 21:38976015-38976037 TGAGCAGGCAGATGGGAAGCAGG + Intergenic
1179186089 21:39086282-39086304 TTAGCAGGGAGAAGGGGGCCAGG + Intergenic
1179215861 21:39366809-39366831 AGAGAAGGGGGAAGGGAAGGGGG - Intergenic
1179443269 21:41410984-41411006 AGGGCAGGGAGAAGGGGAAATGG + Intergenic
1179464260 21:41561319-41561341 GGAGCAGAGAGGAAGGGAGCAGG - Intergenic
1179739519 21:43410480-43410502 AGAGAAGAGAGAGGGGGAGAGGG - Intergenic
1179894238 21:44352328-44352350 GGAGGAGGGAGAGGGGGAGGTGG + Intronic
1179986211 21:44921582-44921604 AGAGAAGGGAGAGGAGGAGGAGG + Intronic
1180050866 21:45330529-45330551 CGAGCAGTGAGCAGGGCAGCAGG - Intergenic
1180129268 21:45816486-45816508 AGGGGAGGGGGAAGGGGAGGAGG - Intronic
1180186829 21:46144468-46144490 AGGGGAGGGAGAGGGGGAGAGGG - Intronic
1180210992 21:46295495-46295517 AGAGCTGGGGGAAGAGGAGGAGG - Intronic
1180252855 21:46601111-46601133 AGGGCAGGGGGAGGGGGCGCTGG - Intronic
1180300241 22:11031453-11031475 AAATCAGGGAGGTGGGGAGCTGG - Intergenic
1180552997 22:16555995-16556017 AGAGCAGGAAGCAGGGGCGGGGG + Intergenic
1180581495 22:16843385-16843407 AGAGAAGGGAGAAGGGGAAGAGG + Intergenic
1180766724 22:18349601-18349623 AGAGATGGGAGCTGGGGAGCAGG + Intergenic
1180779590 22:18512777-18512799 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1180812305 22:18770098-18770120 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1180881007 22:19203588-19203610 ACAGCAGGGAGAGGGGGAGATGG - Intronic
1181079271 22:20403160-20403182 AGAGCAGAGAGAAGAGGCCCAGG - Intronic
1181198462 22:21204345-21204367 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1181351094 22:22258444-22258466 AGAGCAGGAAGCAGGGGCGGGGG - Intergenic
1181625321 22:24118934-24118956 TGAGCACTGAGCAGGGGAGCAGG + Intronic
1181641745 22:24204399-24204421 AGAGCAGTGTGGAGGGCAGCTGG - Intergenic
1181648260 22:24245437-24245459 AGAGATGGGAGCTGGGGAGCAGG - Intergenic
1181703244 22:24632536-24632558 AGAGATGGGAGCTGGGGAGCAGG + Intergenic
1181719050 22:24759889-24759911 AGAGCAGCAAGAGGAGGAGCAGG - Exonic
1181890666 22:26060418-26060440 AGAGCAGGGAAAAGGTCAGGAGG - Intergenic
1181911001 22:26238155-26238177 AGAGCAGGCAGAAGGGCAAAGGG + Intronic
1182196027 22:28519102-28519124 AGAGCAGGGAGAAGTGTAGCAGG + Intronic
1182285671 22:29245485-29245507 AGTGCAGGTAGAAGAGGGGCAGG - Intronic
1182879612 22:33722263-33722285 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1182879617 22:33722278-33722300 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1182879622 22:33722293-33722315 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1182879627 22:33722308-33722330 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1183065028 22:35356876-35356898 TGAGCAGGGGGTAGGGGAGAGGG - Intergenic
1183166988 22:36155584-36155606 AAAGCAGGAAGAAGGGGAAGGGG - Intronic
1183177748 22:36237011-36237033 CCAGGAGGGAGAAGAGGAGCAGG + Intronic
1183184499 22:36284366-36284388 GGGGCAGTGAGAAGGGCAGCGGG - Intronic
1183230753 22:36580476-36580498 AGAGAAGGGGGAAGGGAGGCAGG - Intronic
1183264602 22:36817479-36817501 AGTGGAGAGAGAAAGGGAGCAGG - Intronic
1183323196 22:37177484-37177506 AGAGGAGGCAGGAGGGCAGCTGG - Intergenic
1183325343 22:37188354-37188376 GGAGCAGGGAGGAGGGGAAGTGG - Intronic
1183334213 22:37237378-37237400 GGGGCAGGGAGAGGTGGAGCAGG + Intronic
1183352766 22:37343275-37343297 GGAGCAGGGAGGAGCGGACCTGG - Intergenic
1183376619 22:37469197-37469219 ATAGCAGGAAGATGGGGAGTGGG + Exonic
1183408583 22:37642204-37642226 GGTGGAGGGAGAATGGGAGCGGG - Intronic
1183464329 22:37972071-37972093 AGAGAAAGGAGAGGGGGAGGGGG + Intronic
1183475566 22:38034112-38034134 AGAGGAAGCAGAAGGGGAGGCGG - Intronic
1183503587 22:38195981-38196003 AGAGGAGGAAGAAGGGGAGGAGG + Intronic
1183537357 22:38410692-38410714 AGACCGGGGAGAAGGGGAGGGGG + Intergenic
1183616775 22:38950512-38950534 AGAGGAGGGAGGAGAGGGGCAGG + Intergenic
1183742265 22:39675372-39675394 AGAGCATGGGGAAGGGGAGAGGG - Intronic
1183813751 22:40281177-40281199 GTAGCTGGGAGAAGGGGAGAAGG - Exonic
1183934467 22:41254391-41254413 AGAGGAGGAAGAAGAGGAGGAGG - Exonic
1183985433 22:41567545-41567567 AGACCAGAGAGAAGGGAAGATGG - Intronic
1184037506 22:41925724-41925746 AGGGCAGGGAGTTGGGGAGCTGG + Intronic
1184095603 22:42314661-42314683 AGAGCAGACAGGAGGGGTGCAGG - Intronic
1184460549 22:44635313-44635335 ATGGCAGGGAGAAGGGGAGAAGG + Intergenic
1184461504 22:44640430-44640452 GGAGGAGGGAGGAGGGGAGGAGG + Intergenic
1184895286 22:47403076-47403098 AGAGGAGGCAGGAGGGGTGCGGG + Intergenic
1184946981 22:47810784-47810806 GGAGGAGGGAAAAGGGAAGCAGG - Intergenic
1185055417 22:48576282-48576304 TGGGCAGGGGGGAGGGGAGCGGG - Intronic
1185219076 22:49620094-49620116 AGGGCAGGGGGACGGGGAGGGGG - Intronic
1185361933 22:50413659-50413681 AGAGGAGGGGGTAGGGGAGGAGG - Intronic
1185368266 22:50446764-50446786 AGAGCAGGCAGCCGGGGAGTGGG + Exonic
1203228343 22_KI270731v1_random:90492-90514 AGAGATGGGAGCTGGGGAGCAGG + Intergenic
949126400 3:450170-450192 AGAAGAGGGAGAGGGTGAGCAGG - Intergenic
949289893 3:2452131-2452153 AGAGCAGGAAAAATGGGAACAGG + Intronic
950113858 3:10438062-10438084 AGAGCAGGGAGGGGGGTGGCGGG + Intronic
950118774 3:10468147-10468169 TGGGCAGAGAGGAGGGGAGCAGG - Intronic
950119756 3:10474025-10474047 AGAGCAGGGAGGAAGTGAGGTGG + Intronic
950135907 3:10580636-10580658 GGAGCAGGGAGACAGGGAGGGGG - Intronic
950139853 3:10607959-10607981 AGAGAGGGGACAAGGGGAGAAGG - Intronic
950352759 3:12373284-12373306 AGGGAAGGGAGAAGGGCAGGGGG + Intronic
950356021 3:12409963-12409985 AAAGTTGGTAGAAGGGGAGCAGG - Intronic
950371319 3:12533357-12533379 AGAGGAGGGAGATGGGTGGCTGG + Intronic
950393067 3:12711878-12711900 AGAGCGGGGAGGAGAGGAGAGGG - Intergenic
950452709 3:13074145-13074167 AGAGCAGGAAGAGGGGAGGCAGG + Intergenic
950473917 3:13204016-13204038 TGGGCGGGGGGAAGGGGAGCTGG - Intergenic
950507435 3:13403962-13403984 AGAGCAGGCCCCAGGGGAGCGGG - Intronic
951006315 3:17619644-17619666 AGTGCAGGGAGCAGGAGAGAGGG + Intronic
951194153 3:19804742-19804764 GGAGGAGGGAGGAGGGGAGAGGG + Intergenic
952344490 3:32471067-32471089 AGAGGAGGGGGAGGGGGAGGAGG + Intronic
952500935 3:33961344-33961366 TGAGCAGCTAAAAGGGGAGCAGG + Intergenic
952504836 3:33998396-33998418 AGAGCTGGGAGCATGGGAGTGGG + Intergenic
952637738 3:35552244-35552266 AGAGCAGGAAGAAGGGAGGGTGG + Intergenic
952693411 3:36237099-36237121 AGAGGAGGGAGACAGGGAGGGGG + Intergenic
952853078 3:37744880-37744902 AGAGCTGGGAGAAGCCGGGCTGG + Intronic
953150401 3:40319380-40319402 CAAGAAGGGAGATGGGGAGCAGG - Intergenic
953151069 3:40325309-40325331 AGAGTAGGGAGGAAGGGAGAAGG + Intergenic
953187812 3:40654616-40654638 AGAGCTGGGGAAAGGGGAGTGGG + Intergenic
953241717 3:41155429-41155451 TGTGCAGGGAAAAGGGGAACTGG + Intergenic
953258746 3:41316612-41316634 AGAAGAGGGAGACAGGGAGCGGG + Intronic
953365446 3:42340512-42340534 GGAGCAGGGAGAGGGGGAGGAGG + Intergenic
953507706 3:43502484-43502506 GGTGCAAGGTGAAGGGGAGCTGG - Intronic
953743039 3:45553392-45553414 AGAGAAGGGAACAGGGGAGGAGG + Intergenic
953884218 3:46706460-46706482 AGGGGAGGGCTAAGGGGAGCCGG - Intronic
953984414 3:47430466-47430488 AGAACAGGTAGGAGAGGAGCAGG + Intronic
954259036 3:49425510-49425532 GGAGCAGAGAGAAGGGCCGCTGG + Intronic
954367390 3:50153952-50153974 AGAGAAGGGAGAGGAGGAGAGGG + Intergenic
954662178 3:52232015-52232037 AGAGCAGGTAGCAGGGCTGCTGG + Exonic
954672699 3:52299198-52299220 AGAGCAGGGACAGGGTGAGGAGG + Intergenic
954680633 3:52344196-52344218 AGAGCAGTGGGACGGGGTGCAGG - Intronic
954701166 3:52451598-52451620 AGAGCAGGGACACTGGGAGATGG + Intronic
954863756 3:53711841-53711863 AAAGGAGGGAGAAGAGGAGGTGG + Intronic
955208452 3:56918502-56918524 AGGGCAGGTAGCAGTGGAGCAGG + Intronic
955300217 3:57771177-57771199 AGAGAAGGGAGGAGAGGAGAGGG - Intronic
955377514 3:58410663-58410685 AGAGCTGGGTGAAGGGCAGCTGG - Intronic
955395727 3:58555849-58555871 AGGGCTGGGAGAAGGGCAGGGGG + Intergenic
955616573 3:60814350-60814372 AGAGCAGGGAAGAAGGGAGAGGG - Intronic
955756632 3:62231290-62231312 AGAGAGGAGAGAAGGGGAGCAGG + Exonic
956432094 3:69197591-69197613 GGAGAGGGGAGAGGGGGAGCGGG + Intronic
956466467 3:69525040-69525062 AGAGCAGGCAGAATGGAAGTGGG + Intronic
956505817 3:69938373-69938395 AGAGAGAGGAGAAGGGGAGGTGG + Intronic
956547926 3:70426561-70426583 AGAGAAGGAAGAAGAGGAGGAGG - Intergenic
956557802 3:70541477-70541499 AGAGCAGGGCCAAAGGGAGCTGG + Intergenic
956882067 3:73520725-73520747 AAAGCAGGGGTAGGGGGAGCAGG + Intronic
956899678 3:73702343-73702365 ACAGCAGGGAGAGGGGTAGATGG - Intergenic
956975657 3:74575717-74575739 AGATGAGGGAAAAGGGGAGCAGG - Intergenic
956989365 3:74745431-74745453 GGAGAAGGGAGAAGAGGAGGAGG - Intergenic
957223121 3:77410530-77410552 AGAGGAGGAAGAAGAGGAGGAGG - Intronic
957457618 3:80472678-80472700 AGAGCTGGGAGGTGGGGAGGTGG - Intergenic
957610015 3:82453832-82453854 AGAGCAGGGAGAAGGGGGCAGGG - Intergenic
957718179 3:83960409-83960431 AGAGGAGGGAGAGAGGGAGAGGG - Intergenic
957940103 3:86992587-86992609 AGAGCAGAGAGACAGGGAGTGGG - Intergenic
958123116 3:89319229-89319251 AGAGGAGGGAGAAGAGAAGTAGG + Intronic
958181582 3:90067471-90067493 AAAACAAGGAGAAGGGGAGAAGG + Intergenic
958814472 3:98901207-98901229 GGAGCAGGGAGGGAGGGAGCGGG + Exonic
959001757 3:100971996-100972018 GGGGCAGGGAGAAGGGCAGCTGG + Intronic
959539626 3:107524039-107524061 AGAGGAGGGGGAAGAGGAGGAGG + Intronic
959704372 3:109325995-109326017 ATAGCAGGGAGACAGGGAGTGGG + Intergenic
960130312 3:114048697-114048719 AGGACGGGGAGAAGGAGAGCTGG - Intronic
960590231 3:119358828-119358850 GGAGCTGGGAGAAGGGGAAATGG + Intronic
960874530 3:122283910-122283932 AGAGCAGGGAGAAGAGGAGGAGG - Exonic
960992922 3:123323528-123323550 AGGGCAGGGAGATGGGGAGGAGG - Intronic
961102690 3:124215046-124215068 AGGGCAGGGGGAAGAGGAGTTGG + Intronic
961261066 3:125602294-125602316 GTAGCAGGGAGCAGGGGTGCGGG + Intergenic
961345360 3:126260370-126260392 AGGACAGGGAGGAGGGGAGAAGG - Intergenic
961518267 3:127451913-127451935 TGAGAATGGAGAAGGGGAGAGGG - Intergenic
961599973 3:128052722-128052744 AGAGCAGGGGCCAGGGGAGCCGG - Intronic
961679171 3:128587283-128587305 AGTGGAAGGAGAAGGGAAGCAGG + Intergenic
961824624 3:129592562-129592584 GCAGCAGGGAGGAGGGGAGCAGG + Intronic
961923340 3:130450231-130450253 ACACCAGGGAAACGGGGAGCAGG - Intronic
962258517 3:133887986-133888008 TGAGCAGGGAGGAGGGAAGCAGG - Intronic
962298872 3:134219209-134219231 AGAGCAGGTAGGAGGGGCTCGGG - Intronic
962486637 3:135849919-135849941 AGAGGAGGAAGAGGGGGAGGGGG + Intergenic
962559532 3:136591256-136591278 GGAGGAGGGAGGAGGGGAGGAGG + Intronic
962610657 3:137073453-137073475 AGGGCAGGCAGCAGGGGAGCTGG + Intergenic
962978129 3:140463890-140463912 AGAGAAGGGAGAAGCTGAGGAGG + Intronic
962978930 3:140470466-140470488 AGAGCAGTGAGCAGGAGGGCTGG + Intronic
963154856 3:142085648-142085670 AGCGCAAGGACAAGGGAAGCTGG + Intronic
963299284 3:143580941-143580963 AGAGCATAGAGAAGGGAAGCAGG + Intronic
963605612 3:147409990-147410012 AGAGGAGGAAGAAGAGGAGGAGG - Exonic
963638785 3:147833548-147833570 AGAGCAGGAAGGAAGGGAGAGGG - Intergenic
963652058 3:147992244-147992266 ATGGCAGGGAGTAGGGGAGATGG + Intergenic
963951680 3:151208858-151208880 AGAGAAGGGAGAAGTAGTGCAGG + Intronic
963963569 3:151338752-151338774 AGAGCAGTGGGAAGAGGACCTGG + Exonic
964537950 3:157746158-157746180 AGAGGAGGTAGAAGGGAGGCAGG + Intergenic
964553012 3:157905820-157905842 AGAAGAAGGACAAGGGGAGCAGG + Intergenic
964794576 3:160483112-160483134 AGTGGAAGGTGAAGGGGAGCTGG - Intronic
965128278 3:164658654-164658676 AGAACAGGGGAAAGGGGAGAGGG + Intergenic
965398483 3:168189345-168189367 AGAAAAGGGAGAAAGGGAGAAGG - Intergenic
965451662 3:168845895-168845917 AGAGTAGGAAGAAGAGGAGGAGG - Intergenic
965760477 3:172070062-172070084 AGAAAAGGGAGCAGGGGACCTGG - Intronic
966200461 3:177355998-177356020 GGAGGAAGGTGAAGGGGAGCAGG + Intergenic
966206870 3:177413711-177413733 AGGGGAGGGGGAAGGGGAGGGGG + Intergenic
966294239 3:178400315-178400337 GGAGGAAGGTGAAGGGGAGCAGG - Intergenic
966305860 3:178533921-178533943 AGAGAAGGGAGAAGAGGGGAGGG - Intronic
966372728 3:179265852-179265874 AGGGCAGGCAAAAGGGGTGCAGG + Intronic
966669347 3:182509349-182509371 AGAGCAAAGGGAAGGGCAGCAGG + Intergenic
966934119 3:184694663-184694685 AGAGCAGGGAGAGCGGGAACGGG - Intergenic
967177319 3:186873230-186873252 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
967391610 3:188961728-188961750 AAGGGAGGGAGAAGGGAAGCAGG - Intronic
967524086 3:190472661-190472683 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
967685381 3:192410269-192410291 AGAGGAGGGAGAGGGGTGGCGGG - Intronic
967767881 3:193302073-193302095 AGAGGAGGCTGAAGGAGAGCTGG - Intronic
967768018 3:193303707-193303729 AGAGGAGGCTGAAGGAGAGCTGG - Intronic
968889185 4:3358944-3358966 GGAGGAGGAAGAAGGGGAGGGGG - Intronic
968889205 4:3358995-3359017 GGAGGAGGAAGAAGGGGAGGGGG - Intronic
968889223 4:3359036-3359058 GGAGGAGGGAGGAGGGGAGGAGG - Intronic
968889260 4:3359123-3359145 AGGGGAGGGAGGAGGGGAGGAGG - Intronic
968924500 4:3539787-3539809 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
968924505 4:3539802-3539824 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
969143545 4:5100718-5100740 AGAGAAGGAAGAAGGGAAGGAGG - Intronic
969299692 4:6290696-6290718 ACAGCGGGGAGAGGGAGAGCAGG - Intronic
969321655 4:6416616-6416638 AGAGGATGGGGGAGGGGAGCAGG - Intronic
969334970 4:6502458-6502480 AGGGCAGGAAGAAGGGAAGGAGG - Intronic
969370308 4:6727618-6727640 GGAGGAGGGGGAAGGGGAGGAGG - Intergenic
969376420 4:6766442-6766464 AAAGCAGAGAGAGTGGGAGCAGG - Intergenic
969403970 4:6977031-6977053 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
969403975 4:6977046-6977068 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
969429655 4:7146745-7146767 AGAACAGGGAGTAGGGGGGCTGG - Intergenic
969454761 4:7294816-7294838 AGAGGAGGGGGAGGGGGAGGAGG - Intronic
969454865 4:7295075-7295097 GGAGAAGGGAGAGGGGGAGGAGG - Intronic
969599671 4:8168761-8168783 AAAGCAGGGAGCAGGGGAAATGG - Intergenic
969853101 4:9977549-9977571 GGAGCAGGGGGAGGGGGAGGGGG - Intronic
970124260 4:12791790-12791812 AGAGAAGGGAGAGAGGGAGAAGG + Intergenic
970350512 4:15197263-15197285 AGAGGTGGGAGATGGGCAGCTGG + Intergenic
970413998 4:15838520-15838542 ACAGAAGGGAGCAGGGGAGCAGG - Intronic
970846236 4:20541365-20541387 ATAGCGTGGAGAAGGGTAGCTGG + Intronic
971034444 4:22677783-22677805 AGAGTAGGGAGAAGAGGTGGGGG - Intergenic
971136015 4:23869307-23869329 AGAGAAAGTAGCAGGGGAGCTGG + Intronic
971309743 4:25515056-25515078 AGAGCAGAGGGAAGCGGGGCAGG + Intergenic
971315864 4:25567388-25567410 GGAGCAGGGACAAGGGGGACAGG - Intergenic
971317729 4:25581336-25581358 CGTGCAGGGAAAGGGGGAGCAGG - Intergenic
971372654 4:26030586-26030608 AGAACAGGGAGAGTGGGAACCGG + Intergenic
972049799 4:34715353-34715375 AGGGAAGGGAGAAAGGGAGAGGG - Intergenic
972789758 4:42360012-42360034 ACTGCAGGGAGAAAGGGAGTTGG + Intergenic
972810856 4:42584279-42584301 AAAGAGGGGAGAAGGGAAGCAGG + Intronic
973094180 4:46176583-46176605 AGAGCAAGGAGAAGTGCAGGTGG + Intergenic
973101496 4:46277288-46277310 ACAGCAGGGAGGAGGGCTGCTGG + Intronic
973793556 4:54400523-54400545 AGAGTAAGAAGAAGAGGAGCTGG + Intergenic
973818981 4:54645947-54645969 CCAGCAGGGAGAAGGGGACAGGG - Intergenic
974330548 4:60472011-60472033 AGAGCAGGGAGGTAGGGAGAGGG + Intergenic
975055074 4:69920011-69920033 AGGGCTGGGAGAAGGGGAAATGG - Intergenic
975101615 4:70520740-70520762 AGAGCAGGGTGAGATGGAGCAGG + Intronic
975329714 4:73099727-73099749 AGTGCAGGGACTAGGGGAGGTGG - Intronic
976613146 4:87050220-87050242 AGAGCTGGGAGAAGGGGGTGTGG + Intronic
977401460 4:96537741-96537763 AGATCATGGGGAAGGGGAGGGGG - Intergenic
977836278 4:101649140-101649162 AGAGAAGGGAAAAGGAGAGGAGG + Intronic
978111609 4:104970881-104970903 AGTACAGTGAGAAGGGGAACTGG + Intergenic
978264740 4:106810276-106810298 AGAGGAGGAAGAAGGGAAGAAGG - Intergenic
978638267 4:110837951-110837973 GGAACAGGAAGAAGGTGAGCTGG - Intergenic
978901218 4:113951693-113951715 AGAGCAGGAAGAATGAGAGAAGG - Intronic
979168803 4:117572997-117573019 ACAGCAGGGAGAAAGGGAAGTGG + Intergenic
979209126 4:118078185-118078207 AGAGCAGAGAGGAGTGAAGCTGG - Intronic
979218402 4:118193351-118193373 AGAGTAGGGAGACGGGGGGCAGG + Intronic
979741680 4:124159166-124159188 AGAGCAGGGCAGAGGGGAGTGGG - Intergenic
979809096 4:125013151-125013173 AGGGCAAGGAGAAGGTGATCTGG + Intergenic
980896965 4:138869077-138869099 AGAGAGGAGAGAAGGGGAGAAGG + Intergenic
980976245 4:139613246-139613268 AGAGCAGGGGAACGGGGAGTGGG + Intergenic
981270928 4:142846591-142846613 AGAGGAGGAGGAAGAGGAGCGGG - Intronic
981345382 4:143669920-143669942 TGAGAAGGGAGGAAGGGAGCAGG - Intronic
981850037 4:149219016-149219038 TGAGGAGGGAGCAGGTGAGCTGG - Intergenic
982030432 4:151295081-151295103 AGACCAGAAAGAAAGGGAGCAGG + Intronic
983631453 4:169853481-169853503 AGAGCAGGAGGAAGAGGGGCTGG - Intergenic
983715087 4:170772295-170772317 GGAGAAGGTAGAAGAGGAGCAGG + Intergenic
983790202 4:171787181-171787203 AGACCATGGAGGAGAGGAGCTGG - Intergenic
984019716 4:174470306-174470328 GGAGGAGGTGGAAGGGGAGCAGG + Intergenic
984419821 4:179506895-179506917 AGAGGTGGGAGAAGTGGAGGAGG + Intergenic
984435615 4:179706447-179706469 AGAGCAGGAGCAAGGGGACCTGG - Intergenic
984488832 4:180406447-180406469 AGAGAAGGAGGAAGGGGAGGAGG + Intergenic
984898007 4:184559248-184559270 CGAGGAGGAAGAAGGGGAGGTGG - Intergenic
984911238 4:184676398-184676420 AGGGAAGGGAGAAGGGAAGGGGG - Intronic
984911250 4:184676429-184676451 AGGGAAGGGAGAAGGGAAGGGGG - Intronic
984943760 4:184955343-184955365 AGGGCAGGGAGAAGGGCAGTCGG + Intergenic
984977381 4:185241523-185241545 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
984977386 4:185241538-185241560 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
984977391 4:185241553-185241575 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
984977396 4:185241568-185241590 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
985211869 4:187604085-187604107 AGAGCAGAGGGGAGGGGAGGAGG - Intergenic
985532072 5:439709-439731 TGTGCAGGGGGAAGGGGTGCAGG + Intergenic
985576653 5:676379-676401 AGAGCTGGTAGATGGGGCGCTGG + Intronic
986043698 5:4017404-4017426 AGAGCAGAGAGGAGCAGAGCAGG + Intergenic
986071739 5:4291861-4291883 CAAGCAGGGAGCATGGGAGCGGG + Intergenic
986127400 5:4895698-4895720 GGAGCAGGGATAAGGGGTGTGGG - Intergenic
986844059 5:11732801-11732823 AGAGCAGGTAAAAGGAGGGCAGG - Intronic
986957096 5:13165826-13165848 AGAGGAGGAAGTGGGGGAGCTGG + Intergenic
987032886 5:13991595-13991617 AGAGGAGGAGGAAGGGGAGAGGG + Intergenic
987119275 5:14751243-14751265 AGAGAAGGGAGAACGGGAACAGG + Intronic
987140322 5:14939186-14939208 AGACCAGGGTGAAGAGGAGCTGG + Intergenic
987281465 5:16418235-16418257 ACAGGAGGGAGAAGAGGGGCTGG + Intergenic
989076200 5:37564574-37564596 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
989085552 5:37672634-37672656 AGAGTGGGGAGAAGGTCAGCAGG - Intronic
989133905 5:38134484-38134506 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
989318196 5:40106047-40106069 ACACCAGGGAAATGGGGAGCGGG + Intergenic
989588974 5:43095892-43095914 AGGACAGGGAGCAGAGGAGCTGG - Intronic
989710365 5:44389570-44389592 AGAGAAGGGGGTGGGGGAGCAGG + Intronic
990437843 5:55811707-55811729 GGAGCAGGGAGATGGGAAACTGG + Intronic
990533682 5:56698924-56698946 AGAGCAGGGAGAATGGGTGTTGG + Intergenic
991284492 5:64956536-64956558 AGAGAAGGGAGAGGGAAAGCTGG - Intronic
991540313 5:67720484-67720506 AGAGGAGGGAGAAGAGGAGAGGG - Intergenic
991545084 5:67772713-67772735 AGTGCAGAGGGCAGGGGAGCAGG + Intergenic
991693167 5:69245297-69245319 AGGGGAGGGGGAAGGGGAGGGGG - Intronic
992473758 5:77082701-77082723 AAAGGAGGGAGAAGGGGAAGAGG + Intronic
992605049 5:78447812-78447834 AGGGGAGGGAGAGGGGGAGGAGG - Intronic
992605138 5:78448026-78448048 GGAACGGGGAGAAGGGGAGGAGG - Intronic
992867663 5:80973818-80973840 AGATGAGGGAGAGAGGGAGCTGG + Intronic
992961572 5:81960894-81960916 AGAGAAGGAAAAAGGGTAGCAGG - Intergenic
993696801 5:91071140-91071162 AGAGAAGGGAGAGGGGGTGGAGG + Intronic
994185078 5:96807709-96807731 GGAGGAGGGAGACGGGGCGCGGG - Intronic
994263342 5:97685756-97685778 AGAGCAGAGAGGAGCGAAGCTGG + Intergenic
994472285 5:100222893-100222915 AGAGTAGGGTGAAGGGGAGAGGG + Intergenic
994684504 5:102932779-102932801 AGAAAAGGGAGAAGGGGATAAGG - Intronic
994851996 5:105067533-105067555 AGAGCGGGTAGAGGGGGAGAAGG + Intergenic
995243546 5:109912439-109912461 AGAGCAGGGAGAAGTGCTGCTGG - Intergenic
995354725 5:111224506-111224528 AGAGCAGGACGAGGCGGAGCAGG - Exonic
995412775 5:111877503-111877525 ACAGCAGGGAGATTGGGAGTTGG + Intronic
995442434 5:112206631-112206653 AGAGAAGGGAGAAGGGAGACTGG + Intronic
996070247 5:119123331-119123353 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
996070252 5:119123346-119123368 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
996070276 5:119123412-119123434 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
996070281 5:119123427-119123449 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
996657064 5:125953491-125953513 AGATCAGGGAGATGAGGATCTGG + Intergenic
996789419 5:127276846-127276868 AGAGCATGGTAAAGGGGATCAGG + Intergenic
996789890 5:127281573-127281595 AGAGCGGGAAGCAGAGGAGCAGG - Intergenic
997297744 5:132778182-132778204 AGAGCAGAGAGAAAGGCAGAGGG - Intronic
997399554 5:133591766-133591788 AGAGGAGGGAGAAATGGAGAAGG + Intronic
997419285 5:133753206-133753228 AGAGCAGGGAGCAGAGGAGAAGG - Intergenic
997480935 5:134184088-134184110 AGAGCAGGAAAATGGGGAGGTGG + Intronic
997530345 5:134577897-134577919 AGAGCATGGATAAAGGGATCAGG - Intronic
997565473 5:134882833-134882855 AGAGGAGGGAGAGGGGGAGGGGG + Intronic
997701005 5:135899374-135899396 AGGGAAGGGAGCAGGGGACCTGG + Intergenic
997735231 5:136208216-136208238 AGACAAGGGAGAAGAGGAGATGG - Intergenic
998022046 5:138777888-138777910 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
998022053 5:138777903-138777925 AGAGGAGGGAGAGGGGGAGGAGG + Intronic
998022060 5:138777918-138777940 GGAGGAGGGAGAGGGGGAGGAGG + Intronic
998022067 5:138777933-138777955 GGAGGAGGGAGAGGGGGAGGAGG + Intronic
998136472 5:139676860-139676882 GGATCAGAGAAAAGGGGAGCTGG - Intronic
998277433 5:140770166-140770188 AGAGAAGGTGAAAGGGGAGCAGG - Intergenic
998522904 5:142816891-142816913 GGAGCAGCGGGAGGGGGAGCAGG + Intronic
998532746 5:142900600-142900622 AGAGTAGGGGGAGGGGGGGCGGG + Intronic
998769191 5:145522780-145522802 AGAGAAGGAAGAAGAGGAGGAGG + Intronic
998776609 5:145610250-145610272 AGAGCAGGGAGGAGCAAAGCTGG - Intronic
998804090 5:145901587-145901609 AGAGCAGGGTAAAGGGGATTGGG + Intergenic
999126737 5:149251572-149251594 AGAGCAGGGGAAAAGGGAGGGGG - Intronic
999152836 5:149437849-149437871 AAAACAGAGAGAAGGGGAGGAGG - Intergenic
999201422 5:149819233-149819255 ACAGCAGTGAGTAGGGGAGAAGG - Intronic
999231393 5:150064151-150064173 AGAGCAGGGAGGGTGGAAGCGGG + Intronic
999257372 5:150217029-150217051 AGAGGAAGGAGAAGGAGAGATGG - Intronic
999265928 5:150266916-150266938 GGGGCAGGGGAAAGGGGAGCTGG - Intronic
999409731 5:151340218-151340240 AGAGGAGGAGGAAGGGGAGGAGG + Intronic
999962219 5:156768100-156768122 AGAGAAGGGAGCAGTGGAGAGGG - Intergenic
1000052513 5:157575336-157575358 AGAGGAAGGAGAAGGCGAGAAGG + Intronic
1000203164 5:159031563-159031585 GGAGCTGGGAGAAGGGGAGGAGG + Intronic
1000731431 5:164838778-164838800 AGGGAGGGGGGAAGGGGAGCGGG - Intergenic
1000905834 5:166964557-166964579 AAAGCAGAAAGAAGGGGAGAGGG - Intergenic
1001085023 5:168694207-168694229 AGAGCAGGCAGATGGGCAGCAGG - Intronic
1001134368 5:169090222-169090244 AGAAGAGGGTGAAGGGGAGGAGG + Intronic
1001296333 5:170501876-170501898 AGAGAAGGCAGGAGGGAAGCAGG + Intronic
1001327512 5:170739866-170739888 AGTGGAAGGTGAAGGGGAGCTGG - Intergenic
1001408927 5:171496472-171496494 AGAGCAGGGGGCAGGGTAGGAGG + Intergenic
1001428923 5:171644536-171644558 AGGGCCGGGAGATGGGGAGGTGG + Intergenic
1001443612 5:171764840-171764862 AGAGCAGGGAGAGTGGAAGCGGG - Intergenic
1001467890 5:171985183-171985205 AGAGCAGGGCAAATTGGAGCAGG - Intronic
1001543704 5:172557099-172557121 GGAGGAGGGAGGGGGGGAGCTGG - Intergenic
1001706061 5:173741796-173741818 GGGGGAGGGAGAAGGGGAGAGGG + Intergenic
1001753451 5:174148502-174148524 ATAAAGGGGAGAAGGGGAGCAGG - Intronic
1001927349 5:175648108-175648130 AGAGCAGGGGTAAAGGGAGTTGG + Intergenic
1002039250 5:176499780-176499802 AGAAAAAGGAGAAAGGGAGCAGG - Intronic
1002066629 5:176655093-176655115 AGAGCAGGGCAGAGCGGAGCGGG - Intronic
1002168697 5:177363281-177363303 AGAGCGGGGAGCACGAGAGCAGG + Intronic
1002436642 5:179235671-179235693 AGAGGAAGGAGAGGGGAAGCGGG + Intronic
1002575740 5:180172733-180172755 AGCCCAGGGAGGTGGGGAGCAGG - Intronic
1002583019 5:180221968-180221990 AAAGCAGGGAGAAGGAGGGGAGG - Intergenic
1002795622 6:469237-469259 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795626 6:469252-469274 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795635 6:469288-469310 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795639 6:469303-469325 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795663 6:469402-469424 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795683 6:469598-469620 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795692 6:469634-469656 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795696 6:469649-469671 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795700 6:469664-469686 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1002795704 6:469679-469701 AGAGGAGGGAGACGGAGAGGAGG - Intergenic
1003024949 6:2546424-2546446 CGAGGAGGGAGGAGGTGAGCTGG - Intergenic
1003046261 6:2735801-2735823 AGAGGAGAGAGAATGAGAGCAGG + Intronic
1003137150 6:3442256-3442278 AGAGGAGGGGAATGGGGAGCTGG + Intronic
1003484974 6:6567663-6567685 AGAGTGGGGAGAGGGGGAGAGGG - Intergenic
1003490801 6:6619894-6619916 AGAGCTAGGAGAAAGGGAGGGGG + Intronic
1003681157 6:8258408-8258430 AGAGGAGGAAGAAGGGGAAGAGG + Intergenic
1003748290 6:9026494-9026516 GGCACAGGGAGACGGGGAGCGGG + Intergenic
1003901479 6:10659593-10659615 AGAGAGGGGAGAAGGTGAGGAGG + Intergenic
1004127387 6:12887006-12887028 AGAGGAGGAAGAGGGGGAGGAGG - Intronic
1004252602 6:14034433-14034455 CGAGGAGGGAGAAGGTGAGAGGG + Intergenic
1005008298 6:21311969-21311991 GGAGAAGGCAGAAGGGGAGTAGG - Intergenic
1005132043 6:22520501-22520523 AGAGAAGGGAGAAGGGGGAAGGG + Intergenic
1005133746 6:22542569-22542591 AGAGCAGGAAGAAAGAGAGCTGG - Intergenic
1005203588 6:23375349-23375371 AGAGGAGGGAGGGAGGGAGCAGG - Intergenic
1005719602 6:28588001-28588023 AGAGAATGGAGAAGGGAACCAGG - Intronic
1005867381 6:29946287-29946309 AGAGCAGGAAGAAGAGTAGGAGG - Intergenic
1005938875 6:30546149-30546171 TGAGGAGGGAGAAGGGGATGAGG - Exonic
1005958878 6:30682762-30682784 AGGCCAGAGAGCAGGGGAGCCGG - Intronic
1005987374 6:30883546-30883568 GGAGGAGGAAGAAGAGGAGCAGG - Intronic
1006174937 6:32116018-32116040 ATTGCAGGGAGGAGGGGAGGAGG + Intronic
1006253528 6:32811173-32811195 AAAGCAGGGAGAGGGGCAGTGGG - Intergenic
1006303752 6:33207335-33207357 AGAGGAGGAGGAAGGGGAGGGGG + Intergenic
1006423318 6:33948918-33948940 GGTGCAGGAAGACGGGGAGCAGG + Intergenic
1006446138 6:34080798-34080820 AGAGAAGAGAGAAGTGGATCAGG - Intronic
1006470726 6:34227257-34227279 TGAGCAGGGAGCAGGAGAGGAGG + Intergenic
1006641339 6:35491267-35491289 GGTGAAGGGAGAAGGGGAGAAGG + Intronic
1006729069 6:36222090-36222112 GGAGAGGGGAGAAGGGGAGTCGG + Intronic
1006824448 6:36924139-36924161 AGGCAAGGGAGAAGGGGAGGGGG - Intronic
1006934063 6:37705352-37705374 GGAGAAAGGAGAAGGGGAGGAGG + Intergenic
1006976003 6:38102097-38102119 AGAGGAGGAAGAAGAGGAGGAGG - Intronic
1007150975 6:39690573-39690595 ACAGGAGGGAGAAGGGGAAGGGG + Intronic
1007230716 6:40345902-40345924 GGAGCAGGGACATGGGGAGGAGG - Intergenic
1007325456 6:41056015-41056037 AGAGCAGTGGGAAAGGGATCAGG + Intronic
1007371183 6:41427854-41427876 AGCGCAGGGGCAGGGGGAGCGGG + Intergenic
1007383465 6:41504995-41505017 AGAGGAGGGAGGAGAGGAGGAGG - Intergenic
1007763942 6:44150205-44150227 AGAGCTGGAGGGAGGGGAGCAGG - Exonic
1008064769 6:47035900-47035922 AGAGCAGAGAGAGAGGGAGAGGG + Intronic
1008458310 6:51738154-51738176 TGTGCAGGTGGAAGGGGAGCAGG - Intronic
1008461349 6:51777530-51777552 AGAGCAGAAAGAAGGGAAGCAGG + Intronic
1009482194 6:64172905-64172927 CCAGCAGGAAGAAGGGGAGGAGG - Intronic
1009700595 6:67173295-67173317 AGAGGAGGAGGAAGAGGAGCAGG + Intergenic
1009816724 6:68746675-68746697 AGACCAGGGACAAGGGGAAGAGG - Intronic
1009940626 6:70283631-70283653 AGAGTGGGGAGGAGGGGTGCTGG + Intronic
1010030668 6:71267423-71267445 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1010030673 6:71267438-71267460 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1010030678 6:71267453-71267475 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1010030683 6:71267468-71267490 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1010032754 6:71288368-71288390 GGACCAGGGAGAGGGGGAGGGGG + Intergenic
1010403957 6:75481477-75481499 AGAGCAGGGAGGTGGGAATCAGG - Intronic
1010492647 6:76493549-76493571 AAACCAGGGAAATGGGGAGCGGG - Intergenic
1010928978 6:81777567-81777589 AGAGGAAGGTGAAGGGGTGCAGG + Intergenic
1011320020 6:86080715-86080737 ACAGCTGGGAGACGGGTAGCTGG - Intergenic
1011402330 6:86977179-86977201 AGAGGAGGGAGAGGGGGAAGGGG - Intronic
1011628090 6:89299572-89299594 AGAGCAGGAAGTAGTGGAGAGGG - Intronic
1011632369 6:89339611-89339633 AGGGGAGGGGGAAGGGGAGGAGG + Intronic
1012140954 6:95626040-95626062 AAAGCAAGGAGAAAGGAAGCAGG - Intergenic
1012158849 6:95857142-95857164 AGAGCAGAGGAAAGGGGAGAGGG - Intergenic
1012429924 6:99153578-99153600 TGAGCATGGAGAATGGAAGCAGG + Intergenic
1012465513 6:99512996-99513018 AGGGCAGGGAGAAGTGGAAATGG + Intronic
1012864045 6:104596265-104596287 AGAGCAGGGAGAAGCTGAAATGG - Intergenic
1013042888 6:106453911-106453933 GGAGCAGGGAGAAGAAGGGCAGG + Intergenic
1013091690 6:106906030-106906052 AGAGCAGGGTAAGGGGGATCAGG - Intergenic
1013093790 6:106925454-106925476 AGAACAAGGAGAAGAGGAGGAGG + Intergenic
1013190712 6:107802655-107802677 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1013190726 6:107802691-107802713 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1013272807 6:108559434-108559456 AGAGGAGGGAGAAGGGGGAGCGG - Intergenic
1013410162 6:109876706-109876728 AAAGCAGGAAGACTGGGAGCGGG + Intergenic
1013534184 6:111048321-111048343 GGAGCAGGGAGAAGGGGAAATGG - Intergenic
1013608593 6:111773556-111773578 AGAGGAGGGAGAGGGAGAGGGGG + Intronic
1013946731 6:115730617-115730639 AGAGAATGGAGAGGGGGTGCTGG - Intergenic
1014232585 6:118920701-118920723 GCAGAAGGGAGAGGGGGAGCAGG - Intronic
1014755964 6:125302082-125302104 GGAGGAGGAAGAGGGGGAGCAGG - Intergenic
1014804841 6:125817995-125818017 GGAGCAGGAAGAAAGGGAGGAGG - Intronic
1015243804 6:131054850-131054872 AGAGCAGGGAGAAGGAGGTAAGG + Intronic
1015880100 6:137863765-137863787 AGTGCAGGGAAAAGGGGAGGGGG + Intergenic
1016940969 6:149482560-149482582 AGAGCAGGGAGGAAGGGAGGGGG + Intronic
1017027422 6:150193603-150193625 AGGGCTGGGAGAAGGGGAGGAGG + Intronic
1017103490 6:150867092-150867114 TGAGATGGGAGAAGGGGAGTGGG - Intronic
1017272044 6:152518477-152518499 GGCGGAAGGAGAAGGGGAGCAGG - Intronic
1017324662 6:153131270-153131292 AGAGGAGGGGGAGGGGGAGGAGG + Intergenic
1017721191 6:157244218-157244240 TGAGCAGGGGGAAGGAGAGGAGG - Intergenic
1018205777 6:161436092-161436114 AGAGCAGAGAGCAGGGGAGGAGG + Intronic
1018389642 6:163332280-163332302 AGGGCAGGGAGAGGGGATGCAGG + Intergenic
1018908876 6:168090501-168090523 AGAACAGGGAGAAGATGGGCTGG - Intergenic
1019054315 6:169212108-169212130 AGAGGAAGATGAAGGGGAGCTGG + Intergenic
1019162971 6:170081172-170081194 GGAGGAGGGAGAAGAGGAGGAGG + Intergenic
1019164800 6:170091131-170091153 AGGGCAGGGAGCAGGGCAGGGGG - Intergenic
1019296873 7:282298-282320 AGAGCAGGGAGGAGGGGGTGAGG + Intergenic
1019296888 7:282348-282370 AGAGCAGGGAGGAGGGGGTGAGG + Intergenic
1019320706 7:414209-414231 GGAGGAGGGAGGAGGGGAGGAGG - Intergenic
1019392599 7:797399-797421 GGTGCAGGGAGGAGGGCAGCAGG - Intergenic
1019660165 7:2219679-2219701 AGGGCAGGGGGAAGAGGAGCAGG + Intronic
1019666070 7:2252843-2252865 AGAGCAGGGGTGAGGAGAGCAGG - Exonic
1019779295 7:2930106-2930128 AGAGAAAGGAGAAGGGGGCCGGG + Intronic
1020005689 7:4782871-4782893 AGGGCAGGGAGGAGGGCGGCTGG - Intronic
1020361705 7:7333746-7333768 AGAGCAGGGAGGTAGGGAGGGGG - Intergenic
1020473784 7:8570737-8570759 GGAGCAGAGAGAAGTGGAGTAGG + Intronic
1020739486 7:11995932-11995954 AGAGGAGGGAGGAAGGAAGCAGG - Intergenic
1021234962 7:18131714-18131736 AGAGGAGGGTGAAGGTGAGGCGG + Intronic
1021408805 7:20304826-20304848 GGAGCAGGGAGAAGGTGAGTTGG - Intergenic
1021563485 7:21992536-21992558 AGAGCTGGGATAAGGGGAGATGG + Intergenic
1021758690 7:23881951-23881973 AGAGCAGGAGGAAGGGGGGCAGG + Intergenic
1022506427 7:30910965-30910987 AGAGGAGGGAGGGAGGGAGCAGG - Intergenic
1023156428 7:37256670-37256692 AGAGAAGGGAGAAGGAGGGAAGG + Intronic
1023214562 7:37847938-37847960 AGAGGAGGAAGAAGAGGAGGAGG + Intronic
1023567674 7:41539717-41539739 AGGGGAGGGAGAAAGGGAGAGGG - Intergenic
1023705201 7:42933455-42933477 AGAGGGGGGAGAGGGGAAGCGGG - Intronic
1023836906 7:44073800-44073822 CGAGCAGGGCGAAAGGGAACTGG + Exonic
1024495157 7:50037761-50037783 AGGGGAGGGAGGAAGGGAGCAGG - Intronic
1024621240 7:51159193-51159215 AAAGCAGGGAGGTGGGGAGGAGG + Intronic
1024720950 7:52137066-52137088 AGAGGAGGGAGAGGAGGAGAAGG + Intergenic
1024738042 7:52327081-52327103 AGAGCTGGGAGAAGGGAAGAAGG - Intergenic
1024800097 7:53067231-53067253 AGAGCAAGATGCAGGGGAGCAGG + Intergenic
1024800104 7:53067246-53067268 GGAGCAGGGGGCAGGGGAGAAGG + Intergenic
1024813237 7:53237701-53237723 AGAGAAGGGAGAGGGGGAAGGGG + Intergenic
1024859272 7:53818738-53818760 GGAGGAGGGAGAGGGGGAGCTGG - Intergenic
1024936942 7:54720090-54720112 AGAGGAAGGTGAAGGGGAGCAGG - Intergenic
1025011807 7:55403456-55403478 AGAGGAGGGAGAGGGAGAGGAGG + Intronic
1025255963 7:57384113-57384135 AGCGCAGGGAGATGAGGAGGAGG + Intergenic
1025788476 7:64666161-64666183 TGAGCAGTGAGGAGGAGAGCAGG - Intronic
1025852660 7:65257390-65257412 AGACGAGGGAGAGGGGGAGGGGG - Intergenic
1026181674 7:68046765-68046787 AGTGCCTGGAGAAGGGGAGGAGG + Intergenic
1026479338 7:70764824-70764846 TGGGCAGGGAGAGGGGGAACGGG - Exonic
1026491012 7:70863479-70863501 GGAGCAGGGAGAAGAGAAGGAGG + Intergenic
1026643809 7:72150639-72150661 AGAGCAGAGAGAACGTGAGAGGG + Intronic
1026846175 7:73700268-73700290 AGAGAAGGGAGCATGGGGGCCGG + Exonic
1026958589 7:74394136-74394158 ACAGCAGGGAGACGGGGATGAGG - Intronic
1026958738 7:74395054-74395076 ACAGCAGGGAGACGGGGATGAGG - Intronic
1027222667 7:76223926-76223948 AGAGAAGGGAGAGGGGGAGGGGG - Intronic
1027222714 7:76224044-76224066 AGAGAAGGGAGAGGGAGAGAGGG - Intronic
1027973585 7:85119607-85119629 AGAGCATGGAGGTAGGGAGCAGG + Intronic
1028866792 7:95722870-95722892 AGAACTGGGAGAAGGGGAATAGG - Intergenic
1029139469 7:98400339-98400361 AGAGGAGGGGGAGGGGGAGGGGG + Intronic
1029257372 7:99278699-99278721 AGAGCAGGGAGGACTGGAGATGG - Intergenic
1029373862 7:100166531-100166553 AGAGGATGTGGAAGGGGAGCTGG + Exonic
1029425031 7:100489566-100489588 AGAGGAGGAAGAAGAGGAGGTGG + Exonic
1029426015 7:100494305-100494327 AGAGCCGGGAGTTGGGGAGGGGG + Exonic
1029466482 7:100728507-100728529 AGAGCAGGGAGTTGGGAAGAAGG - Intergenic
1029538122 7:101167512-101167534 AGAGCAGTGGGATGGGGAGGGGG + Intergenic
1029575662 7:101401759-101401781 GGAGGAGGGAGAAGAGGAGGAGG + Intronic
1029670092 7:102024174-102024196 AGAGCAGGGGGCTGGGGCGCAGG - Intronic
1029742195 7:102497055-102497077 TGAGCAGAGAGATGGGAAGCCGG - Intronic
1029760184 7:102596220-102596242 TGAGCAGAGAGATGGGAAGCCGG - Intronic
1029981766 7:104885772-104885794 AGGGTGGGGAGAAGGGGAGGGGG - Intronic
1030829120 7:114198786-114198808 AGAGTGGGGAGAAGGAGAGAGGG + Intronic
1031595074 7:123640662-123640684 AGAGGAGGGGGAGGGGGAGGAGG + Intergenic
1031791642 7:126113508-126113530 AGAGCAGGAAGAAAGGGAAGAGG + Intergenic
1031973638 7:128080608-128080630 GGGGAAGGGAGATGGGGAGCTGG + Intronic
1032238132 7:130141702-130141724 AGAGCAGTGGGCGGGGGAGCAGG - Intergenic
1032468996 7:132164572-132164594 AGAGCAGAGAGGAGGGCAGGAGG - Intronic
1032507575 7:132447229-132447251 AGAGCAGGAAGTAGGGGATGAGG - Intronic
1032523800 7:132564177-132564199 AGAGGAGGGAGAGGAGGGGCAGG - Intronic
1032569340 7:132983966-132983988 AGAGGAGGGAGAGGGAGAGGAGG - Intronic
1032686130 7:134235516-134235538 AGAGCAGGGAAAAGGGGCTAGGG - Intronic
1032751462 7:134846041-134846063 TGAGCAGGCAGCAGGGGAGTTGG - Intronic
1032801053 7:135317580-135317602 GGAGCAGGAAGAAGGGCTGCGGG - Intergenic
1032816982 7:135485703-135485725 AGGGAAGGGGGAAGGGAAGCGGG + Intronic
1033150871 7:138913989-138914011 AGAGGAGGGAGAAGGAAAGAAGG + Intronic
1033164162 7:139024986-139025008 AGAGCAGGGAGGAAGGGAGAAGG + Intergenic
1033890446 7:146006435-146006457 AGAGGAGGAGGAAGAGGAGCAGG - Intergenic
1033963565 7:146945488-146945510 AGAGAGAGGAGAAGGGGAGGAGG + Intronic
1034065798 7:148135850-148135872 AGAGCAGAGGGGAGGGGAGGGGG + Intronic
1034239169 7:149596638-149596660 AGAGAAGGAAGAAGGGAAGGAGG + Intergenic
1034248603 7:149670018-149670040 AGAGCAGGAAGAGGAGGAGGAGG - Intergenic
1034337489 7:150332886-150332908 AGAGCAGGGATAGGAGGGGCAGG + Intronic
1034349280 7:150405783-150405805 GGGGCGGGGAGAAGGGGCGCGGG + Intronic
1034422334 7:150996321-150996343 GGGGCAGGGAGGAGGGGTGCAGG - Intronic
1034442529 7:151093685-151093707 TTTGCTGGGAGAAGGGGAGCCGG + Intronic
1034514051 7:151559950-151559972 GGAGCAGAGAGAACGGGAGAGGG - Intronic
1034566571 7:151920317-151920339 TGAGCAGGGAGAAGGCTTGCAGG + Intergenic
1034973822 7:155436494-155436516 GAAGCAGTGAGAAGGGGTGCAGG - Intergenic
1035237672 7:157509215-157509237 AGAGGAGGGAGAGGGAGAGAGGG + Intergenic
1035285615 7:157804809-157804831 AGGACTGGGAGAAGGGGGGCTGG - Intronic
1035317455 7:158005614-158005636 AGAGCTGGAAGATGGGGTGCAGG + Intronic
1035366445 7:158351868-158351890 CGAGCAGACAGGAGGGGAGCTGG - Intronic
1035375523 7:158404703-158404725 AGAGCTGGGGGCCGGGGAGCTGG - Intronic
1035375618 7:158404938-158404960 GGAGCTGGGAGCTGGGGAGCTGG - Intronic
1035389636 7:158496476-158496498 AGGGAAGGGGGAAGGGGAGCAGG - Intronic
1035389713 7:158496667-158496689 GGGGAAGGGGGAAGGGGAGCAGG - Intronic
1035389879 7:158497061-158497083 AGGGAAGGGAGAGGGGGTGCAGG - Intronic
1035476883 7:159149996-159150018 GGAGCATGGAGAAGGGGAGAGGG + Intergenic
1035651172 8:1266443-1266465 AGAGCAGGTTGATGGGGAGAGGG - Intergenic
1035769462 8:2135490-2135512 TGAGCAGGGAGGAGGAGAGAAGG - Intronic
1036217434 8:6892314-6892336 AGGGCAGGCTGAAGGGGAGCTGG + Intergenic
1036763854 8:11533624-11533646 GGAGGAGGGGGAAGGGGAGGTGG + Intronic
1036815221 8:11897260-11897282 AGGGCAGGGTGCAGGGGGGCGGG + Intergenic
1037497009 8:19450111-19450133 AGAGGAGGGAGAAGAGGAGGAGG + Intronic
1037584274 8:20265783-20265805 AGAGCAGGGAGATGGGAGCCAGG - Intronic
1037728629 8:21505183-21505205 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1037769132 8:21788899-21788921 GGAGCAGGGAGAGTGGGAGAAGG - Intronic
1037837194 8:22221244-22221266 AGTGGAGGGAGCAGGGGGGCAGG + Exonic
1037989037 8:23307459-23307481 GGAGCAGGGGGTTGGGGAGCAGG + Intronic
1038573656 8:28685401-28685423 GGAAGAGGGAGAAGGGGAGGGGG - Intronic
1038583463 8:28769880-28769902 AGACCCTGGAGAAGGTGAGCTGG - Exonic
1038651446 8:29407544-29407566 AGGGAAGGGAGAAAGGGAGAAGG - Intergenic
1038741794 8:30223115-30223137 AGAGGAAGGAGGTGGGGAGCAGG - Intergenic
1038828425 8:31032754-31032776 AGAGCCAGGCGAAGGGGAGGCGG - Exonic
1038877242 8:31565080-31565102 AGAGGAGGGAGAAAGGTAGAAGG + Intergenic
1039201187 8:35095099-35095121 AGAGGAGGGAGAGGGAGAGTAGG + Intergenic
1039476017 8:37839813-37839835 AGATCAGAGAGAATGGGAGATGG + Intronic
1039477081 8:37844735-37844757 GGGGCAAGGAGAAGGGGAGGTGG - Exonic
1039806282 8:41002411-41002433 AGAGCAGAGGGAAGGGCACCCGG - Intergenic
1039846695 8:41330543-41330565 AGGGAAGGGAGCAGGGGAGGAGG - Intergenic
1039912327 8:41835081-41835103 AGAGCAGCTACAAGGGGCGCAGG + Intronic
1040007313 8:42631368-42631390 GGTGCAGGGAGAAGGGGAGTGGG - Intergenic
1040460864 8:47646760-47646782 AGAGGATGGAGGACGGGAGCTGG + Intronic
1040690747 8:49935590-49935612 AGGGCTGGGAAAATGGGAGCCGG - Intronic
1040785295 8:51158370-51158392 AGAGGAGGGAGAGGGAGAGGAGG - Intergenic
1040884834 8:52250197-52250219 AGTGTGGGGAGAAGGGGAGGAGG + Intronic
1041495677 8:58482952-58482974 ATGGCAGGGAAAAAGGGAGCTGG - Intergenic
1042397795 8:68311804-68311826 AGAGAAGGAAGAAGAGGAGGGGG - Intronic
1042496849 8:69464468-69464490 ACTACAGAGAGAAGGGGAGCTGG + Intergenic
1042585680 8:70335598-70335620 GGAGTAGGGAGCAGGGGTGCGGG - Intronic
1043388342 8:79768610-79768632 GGAGCCGGGAGAGGGGGCGCCGG + Intergenic
1043472770 8:80578552-80578574 GGGGCAGGGAGAAGGAGCGCCGG - Intergenic
1043472794 8:80578622-80578644 GGAGCAGGGAGAAGGGGCGCAGG - Intergenic
1043472799 8:80578637-80578659 GGAGCAGGGAGAAGGGGAGCAGG - Intergenic
1043472804 8:80578652-80578674 AGGGCGAGGAGGAGGGGAGCAGG - Intergenic
1043779941 8:84320311-84320333 AGAGAAGGTAGAAGGGGAATAGG - Intronic
1044014152 8:87030822-87030844 GGAGGGGGGAGAAGGGGAGGAGG - Intronic
1044014197 8:87030925-87030947 GGAGGAGGGGGAAGGGGGGCAGG - Intronic
1044413373 8:91909754-91909776 AGAGGAGGAGGAAGGGGAGGAGG + Intergenic
1045066750 8:98454356-98454378 ACAATAAGGAGAAGGGGAGCTGG - Intronic
1045186480 8:99843529-99843551 ACAGCAGGGAAAGGGGGAGCAGG - Intronic
1045277589 8:100721662-100721684 GGAGCCGGGGGGAGGGGAGCGGG + Exonic
1045409652 8:101904299-101904321 AAAGGAGGGATTAGGGGAGCGGG - Intronic
1045437157 8:102174767-102174789 AGAGCAGGAACAAGGGGTGATGG + Intergenic
1045474629 8:102542549-102542571 AGAGAAGGGGGAAGGGGAGGGGG - Intergenic
1045623864 8:104018237-104018259 AGAGCAGGGGGAAGAAAAGCAGG + Intronic
1045670840 8:104551789-104551811 AGAGAAGAAAGAAGGGGAGAAGG - Intronic
1046015608 8:108601140-108601162 GGAGGAGGGAGAGGGGGAGGGGG + Intergenic
1046190163 8:110784782-110784804 AGTGGAAGGTGAAGGGGAGCTGG + Intergenic
1046247989 8:111591400-111591422 AGAGACGGGAGGCGGGGAGCAGG + Intergenic
1046520671 8:115321052-115321074 AGAGCAGGAAGAAGGGGGCTGGG - Intergenic
1046701472 8:117405648-117405670 AGATCAGAGACAAGGGGAGCTGG + Intergenic
1047119630 8:121886520-121886542 AGAGTAGGGAGAGAGGGAGGAGG - Intergenic
1047148192 8:122229886-122229908 AGAGCAGGTGGATGGGGAGGGGG + Intergenic
1047306149 8:123654601-123654623 AGAGGAGGAAGAAGAGGAGGAGG + Intergenic
1047324887 8:123826507-123826529 AGAGAAGAGAGGAGGGGAGAAGG + Intergenic
1047356693 8:124129035-124129057 AGAGCAGAGAGGAGGGAAGCTGG + Intergenic
1047690938 8:127353930-127353952 GGAGCAGGAGGAAGAGGAGCAGG + Intergenic
1047701185 8:127451135-127451157 AAAGCAGGGAACAGGGGAGTCGG - Intergenic
1047793296 8:128227968-128227990 AGGGGTGGGAGAAGGGGAGAAGG - Intergenic
1048049902 8:130806851-130806873 AGAGCAGAGAGAAGAGGTGAAGG + Intronic
1048630858 8:136240821-136240843 AGATCAAGAAGAAGGGGAGTAGG - Intergenic
1048968806 8:139632662-139632684 GGAGCGGGGGGAATGGGAGCAGG - Intronic
1048990674 8:139758494-139758516 ACAGCAGGCAGAAGGGCACCAGG - Intronic
1049004873 8:139848103-139848125 ATTGTAGGGAGAAGGGAAGCAGG + Intronic
1049018944 8:139940878-139940900 GGGCCAGGGTGAAGGGGAGCTGG + Intronic
1049032622 8:140048842-140048864 GGAGCTGGGAGTAGGGGAGCAGG - Intronic
1049121961 8:140747471-140747493 AGAGGAGGGGGAAGAGGAGGGGG + Intronic
1049121964 8:140747483-140747505 AGAGGAGGGGGAAGAGGAGGAGG + Intronic
1049121986 8:140747546-140747568 AGAGGAGGGGGAACGGGAGGAGG + Intronic
1049166503 8:141129005-141129027 AGAGAAGAGGGGAGGGGAGCAGG - Intronic
1049210772 8:141385470-141385492 ACAGAAGGAAGAAGGGGAGGAGG - Intergenic
1049273225 8:141707187-141707209 AGAGGAGGGAGAAGGCAAGTGGG - Intergenic
1049356679 8:142192651-142192673 AGAGCAGGAAGGAGGGAAGGAGG + Intergenic
1049358722 8:142201681-142201703 ACAGCAGGGAGAGGGGGGCCGGG + Intergenic
1049537850 8:143190212-143190234 AGAGGAGGGAGGCGGGGACCTGG - Intergenic
1049541053 8:143209174-143209196 AGAGCAGCATGGAGGGGAGCTGG + Intergenic
1049543850 8:143220595-143220617 AGAGAAGGGGAAGGGGGAGCTGG - Intergenic
1049588090 8:143441120-143441142 ACTGCAGAGAGAAGGGGTGCAGG + Exonic
1050008290 9:1157979-1158001 AAGGCAGAGAGAAGGGGAACTGG + Intergenic
1050638758 9:7642449-7642471 AGAGAAGAGAAAAGGGGAGAGGG - Intergenic
1050930013 9:11310982-11311004 AGAGCAGGGAGGAATAGAGCGGG + Intergenic
1050957479 9:11683087-11683109 GGAGGAGGTAGAAGGGGAGACGG - Intergenic
1051602506 9:18889474-18889496 AGGGCAGGGAGAAGGTGACAGGG - Intronic
1051845934 9:21451216-21451238 AGGGCAGGCAGAAGAGGAGGGGG - Intergenic
1052129811 9:24829420-24829442 AATGCAGGGAGAATGGGAGCAGG + Intergenic
1052711909 9:32067501-32067523 AGATCAGGGAGGAGGAGATCTGG + Intergenic
1052790079 9:32867271-32867293 AGGGAAGAGAGAAGGGGAGTAGG - Intergenic
1052899053 9:33774518-33774540 AGGGCAGGGAGGAGGGAAGCCGG + Intronic
1053303021 9:36965058-36965080 GGAGCAAGGAGAAGGGGTGTGGG - Intronic
1053453740 9:38214714-38214736 AGAGGAAGGAGAAGGGGAAAGGG + Intergenic
1054928617 9:70613656-70613678 ACAGCAGGGAGAAGGAAAGAAGG - Intronic
1054991435 9:71331776-71331798 AGAGGAGGAAGAAGAGGAGAGGG + Intronic
1055184133 9:73429834-73429856 AGAGGAGGAAGAAGAGGAGGAGG - Intergenic
1055441937 9:76345121-76345143 AGAGCAGGGAGAGAAGGAGTGGG - Intronic
1055637546 9:78293736-78293758 AGAGCAGTGAGAAGAGAAGTAGG - Intergenic
1056005050 9:82260738-82260760 TGAGCAGGGAGGAGGGGAAGTGG + Intergenic
1056135017 9:83623016-83623038 AAAGCATGGAAAAGGGGCGCGGG + Intergenic
1056147498 9:83747384-83747406 AGAGCAGTGGGGAGGGGAGAAGG + Intronic
1056625058 9:88245996-88246018 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1056625063 9:88246011-88246033 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1056625068 9:88246026-88246048 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1056760474 9:89411089-89411111 AGAGCGGGGAGCTGGGGAGCAGG + Intronic
1056877521 9:90349151-90349173 AGAGCAGAGAGGAGAGAAGCTGG + Intergenic
1056968110 9:91180774-91180796 AGAGCAGCGAGCAGAGGTGCAGG - Intergenic
1057258434 9:93569244-93569266 TGAGCAGGGAGAAGGAATGCAGG - Intergenic
1057308649 9:93927559-93927581 ACAGTAGGGAGCTGGGGAGCAGG + Intergenic
1057457219 9:95225474-95225496 GGAGGATAGAGAAGGGGAGCTGG + Intronic
1057480358 9:95440520-95440542 GGAGGAGGGAGAAGAGGAGGAGG + Intergenic
1057510893 9:95678718-95678740 GGTGCAGGGAGAATGGGTGCAGG + Intergenic
1057756048 9:97836711-97836733 AGAGGAGGGAGGGTGGGAGCAGG - Intergenic
1057896460 9:98912795-98912817 AGAGGAGGGAGAGGGAGAGGAGG + Intergenic
1057928043 9:99170435-99170457 AGGGCAGGGAGATGCGGTGCAGG - Intergenic
1057936604 9:99244894-99244916 AGAGTGAGGAGAAGGGGAGAAGG + Intergenic
1058040867 9:100300330-100300352 AGAGCAGGCACTTGGGGAGCTGG - Intronic
1058375298 9:104316062-104316084 AGGGGAGGGAGAGGGGGAGGAGG - Intergenic
1058593464 9:106589531-106589553 AGAGAAGGAAGAAGGGGAGCAGG + Intergenic
1058746429 9:107995918-107995940 AGAGCAGGTGGGAGGGGACCTGG + Intergenic
1058858572 9:109091097-109091119 GGAGGAGGGTGAAGGGGAGGTGG + Exonic
1058972258 9:110094578-110094600 AGGGCAGGAAGAAAGGGAGTGGG + Intronic
1059038338 9:110784869-110784891 AGAGAAGGAAGAAGAGGAGGAGG - Exonic
1059040200 9:110806356-110806378 AGAGCAGGGAGAAGTGATGGAGG - Intergenic
1059341709 9:113601113-113601135 GGAGCAGGGAGGAGTGAAGCTGG - Intergenic
1059354223 9:113687052-113687074 AGAGAAGGGAGGAGGGAAGAAGG + Intergenic
1059663099 9:116420826-116420848 AGAGGAGGGAGAGGAGGAGAAGG + Intergenic
1059718233 9:116933384-116933406 CAAGCAGACAGAAGGGGAGCCGG + Intronic
1059799912 9:117739696-117739718 ATAGCAGAGAGGAGGGGAGATGG + Intergenic
1059940472 9:119354449-119354471 AAAGCAGGGAGAGGTTGAGCAGG - Intronic
1060059821 9:120449113-120449135 AGAGCAGGGTGAAGTGGAAGGGG - Intronic
1060119897 9:120979125-120979147 AGAGGAGTGAGAAGAGGAGTAGG - Intronic
1060188570 9:121578351-121578373 AGAGGAGGGAAGAGGGGAGCAGG - Intronic
1060369832 9:123058046-123058068 AGAGAGGGGAGAGGGGGAGAGGG + Intronic
1060662429 9:125412093-125412115 ACAGCAGAGAGATGGGGGGCAGG + Intergenic
1060978372 9:127778708-127778730 AGAGAAAGGGGAAGGGGAGGTGG - Exonic
1060989742 9:127841585-127841607 AGGGCAGGGCGGTGGGGAGCAGG + Intronic
1060998975 9:127891715-127891737 AGGAGAGGGAGAAGGGGAGGGGG + Intronic
1061059857 9:128244963-128244985 AAAGGAGGCAGAAGGGGAGTTGG - Intronic
1061147592 9:128808900-128808922 GGAGAAGGAAGAGGGGGAGCTGG + Exonic
1061394048 9:130333652-130333674 AGAGATGGGAGAAAGGGAGGAGG - Intronic
1061450300 9:130663967-130663989 AGGGGACGGAGAAGGGGAGGGGG - Intergenic
1061479987 9:130892926-130892948 ATGGCATGGAGAAGGGGATCGGG + Intergenic
1061493121 9:130957108-130957130 AGAGGAGGGGGCAGGTGAGCTGG + Intergenic
1061806974 9:133142140-133142162 AGAGTGGGGAGATGGGGAGGGGG + Intronic
1061812764 9:133171933-133171955 TGAGCCCGGAGGAGGGGAGCCGG - Intergenic
1061845662 9:133386760-133386782 TGAGCAGGCACAAGGGGTGCTGG + Intronic
1061933734 9:133846338-133846360 ATAGCAGGAAGAGGGTGAGCGGG - Intronic
1061994655 9:134177391-134177413 AGAGGAGGGACACGGGGAGGAGG - Intergenic
1062080847 9:134622616-134622638 AGAGGAGGGAGGAGGGGGGAGGG - Intergenic
1062080878 9:134622715-134622737 AGAGGAGGGAGGAGGGGGGAGGG - Intergenic
1062080909 9:134622816-134622838 AGAGGAGGGAGGAGGGGGGAGGG - Intergenic
1062134713 9:134919071-134919093 AGAACAGGGAGAAAGCCAGCAGG + Intergenic
1062137575 9:134937933-134937955 GGGGCAGGGAGAAGGTGTGCTGG - Intergenic
1062172651 9:135144087-135144109 AAAGGAGGGAGCAGGGGAGCTGG - Intergenic
1062255759 9:135619937-135619959 AGAAGGGGGAGAAGGGGAGTAGG - Intergenic
1062305175 9:135901951-135901973 AGAGCAGAGGGGAGGGCAGCTGG - Intronic
1062578160 9:137218041-137218063 AGAGCAGGCAGCAGGGCAGGGGG + Intergenic
1203743185 Un_GL000218v1:19681-19703 AGGGCAGGAAGAAGGGAATCAGG - Intergenic
1185499181 X:584479-584501 AGAGGAGGAAAAAGGGGAGGAGG + Intergenic
1185541557 X:906638-906660 AAATCAGGGAGGTGGGGAGCTGG + Intergenic
1185608474 X:1380525-1380547 GGAGGAGGGGGAAGGGGAGGAGG + Intronic
1185662006 X:1735501-1735523 GGAGGAGGGAGAAGAGGAGGAGG - Intergenic
1185662025 X:1735586-1735608 AGTGGAGGGAGAAGAGGAGGGGG - Intergenic
1185700000 X:2223616-2223638 AGAGCAGGAGGAAAGGGAGAGGG + Intronic
1185756926 X:2659758-2659780 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
1185756933 X:2659770-2659792 AGGGGAGGGGGAAGGGGAGGGGG - Intergenic
1185785114 X:2884199-2884221 AGGGTAGGGAGAAGGGGTGATGG + Intergenic
1186391533 X:9164644-9164666 AGAGCAGGGGCAAGGGGAGTGGG + Intergenic
1187248890 X:17579467-17579489 AGGAGAGGGAGAGGGGGAGCAGG - Intronic
1187460024 X:19478106-19478128 AGAGGGGGGAGAGGGGGAGAGGG + Intronic
1187559080 X:20382997-20383019 AGGGCAGGGAGAAGAGAGGCAGG - Intergenic
1187565297 X:20443694-20443716 AAGCAAGGGAGAAGGGGAGCAGG - Intergenic
1187715389 X:22097456-22097478 AGAGCAGGAAGAAGGTGAAAGGG + Intronic
1188137148 X:26504682-26504704 ATGCCAGGGAGAAGGGGAGGTGG - Intergenic
1189021981 X:37350048-37350070 AGAGCGGGGGGAGGGGGAGGCGG + Intronic
1189110573 X:38286028-38286050 GGAGGAAGGAGAAGGGGAGGGGG - Exonic
1189110583 X:38286055-38286077 GGAGGAAGGAGAAGGGGAGGGGG - Exonic
1189110592 X:38286076-38286098 AGAGGAAGGAGAAGGGGAAGGGG - Exonic
1189110600 X:38286100-38286122 GGAGGAAGGAGAAGGGGAGGGGG - Exonic
1189110619 X:38286154-38286176 GGAGGATGGAGAAGGGGAGGGGG - Exonic
1189110637 X:38286202-38286224 AGAGGAAGGAGAAGGGGAGGGGG - Exonic
1189110687 X:38286364-38286386 GGAGGAAGGAGAAGGGGAGGGGG - Exonic
1189125816 X:38445074-38445096 GGAGGAGGTAGGAGGGGAGCAGG - Intronic
1189185058 X:39047639-39047661 AGAGCAGGGAGGAGAGAAGGTGG - Intergenic
1189289713 X:39876501-39876523 AGGAGAGGGAGAAGGGGAGGAGG + Intergenic
1189300466 X:39948677-39948699 TGACCAGGAAGAAGGGGAGGGGG + Intergenic
1189960854 X:46323650-46323672 AGAGGAGTCAGAAGGGGAGATGG - Intergenic
1190058560 X:47196331-47196353 AGGGCATAGAGAAGGGGGGCTGG - Intronic
1190084195 X:47381057-47381079 AGAGCAGGAGGAGGAGGAGCAGG + Intronic
1190084206 X:47381120-47381142 AGAGCAGGAGGAGGAGGAGCAGG + Intronic
1190149502 X:47932241-47932263 AGGGCAGGGAGAAGGCTAGAAGG - Intronic
1190157883 X:48008351-48008373 GGGGCAGGGAGAAGGGAGGCAGG - Intronic
1190173655 X:48131236-48131258 GGGGCAGGGAGAAGGGAGGCAGG - Intronic
1190189947 X:48268772-48268794 AGCGTAGGGAGAAGAGGGGCAGG + Intronic
1190266554 X:48830684-48830706 AGAGCGGAGAGAAAGGGAGAGGG - Intergenic
1190420619 X:50281024-50281046 AGAGCTGGGAGTACGGGAGTAGG + Intronic
1190457042 X:50636648-50636670 AAAGCAGGGAGAAAGGAAGTGGG - Intronic
1190472609 X:50798029-50798051 AGAGAAGGAAGGAGGGGAGAGGG + Intronic
1190662076 X:52663965-52663987 AGAGCAGGGTGGTGGGGAGCAGG + Intronic
1191104779 X:56765784-56765806 AGTGCAGGGGGAGGGGGAGGAGG - Intergenic
1191977004 X:66884080-66884102 AGAGCAGGGCAAAGGGTATCAGG - Intergenic
1192193778 X:69015364-69015386 ACACCAGGGAGAAGGGCAGACGG + Intergenic
1192202956 X:69078512-69078534 AGAGGAGGGTGGAGGGCAGCTGG - Intergenic
1193043942 X:77032862-77032884 AGAGCAGAGAGGAGTGAAGCTGG + Intergenic
1193046758 X:77062010-77062032 ATGGCATGGAAAAGGGGAGCAGG + Intergenic
1193742983 X:85241275-85241297 AGAGGAGAGAGAAGGAGGGCGGG + Intergenic
1193743451 X:85244891-85244913 AGAGGAGGGAGGAGGGGAAAGGG + Intronic
1193839367 X:86390363-86390385 GGAGGCGGGAGAAGGGGAGAGGG + Intronic
1194174493 X:90629493-90629515 GGGGCGGGGAGGAGGGGAGCAGG - Intergenic
1194844160 X:98782741-98782763 AGAGAAGGGGGAAGAGGAGGAGG + Intergenic
1195101940 X:101563175-101563197 AGAGGAGGGAGAAGGGAGGAAGG + Intergenic
1195343480 X:103926551-103926573 GGAGCAGGGAGAAGGGGCTAGGG + Intronic
1195363488 X:104106768-104106790 GGAGCAGGGAGAAGGGGCTAGGG - Intronic
1195406721 X:104522615-104522637 AGCGAAGGGAGAAGGGGAAGTGG + Intergenic
1195446725 X:104960528-104960550 AGAGTATGGGGAAGGGGAGCAGG + Intronic
1195610854 X:106864331-106864353 AGAGCAGAGAGGAGGGAAGCTGG - Intronic
1195761592 X:108252124-108252146 AGAGTAGGGAGAAGGGGAGAAGG - Intronic
1196219463 X:113095326-113095348 AGTGGAGGGAGAAGGGGAATAGG + Intergenic
1196298874 X:114031567-114031589 ACAGAAGGCAGAAGGGAAGCAGG + Intergenic
1196429333 X:115606069-115606091 TCAGCAGGGATAAGGGGGGCGGG + Intronic
1196816077 X:119666542-119666564 AGAGGAGGGAGACAGGGAGAGGG + Intronic
1196827972 X:119755900-119755922 ATAGCAGGGAGTAGGGCAGAGGG - Intergenic
1197153179 X:123242265-123242287 TGAGCAGGGAGAGGGTGAGATGG - Intronic
1197392586 X:125885188-125885210 AGAGCAGAGAGAAGAGGAATTGG + Intergenic
1197563157 X:128048387-128048409 AGAGCAGAGAGAAGAGAGGCAGG - Intergenic
1197761364 X:130030687-130030709 GGAACAGGGGGAAGGGGAGGGGG - Intronic
1198242068 X:134796721-134796743 AGAGGAGGGAGAAGAGGAGGGGG + Intronic
1198430626 X:136563295-136563317 AGAGGAGGTAGAAAGGGAGATGG - Intergenic
1198444155 X:136694607-136694629 AGATCAGAGAGAAGAGGAGTTGG - Intronic
1198600961 X:138283433-138283455 AGACCGGGGAGAGGGGGAGGGGG + Intergenic
1199021312 X:142881569-142881591 AGAACAGCAAGAAGGGCAGCTGG + Intergenic
1199334769 X:146605786-146605808 AGAGCAGGAAGAAGGGGTAGCGG + Intergenic
1199411445 X:147528551-147528573 GGAGAAGGGAGAGGGGGAGGGGG - Intergenic
1199488363 X:148372445-148372467 AGAGCAGTCAGAGGTGGAGCCGG + Intergenic
1199896902 X:152135468-152135490 AGAGGATGGAAAAGAGGAGCTGG + Exonic
1199968811 X:152843560-152843582 AAGGCAGGGAGAAGAGGAGGAGG - Intronic
1200061300 X:153484972-153484994 AGAACATGGAGAGAGGGAGCAGG - Intronic
1200086526 X:153609939-153609961 AGAGGAAGGAGAAGGGGTCCAGG - Intergenic
1200136142 X:153875672-153875694 GGAACAGGGAGAAGGTGAGGAGG + Intronic
1200137807 X:153883426-153883448 AGAGGAGAGAGCAGGGGGGCGGG + Intronic
1200149581 X:153944686-153944708 AGAGGAGGGGGAGGGTGAGCCGG - Exonic
1200374711 X:155767572-155767594 AAAGGAGGAAGAAGGGGAGGAGG + Intergenic
1201156714 Y:11137148-11137170 AGGGCAGGAAGAAGGGAATCAGG - Intergenic
1201702471 Y:16899483-16899505 AGAGAAGGGAGAGGGGGAAGAGG - Intergenic
1201894916 Y:18982898-18982920 AGAGGAGGGAAAGGGGGAGGAGG + Intergenic
1202372135 Y:24205759-24205781 GCAGCAGGGAGAGGCGGAGCTGG - Intergenic
1202498650 Y:25464357-25464379 GCAGCAGGGAGAGGCGGAGCTGG + Intergenic