ID: 1071503516

View in Genome Browser
Species Human (GRCh38)
Location 10:86219543-86219565
Sequence CAGAGCAGGGAGAAGGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2309
Summary {0: 1, 1: 1, 2: 19, 3: 249, 4: 2039}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503516_1071503522 1 Left 1071503516 10:86219543-86219565 CCGCTCCCCTTCTCCCTGCTCTG 0: 1
1: 1
2: 19
3: 249
4: 2039
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503516_1071503526 11 Left 1071503516 10:86219543-86219565 CCGCTCCCCTTCTCCCTGCTCTG 0: 1
1: 1
2: 19
3: 249
4: 2039
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503516 Original CRISPR CAGAGCAGGGAGAAGGGGAG CGG (reversed) Intronic
Too many off-targets to display for this crispr