ID: 1071503517

View in Genome Browser
Species Human (GRCh38)
Location 10:86219548-86219570
Sequence GTGTGCAGAGCAGGGAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 822}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503517_1071503530 27 Left 1071503517 10:86219548-86219570 CCCCTTCTCCCTGCTCTGCACAC 0: 1
1: 0
2: 8
3: 75
4: 822
Right 1071503530 10:86219598-86219620 GGCCCCCCGTCCCAGAGTGAGGG No data
1071503517_1071503522 -4 Left 1071503517 10:86219548-86219570 CCCCTTCTCCCTGCTCTGCACAC 0: 1
1: 0
2: 8
3: 75
4: 822
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503517_1071503526 6 Left 1071503517 10:86219548-86219570 CCCCTTCTCCCTGCTCTGCACAC 0: 1
1: 0
2: 8
3: 75
4: 822
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data
1071503517_1071503529 26 Left 1071503517 10:86219548-86219570 CCCCTTCTCCCTGCTCTGCACAC 0: 1
1: 0
2: 8
3: 75
4: 822
Right 1071503529 10:86219597-86219619 TGGCCCCCCGTCCCAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503517 Original CRISPR GTGTGCAGAGCAGGGAGAAG GGG (reversed) Intronic
900114498 1:1022722-1022744 GTATGGAGAGCTGGGAGGAGGGG - Intronic
900204322 1:1425677-1425699 GTGTTCAGATGAGGGAGCAGCGG + Intergenic
900832830 1:4977417-4977439 GTGGGCAGAGCAGGCAGACCAGG + Intergenic
900862273 1:5242136-5242158 GAGTCCTGAGCAGGGAGGAGGGG + Intergenic
901199938 1:7461003-7461025 GTTTGCAGAGGAGGTAGCAGAGG + Intronic
902725706 1:18334753-18334775 GTGTGCTGGGCTGGGAGGAGGGG - Intronic
902768377 1:18631469-18631491 GTGTGGAGGGGAGGGAGAAGAGG + Exonic
903031145 1:20465249-20465271 GTGGGCAGGACAGGGAGAAGAGG - Intergenic
903438929 1:23372439-23372461 CTCTGCAGAGGAGGGGGAAGTGG + Intergenic
903668324 1:25021359-25021381 GTGGGGAGAGCAGAGAGAGGCGG + Intergenic
903740617 1:25556457-25556479 GGGTGAAGAGCTGGGAGTAGGGG - Intronic
903772047 1:25770177-25770199 GTGTGGAGGGAAGAGAGAAGTGG - Intronic
904355271 1:29934503-29934525 GTGGGCAGGGCTGGGAGGAGGGG + Intergenic
904425125 1:30417959-30417981 GTGTGCAGAGCTGGGGCATGAGG + Intergenic
904470256 1:30731672-30731694 GTGGGGAGGGGAGGGAGAAGAGG - Intergenic
904579912 1:31535245-31535267 TGGTGCAGACAAGGGAGAAGTGG - Intergenic
904621716 1:31779339-31779361 GTGTGAAGAGCTGCGAGCAGAGG - Intergenic
904754265 1:32759553-32759575 GTGCCCAGAGCAGGGAGGGGAGG - Intronic
904832217 1:33312421-33312443 GTGTGGAGGGCAGGGACATGGGG + Intronic
905300935 1:36985819-36985841 ATGTGCACAGCAGGGAGACGGGG - Intronic
905490529 1:38340041-38340063 GTGGCCAGAGCAGGGAGAGCTGG + Intergenic
906103026 1:43275198-43275220 GTGTGCATGGCAGGGGGAAGGGG - Intergenic
906288541 1:44604103-44604125 GTGTGCAGGCTAGGGAGAATAGG + Intronic
906614478 1:47225312-47225334 GGGTGGAGCGCAGGGAGAGGAGG - Intronic
907270842 1:53290177-53290199 GTGTTCAGAGCAGTCGGAAGAGG + Intronic
907366415 1:53964305-53964327 GTGTGGAGATGTGGGAGAAGAGG - Intronic
907386327 1:54127939-54127961 GGGCACAGAGCAGGGTGAAGAGG - Intergenic
907444749 1:54500257-54500279 GTGTGCACAGCAGGGACACCTGG + Intergenic
907447785 1:54520021-54520043 GTGCGCAGAGCAGTGTTAAGGGG + Intergenic
907615286 1:55918272-55918294 ATGGCCAGAGCAGGAAGAAGTGG + Intergenic
907708987 1:56860224-56860246 GGGTGAAGAGCAGGGTAAAGCGG + Intronic
908390659 1:63680682-63680704 AAGTCCAGAGCAGAGAGAAGAGG + Intergenic
908505834 1:64799083-64799105 CTGGGAAGAGAAGGGAGAAGGGG - Intronic
909028333 1:70508847-70508869 GTATGCAGACCACTGAGAAGGGG + Intergenic
909662940 1:78104167-78104189 GTGTGTAGAGGGGGGAGAGGGGG + Intronic
911202003 1:95054358-95054380 ATGGGCAGAGCAGGAGGAAGGGG - Intronic
912184799 1:107262332-107262354 GAGGGCAGTTCAGGGAGAAGAGG + Intronic
912207899 1:107528316-107528338 GTGTGAAGAATAGGGAGAAGTGG - Intergenic
912274595 1:108242921-108242943 GTGTGCAGAGCAGGGACCCTGGG - Intronic
912286672 1:108376937-108376959 GTGTGCAGAGCAGGGACCCTGGG + Intronic
912293623 1:108451420-108451442 GTGTGCAGAGCAGGGACCCTGGG + Intronic
913069928 1:115289651-115289673 GTATGCAGAGAAGGAAGATGGGG - Intronic
913497387 1:119440996-119441018 GGCAGCAGAGAAGGGAGAAGAGG + Intergenic
913543417 1:119843318-119843340 GTGTGCAGAGCAGGGACCCTGGG - Intergenic
914365443 1:146973931-146973953 GTGTACAGAGCAGGGACCATGGG + Intronic
914980711 1:152412068-152412090 GTGTGCTGAGCCGGGTGGAGAGG - Intronic
914983881 1:152440271-152440293 GGGTGCCAAGCAAGGAGAAGTGG - Intergenic
915304881 1:154971336-154971358 GGATGCAGAGCAGGGCCAAGAGG + Intronic
915493915 1:156267596-156267618 GTGAGGAGGGCAGGTAGAAGAGG + Exonic
915974298 1:160375007-160375029 GTGGGAAGAGGAGGGAGCAGGGG + Intergenic
916180060 1:162075596-162075618 GGGTGGAGAGAAGGGAGAAAGGG - Intronic
916507294 1:165439600-165439622 GAGTGGAGAGCATGTAGAAGAGG - Intronic
916832349 1:168505817-168505839 TTGTTTGGAGCAGGGAGAAGAGG - Intergenic
917245821 1:172999143-172999165 GTGTGCAGAGCAGGTATGTGGGG + Intergenic
918032666 1:180831029-180831051 GTGTTCAGAACAGTGGGAAGAGG + Intronic
918528052 1:185486573-185486595 GTGGTCAGAGCCTGGAGAAGTGG + Intergenic
919664721 1:200281044-200281066 GTGTGCAGAGCTAAGAGATGAGG + Intergenic
919727986 1:200896033-200896055 CTGGGCTGAGCTGGGAGAAGGGG + Intronic
919850739 1:201670490-201670512 GTGTCCTGAGCAGGCAGATGTGG + Intronic
919883389 1:201915602-201915624 GAGTGCAGAGCGGGGTGCAGAGG - Intronic
920086210 1:203419303-203419325 ATGTTCAAGGCAGGGAGAAGGGG + Intergenic
920378442 1:205522024-205522046 GTGTGCAGAGCAGGATGAGAGGG + Intronic
920670911 1:208003082-208003104 GCTTGCTGAGCAGGGAAAAGTGG + Intergenic
920928423 1:210364762-210364784 TTGTGGAGAGCACTGAGAAGGGG - Intronic
922424817 1:225482931-225482953 GTGTGCACAGCAGGTGGAAATGG - Intergenic
922822705 1:228495003-228495025 GTGGCCAGGGCAGGGGGAAGAGG - Exonic
922932827 1:229403588-229403610 CGGTGCAGAGGAGGGACAAGTGG + Intergenic
922953964 1:229583475-229583497 GTGTGCAAAGTGGGGACAAGAGG - Intergenic
923051369 1:230393243-230393265 GGGAGAAGAGCAGGGAAAAGGGG + Intronic
924089709 1:240489495-240489517 GTGTGAGAAGCAGGGTGAAGGGG + Intergenic
924688287 1:246319283-246319305 GTGAGCAGAGTAGAGAGATGTGG + Intronic
924763188 1:247007865-247007887 GTGTCCCGAGAAGGGAGAGGGGG - Intronic
1063707755 10:8447311-8447333 GTGTGCAGATCAGAGGGAATGGG - Intergenic
1063938948 10:11107821-11107843 GGGGGCAGAGGAGGGAGGAGGGG - Intronic
1064203806 10:13305914-13305936 GTGTGTAAATCTGGGAGAAGAGG + Intergenic
1065499243 10:26362862-26362884 GTGGGAAGAGGAGGGAGAAAGGG + Intergenic
1066179205 10:32943455-32943477 GTGTGCAGGGCAGGTGCAAGAGG + Intronic
1066253954 10:33660847-33660869 CTGTGCAGAGAAGAGAGCAGGGG - Intergenic
1067191186 10:44069483-44069505 GTATAAATAGCAGGGAGAAGAGG - Intergenic
1067246633 10:44552903-44552925 GTGTGCAGAGCAGGGAGGACGGG - Intergenic
1067429533 10:46234049-46234071 CTGAGAAGAGCAGGGAGCAGTGG + Intergenic
1067525546 10:47036195-47036217 GTGTGTGGAGCAGTGAGAAAGGG - Intergenic
1067526569 10:47042929-47042951 GGCTGCAGAGCAGGGAGAGAAGG + Intergenic
1067558073 10:47286027-47286049 GTGTGCAGAGCAGGCAGAGGGGG + Intergenic
1067830570 10:49609370-49609392 GTGTGCAGAACAGGGGGCGGAGG + Intronic
1068595592 10:58899782-58899804 ATGGCCAGAGCAGGAAGAAGGGG - Intergenic
1068766683 10:60772095-60772117 GTTTGCAGAGCAGGTGGAAAGGG - Intergenic
1069135941 10:64766048-64766070 GTTTGCAAATCAGGGAGATGGGG + Intergenic
1069144688 10:64875760-64875782 GTTTGCACAGAGGGGAGAAGTGG - Intergenic
1071455560 10:85849038-85849060 GTGGGCACAGCAGTGAGGAGGGG - Intronic
1071503517 10:86219548-86219570 GTGTGCAGAGCAGGGAGAAGGGG - Intronic
1071561626 10:86650297-86650319 GTGAGCAGAGCAGGGGCATGGGG - Intergenic
1071613639 10:87055002-87055024 GAATGCAGGGCAGTGAGAAGAGG + Intronic
1071703085 10:87963671-87963693 GTGAGGAAAGTAGGGAGAAGGGG + Intronic
1071959088 10:90791552-90791574 GTGTGCATTGAAGGGGGAAGAGG + Intronic
1072613730 10:97035769-97035791 GTCTTCGGAGCAGGGAGCAGAGG - Intronic
1072617786 10:97060773-97060795 TTCTGCAGGCCAGGGAGAAGCGG - Exonic
1073049505 10:100658406-100658428 GGGAGCAGAGAAGGGAGCAGGGG + Intergenic
1073185335 10:101612310-101612332 GTGTGCTGGGCAGGGAGGACAGG - Intronic
1074406482 10:113184048-113184070 GGGTGCAAAGGAGGGAGAGGTGG - Intergenic
1075406592 10:122199562-122199584 GTGTGAAGAGCAGGGGGCTGTGG + Intronic
1075582620 10:123633801-123633823 GAAGGCAGAGGAGGGAGAAGAGG + Intergenic
1075642127 10:124072396-124072418 GGGTCCAGAGCAGTGGGAAGAGG - Intronic
1075811149 10:125226090-125226112 AAGAGCAGAGCAGCGAGAAGTGG + Intergenic
1075825879 10:125356734-125356756 CTGGGCAGAGCAGGGAGGAGGGG - Intergenic
1076092006 10:127694514-127694536 GTGTGGAGAACAGAAAGAAGCGG + Intergenic
1076921690 10:133457631-133457653 CTGGGGAGGGCAGGGAGAAGGGG + Intergenic
1076995399 11:295150-295172 GCGTGGACAGCAGGGATAAGGGG + Exonic
1077130582 11:970388-970410 GTGGGCAGAGAAGGAAGCAGCGG - Intronic
1077461985 11:2715357-2715379 GTGGACAGAGCAGGCAGGAGTGG + Intronic
1077581129 11:3418019-3418041 CAGTGCAGGGCAGGAAGAAGGGG - Intergenic
1078042299 11:7879114-7879136 TTGGGCAGAGCAGGAGGAAGAGG + Intergenic
1078187043 11:9060860-9060882 GAGTGCAGAACAGGGCAAAGGGG + Intronic
1078362913 11:10683537-10683559 GGGGGCAGGGCAGGGAGAAAGGG - Intronic
1078525867 11:12100818-12100840 GTGCGCAGAGGAGGGGGAATGGG - Intronic
1079891973 11:26067176-26067198 GTGTGAAGAGGAGGGGGTAGAGG - Intergenic
1079946663 11:26751480-26751502 GTACGCAGAACAGGGAGAAAAGG + Intergenic
1081338813 11:41902515-41902537 ATGTGCAGAGCAGCAACAAGTGG + Intergenic
1081524261 11:43914036-43914058 GGGTGCAGCACAGGGAGGAGAGG - Intronic
1081854355 11:46294705-46294727 GTGGTGAGAGCAGGGAGAGGAGG - Intronic
1081908858 11:46687227-46687249 GTCTGAAGAGCAGTGGGAAGAGG + Intronic
1082796958 11:57385030-57385052 CTGTGCAGAGCACAGAGTAGGGG - Intergenic
1082814646 11:57499872-57499894 AGTTGCACAGCAGGGAGAAGGGG + Intronic
1083715166 11:64571227-64571249 CTGATCAGGGCAGGGAGAAGAGG - Exonic
1083818384 11:65150970-65150992 GAGGGCAGAGCAGGGACAGGAGG + Intergenic
1083920412 11:65779205-65779227 CTGTGCCGAGGAGGAAGAAGAGG - Exonic
1084273364 11:68040328-68040350 GTGGGCAGGGCAGGGGGCAGCGG - Intronic
1084680954 11:70666051-70666073 AGGAGCAGAGCAGGGAGAAACGG + Intronic
1084903292 11:72326591-72326613 GGATGCTGAGCAGAGAGAAGGGG + Intronic
1085412750 11:76301320-76301342 GAACGCAGAGCAGGGAGATGTGG - Intergenic
1085708645 11:78809609-78809631 GTGTGTAAAGTGGGGAGAAGCGG + Intronic
1086177957 11:83914942-83914964 GTGTGCAGAGTAGGAAGAGAAGG + Intronic
1087008111 11:93488723-93488745 GCCTGCAAAGCAGGGAGAATGGG + Intronic
1087104750 11:94398330-94398352 GTGGGCAGGGGAGGGAGAAGCGG - Intronic
1087709575 11:101533369-101533391 GGTTGCAGAGAAGGGGGAAGCGG + Intronic
1088381174 11:109194518-109194540 GGGAGAAGAGGAGGGAGAAGAGG - Intergenic
1088634477 11:111806568-111806590 GTGTAGAGATTAGGGAGAAGAGG - Intronic
1089159191 11:116424490-116424512 CTGGGCACAGCAGGGAGACGGGG + Intergenic
1089607003 11:119647328-119647350 GTGTGGAGGGCAGGGAGTGGTGG - Intronic
1089812847 11:121145808-121145830 TTGGGCAGAGCTGGGTGAAGAGG + Exonic
1089870515 11:121668590-121668612 GTGTGAAGACATGGGAGAAGAGG + Intergenic
1090031633 11:123211451-123211473 GGGAGCAGAGCAAGGGGAAGGGG - Intergenic
1090234677 11:125138934-125138956 GTGTGAAGAGCAGGGTGGAGAGG - Intergenic
1090396753 11:126424272-126424294 GTGGGCAGAGCAGGTGGTAGAGG + Exonic
1090436172 11:126688197-126688219 GTGGCCAGAGCTGGGTGAAGAGG - Intronic
1090844477 11:130519353-130519375 GAGTGCAGAGAAGGCTGAAGGGG + Intergenic
1090868950 11:130726131-130726153 GTGTCCTGAGCCTGGAGAAGGGG - Intergenic
1091306473 11:134539398-134539420 GTGGGCAGGGCTGGAAGAAGAGG - Intergenic
1091334328 11:134755028-134755050 GTGGGGAGTGCAGGGAGAACCGG + Intergenic
1091549973 12:1530068-1530090 GCGTGCGGCGCCGGGAGAAGGGG + Intronic
1091588969 12:1831755-1831777 GGATGCAGAGCAGGGAGGGGAGG - Intronic
1091726323 12:2848957-2848979 CTGGGTAGAGCAGGGAGAACAGG - Intronic
1092312566 12:7374406-7374428 GTGTGTAGAGGAGGGTGAAAAGG + Intronic
1093252130 12:16819716-16819738 GTGTCAAGAGCAGGGACAGGTGG - Intergenic
1094364890 12:29669869-29669891 GTGGGCAGAACAGAGAGAACTGG + Intronic
1094474211 12:30828693-30828715 GTTGGCAGGGCAGGGAGAAATGG - Intergenic
1094486705 12:30930916-30930938 GTGTGCAGGGCAGTGAGAGAGGG - Intronic
1095737236 12:45570747-45570769 GTTTGCAAGGCAGAGAGAAGTGG - Intergenic
1097812543 12:64034275-64034297 GTGTCCAGAGAAGGAGGAAGAGG - Intronic
1098078504 12:66759007-66759029 GGGGGCAGAGCTGTGAGAAGAGG - Intronic
1099027033 12:77477869-77477891 GTGTGCAAATCAAGCAGAAGGGG - Intergenic
1099136460 12:78909980-78910002 GTGAACAGAGGAGGAAGAAGGGG - Intronic
1099905431 12:88764484-88764506 GTGGGCAGAGCAGAAAGAACAGG + Intergenic
1100701147 12:97149593-97149615 GTATGCAGAGTTTGGAGAAGAGG - Intergenic
1101580270 12:106036639-106036661 GTATGCAGAGGAAGGAGGAGAGG - Intergenic
1101624155 12:106422282-106422304 ATGGCCAGAGCAGGAAGAAGAGG - Intronic
1102531731 12:113551664-113551686 GTGGGCACAGAAGGAAGAAGGGG - Intergenic
1102568914 12:113815493-113815515 GTGAGCAGAGCTGGGAGGAAGGG - Intergenic
1102575551 12:113853977-113853999 GTGGGCATGGTAGGGAGAAGGGG + Intronic
1102851205 12:116246828-116246850 GTGTGGAGGGGAGGGAGAGGAGG + Intronic
1102896512 12:116602654-116602676 ATGGGCACAGCAGGGGGAAGAGG - Intergenic
1102904453 12:116663337-116663359 GGTAGCAGAGCAGGGAGAGGTGG - Intergenic
1102973985 12:117192940-117192962 GTGTGGGAAGCAGGGAGAAATGG + Intergenic
1103276080 12:119712842-119712864 GTGTGCAGAGAAGGCAGAGAGGG + Intronic
1103351612 12:120287566-120287588 AGGTGGAGAGAAGGGAGAAGGGG - Intergenic
1103902732 12:124311745-124311767 GTGTGCCCAGCAGGGAGCTGAGG + Intronic
1104111750 12:125710868-125710890 CTGGGCAGAGAAGGGAAAAGTGG + Intergenic
1104226618 12:126841108-126841130 CTGTTCAAAGCAGGAAGAAGTGG - Intergenic
1104429388 12:128704565-128704587 GGGGGCAGTGCAGGGAGAAGAGG + Intronic
1104894972 12:132159574-132159596 GTGGGCAGGGCATGGAGATGTGG + Intergenic
1104930257 12:132335225-132335247 CAGTGAAGAGAAGGGAGAAGTGG + Intergenic
1104937363 12:132373714-132373736 CTGGGCAGAGCAGAGAGACGGGG - Intergenic
1106469247 13:30039927-30039949 TTGTGCAGAGCGGTGTGAAGAGG + Intergenic
1106861202 13:33910866-33910888 GGGAGCAGAGCAGGAGGAAGTGG + Intronic
1107032088 13:35863522-35863544 GGGTGCAGAGAAAGGAGAAATGG + Intronic
1107714671 13:43188323-43188345 GTGGGAAGAGCTGGGAGAAATGG + Intergenic
1108171271 13:47744587-47744609 GTGTGCAGAGTGGTGAGAGGAGG + Intergenic
1108428024 13:50324946-50324968 ATGTGTAGAGCAGAGAGAGGAGG - Intronic
1110341483 13:74396825-74396847 GAGAGCAGCACAGGGAGAAGAGG + Intergenic
1112386082 13:98940853-98940875 GTGTGCAGAGAATAGATAAGAGG - Intronic
1112576009 13:100637443-100637465 GCGTGCAGAGGAGTGAGACGAGG + Intronic
1113149041 13:107241840-107241862 CTGTGCAGAGCAGTTAGCAGAGG + Intronic
1113541994 13:111115867-111115889 GTGTGCGGGGCAGGGGGAGGGGG + Intronic
1113981374 13:114279924-114279946 CAGTGCAGTGAAGGGAGAAGTGG + Intergenic
1114663130 14:24362045-24362067 GTATGAAGAGCATGGAGAATGGG - Intergenic
1115577785 14:34727717-34727739 GTGTCAAGGGCAGGGACAAGTGG - Intergenic
1115925374 14:38427659-38427681 GTCTGCAGAGCAAGGGGAATAGG + Intergenic
1117011329 14:51473509-51473531 GTGTGTAGAACAGGAAGAACAGG - Intergenic
1117327704 14:54684498-54684520 GTGTGCAGGGCAGGGATGGGAGG - Intronic
1117476160 14:56097017-56097039 GTTTGCACAGGAGAGAGAAGTGG + Intergenic
1117487186 14:56210212-56210234 GGGTGCGGAGGAGGAAGAAGAGG + Intronic
1118347599 14:64951250-64951272 GGATGCTGAGCAGGGAGAATGGG - Intronic
1118629341 14:67688517-67688539 GGGAGAAGAGCAGGGGGAAGAGG + Intronic
1119030467 14:71188333-71188355 GTGTGCAGTGAAGGGAGCTGGGG + Intergenic
1119435057 14:74593128-74593150 GGGTGGAGTGAAGGGAGAAGGGG - Intronic
1119437856 14:74609858-74609880 GCGTGCAGAGCATGGGAAAGGGG - Intronic
1119843528 14:77811080-77811102 GTGTAGAGAGCAAGGAGAAAGGG + Intronic
1120771516 14:88385423-88385445 GCGGGAAGAGCAGGGAGAGGAGG - Intronic
1121321293 14:92993112-92993134 GTCTGTAGGGCAGGGAGCAGGGG + Intronic
1121467991 14:94128306-94128328 GGGTGCTGGGTAGGGAGAAGAGG - Intronic
1121795026 14:96727681-96727703 GTGTGCAGTGGAGTGAGGAGGGG + Intergenic
1121911000 14:97792464-97792486 TGGTGCAGAGAAGGGAGCAGGGG - Intergenic
1121997060 14:98611068-98611090 GTGGGAAGAGCAGGGAGGTGAGG - Intergenic
1122364468 14:101186293-101186315 GTATGCAGAGCTGGAAGGAGAGG + Intergenic
1122501381 14:102202279-102202301 ATGAGGAGAGCAGGCAGAAGAGG - Intronic
1122795883 14:104205982-104206004 GTGTGCAGGGCTGGGAGCTGGGG + Intergenic
1123957251 15:25350329-25350351 GGGTGCAGGGCAGGGAGAGTTGG - Intronic
1124156607 15:27231438-27231460 GTGAGCGGGGTAGGGAGAAGAGG + Intronic
1125253239 15:37730980-37731002 GTGAGCAGAGAAGGGAAAAAGGG - Intergenic
1125345452 15:38714563-38714585 GAATGCAGAGCTGAGAGAAGGGG - Intergenic
1125451716 15:39815182-39815204 GTGTGTAGAGGAGACAGAAGGGG + Intronic
1126583194 15:50259531-50259553 GCTTGCAGAGCAGTGAGATGAGG - Intronic
1126841699 15:52723565-52723587 GTGTGGAAAGGAGGGAGAAGGGG - Intergenic
1126983399 15:54273373-54273395 GTGTGCAGAGAAGCGAGGAAAGG - Intronic
1127309970 15:57743894-57743916 CAGGGAAGAGCAGGGAGAAGGGG - Intronic
1127568383 15:60215534-60215556 GTGTGCAGAGAAGGTGGAGGTGG + Intergenic
1127899421 15:63330055-63330077 GTGAGCAGAGTAGGGAGAATAGG - Intronic
1128215200 15:65929942-65929964 GTGTGCAGAGCTGGGGGGAGTGG - Intronic
1128223218 15:65982987-65983009 GTGTGGGGAAGAGGGAGAAGCGG - Intronic
1128649575 15:69400763-69400785 CTGTGCAGAAAAGGGAAAAGGGG + Intronic
1128861754 15:71080128-71080150 GTGTGCAGGGCGGAGAGGAGAGG + Intergenic
1129052954 15:72797460-72797482 CTGTGCCACGCAGGGAGAAGAGG - Intergenic
1129245664 15:74277353-74277375 CTGGGCAGAGCAGGCAGAGGTGG + Intronic
1129283628 15:74506035-74506057 AAGTGCAGGGCAGGGAGCAGTGG - Intergenic
1129600796 15:76996911-76996933 GTGTGCAAAGTTGGGGGAAGGGG + Intronic
1130670710 15:85910072-85910094 GTGTGCAGAGCGGGGGTCAGGGG + Intergenic
1130674971 15:85943541-85943563 GTGAGAAGAACAGGGAGAATAGG + Intergenic
1130814008 15:87411436-87411458 GTGTGCAGAGGTGGAAGAAAGGG - Intergenic
1130985721 15:88843295-88843317 GGATGCAGAGCAGGGGGAGGGGG + Intronic
1131177900 15:90221301-90221323 GGGCCCTGAGCAGGGAGAAGGGG + Intronic
1131252274 15:90838490-90838512 GCGTGCAGAGCAGGGAGAGCAGG - Intergenic
1131434483 15:92412169-92412191 GTGTGAAAAGGAAGGAGAAGTGG + Intronic
1131620400 15:94062115-94062137 ATGGCCAGAGCAGGAAGAAGAGG - Intergenic
1131871996 15:96773029-96773051 GAGTGCAGAGCAGTGATGAGGGG - Intergenic
1132238927 15:100242595-100242617 GTGTGCAGGACGGGGAGGAGAGG - Intronic
1132313916 15:100877478-100877500 TGGTGCAGTGCAGGGAGGAGGGG - Intergenic
1132552106 16:557782-557804 GTGGGCAGACCGGGCAGAAGAGG + Intergenic
1132763874 16:1524810-1524832 GGATGCGGACCAGGGAGAAGTGG + Exonic
1133062273 16:3182867-3182889 TTGTGCGGCGCAGGGAGAAGCGG - Intergenic
1133541043 16:6754520-6754542 TAGTGCAGAGGAGGGAGCAGTGG - Intronic
1133647246 16:7775855-7775877 GAGGGGAGAGCAGGGGGAAGAGG + Intergenic
1134281370 16:12819917-12819939 GTGTCAAGGGCAGGGAGAGGTGG - Intergenic
1135158115 16:20071774-20071796 GAGTTCAAAGCAGGGACAAGAGG - Intronic
1135517649 16:23149094-23149116 GCGTGCAGAGGAGGGCGAGGAGG + Exonic
1136005156 16:27324338-27324360 GTTTGCCCAGCAGGGAGAGGTGG + Intronic
1136045284 16:27610267-27610289 GAGGGGAGAGCAGGGAGAAATGG + Intronic
1136071236 16:27788526-27788548 GTGTGGAGAGCAGGGAGGTCAGG - Exonic
1136102137 16:28004083-28004105 GTGTGCACAGCAGGGTGGAGGGG + Intronic
1136147247 16:28322629-28322651 GTGGGCACAGCAGGGAGAGTGGG - Exonic
1136402198 16:30024983-30025005 GGGGGCAGAGTAGGGGGAAGAGG + Exonic
1136490471 16:30604689-30604711 GCGTGCTGCGCTGGGAGAAGCGG + Exonic
1137241232 16:46656237-46656259 ATGTGCAGAGCAAAGACAAGAGG - Exonic
1137382552 16:48012673-48012695 GTGAGCAGAGGAGGAAGAAATGG - Intergenic
1137388540 16:48061951-48061973 CTGAGCAGAGGAGGAAGAAGAGG - Intergenic
1137428175 16:48397520-48397542 GTATGCAAAGCAGGAAGAACTGG + Intronic
1137576195 16:49601899-49601921 GTGTGTCAAGGAGGGAGAAGAGG - Intronic
1137594120 16:49712667-49712689 GTGTGCAGGGCAAGGTGATGTGG - Intronic
1138046916 16:53734809-53734831 GTGTTCAGGGTAGGAAGAAGAGG + Intronic
1138346526 16:56323783-56323805 GTGTGGGGAGCAGGCTGAAGAGG + Intronic
1138618988 16:58197425-58197447 GTGCGCAAAGCGGGGAGAAAGGG + Intronic
1140255689 16:73334249-73334271 ACGGGCTGAGCAGGGAGAAGAGG + Intergenic
1140263791 16:73403216-73403238 TTGTGTGGAGCAGGAAGAAGGGG + Intergenic
1140929050 16:79610158-79610180 AGGAGCAGAGCAGAGAGAAGAGG - Intergenic
1141206331 16:81935705-81935727 CTGTGCAGGGAAGGGAGAACAGG - Intronic
1141434760 16:83993747-83993769 GTGTCCAGGGCCGGGAGATGGGG + Intronic
1141572902 16:84945013-84945035 GGGTGGAGAACAGGGAGCAGGGG + Intergenic
1141583968 16:85020661-85020683 GTGTGGAGGGCAAGGGGAAGCGG + Intergenic
1141713942 16:85716379-85716401 GAGAGGAGAGGAGGGAGAAGAGG + Intronic
1141953372 16:87353577-87353599 GTGGCCAGAGCAGGAAGAGGCGG + Intronic
1142438109 16:90076079-90076101 GTGTTCAGAGCAGGAAGACTGGG + Intronic
1143272684 17:5687479-5687501 GTGTGCCCAGCAGGCAGAGGGGG + Intergenic
1143280920 17:5753522-5753544 GTGAGCAGAGGAGAGAGCAGGGG - Intergenic
1143373681 17:6455305-6455327 GTGCTCAGAGCAGGGAGCGGGGG - Exonic
1143650795 17:8263371-8263393 ATGTACAGAGCATGGAGAATGGG - Intronic
1143815838 17:9514018-9514040 CTGGGGAGAGTAGGGAGAAGGGG + Intronic
1144371449 17:14595434-14595456 GTGTTCAGAGGAGGAAGAGGAGG + Intergenic
1144376715 17:14650196-14650218 TTGGTAAGAGCAGGGAGAAGAGG + Intergenic
1144686444 17:17229093-17229115 GAGTGCGGAGCAGTGAGCAGGGG + Intronic
1144767228 17:17739445-17739467 GAGGGCAGAGCAGGGAGAGATGG + Intronic
1144968752 17:19093967-19093989 GTGTGCAGGGCTAGGAGAGGGGG - Exonic
1144979164 17:19158099-19158121 GTGTGCAGGGCTAGGAGAGGGGG + Exonic
1144989058 17:19220133-19220155 GTGTGCAGGGCTAGGAGAGGGGG - Exonic
1145865779 17:28240738-28240760 GTTTCCAGGGCAGAGAGAAGTGG + Intergenic
1145955864 17:28854366-28854388 GTTTGCAAAGGAGGAAGAAGTGG - Intronic
1145993308 17:29091945-29091967 GTGGGCTGGGCAGGGGGAAGGGG + Intronic
1146367696 17:32242098-32242120 GTGTGCAGGGTAGGGAGTGGAGG - Intronic
1146487125 17:33252065-33252087 TTGTGCAGAGCATGAAGAACTGG + Intronic
1146574100 17:33976842-33976864 GTGGGCAGGGGAGGGAAAAGTGG + Intronic
1146824190 17:36009187-36009209 ATGTGCAGAGCTGGGAGGAGAGG - Intergenic
1147237923 17:39071449-39071471 GAGTGCAGAGCAGAGCAAAGGGG - Intronic
1147327822 17:39678304-39678326 GTGTAGAGAGGAGGGTGAAGTGG - Intronic
1147670554 17:42174536-42174558 GTGTGCACAGCCAGGAGAGGAGG + Intronic
1148188787 17:45664547-45664569 GATTGCAGAGTAGGGAGAGGAGG + Intergenic
1148440909 17:47711212-47711234 GTGGGCAGAACAGGGAAAGGAGG - Exonic
1150290833 17:63980658-63980680 GTGTTCAGGCCAGGGAGAAAAGG - Intergenic
1150670314 17:67190491-67190513 TTGTACAAAGGAGGGAGAAGAGG + Intronic
1151361084 17:73589407-73589429 ATTTGCAGAGCTGGGAAAAGAGG + Intronic
1151578131 17:74963069-74963091 GTGTCCCCAGCAGGGAGAAGAGG - Exonic
1151653044 17:75481686-75481708 GTGGGGAGAGCAGTGAGACGAGG + Intronic
1152251135 17:79213274-79213296 GAGTGCAGGGCAGGGAGGCGAGG - Intronic
1152367798 17:79866774-79866796 GTGTGTGGGGCCGGGAGAAGGGG - Intergenic
1152622897 17:81374056-81374078 CCCTGCAGAGCAGGGGGAAGAGG + Intergenic
1152722225 17:81928673-81928695 GTGTCCAGAGCAGGGGGAGCAGG - Intergenic
1152814316 17:82398322-82398344 GAGGGCAGAGCCGGGAGGAGGGG + Intronic
1203192769 17_KI270729v1_random:205183-205205 GCATGCAAAGGAGGGAGAAGGGG - Intergenic
1203202133 17_KI270730v1_random:4618-4640 GCATGCAAAGGAGGGAGAAGGGG - Intergenic
1153022347 18:641332-641354 GTGTGCAGAGCAGGTACATCAGG - Exonic
1153145349 18:2025414-2025436 GTTTGCTGAGAAGGGAGAGGAGG - Intergenic
1153861654 18:9216251-9216273 GGCTGAAGAGAAGGGAGAAGGGG - Intronic
1155225418 18:23725509-23725531 GTGTGCAGAGAGGGGAGTGGAGG + Intronic
1155531880 18:26775682-26775704 GCGTGGAGAGAAGGGAGAAGTGG - Intergenic
1155708377 18:28844991-28845013 GTGTGCAGAACAGAGTGAAGAGG + Intergenic
1156231707 18:35159544-35159566 GAGAGCAGGGCAGGAAGAAGAGG - Intergenic
1156291928 18:35755054-35755076 GTGTGGAGTGGAGGGAGAAGGGG - Intergenic
1157228900 18:45895026-45895048 GTGTGCATACCATGGAGAAATGG + Intronic
1157277630 18:46323022-46323044 GGCAGCAGAGCTGGGAGAAGTGG + Intergenic
1157285199 18:46372910-46372932 GTGGGAAAAGAAGGGAGAAGTGG - Intronic
1159014252 18:63088621-63088643 GGGTGGAGACCAAGGAGAAGGGG + Intergenic
1160008665 18:75087878-75087900 GTGAGCAGAGAAGGGAGGACAGG - Intergenic
1160035365 18:75296718-75296740 GTGTGCAGAGCAGGGGGACGGGG + Intergenic
1160265522 18:77338623-77338645 GAGAGAAGAGGAGGGAGAAGTGG + Intergenic
1160506470 18:79429596-79429618 GGGTGGAGAGCAGGCAGCAGCGG + Intronic
1160716726 19:580118-580140 GGGTGCAGAGCAGGGACCAGAGG + Intronic
1160739017 19:677408-677430 GAGGGCAGAGGCGGGAGAAGCGG + Intronic
1160874376 19:1290385-1290407 GTTTGCAGAGAAGGGAACAGAGG + Intronic
1160876844 19:1300410-1300432 GGGTGCAGAGCAGAGGGGAGCGG - Intergenic
1160876855 19:1300452-1300474 GGGTGCAGAGCAGAGGGGAGCGG - Intergenic
1160876866 19:1300494-1300516 GGGTGCAGAGCAGAGGGGAGCGG - Intergenic
1160876877 19:1300536-1300558 GGGTGCAGAGCAGAGGGGAGCGG - Intergenic
1161019333 19:2000614-2000636 GTGGGCAGAGGAGGCAGTAGCGG - Intronic
1161236642 19:3201585-3201607 AGGTGTAGAGCCGGGAGAAGAGG - Exonic
1161328193 19:3673342-3673364 GTGTGCCGGGCAGTGAGGAGGGG - Intronic
1161374657 19:3933323-3933345 GGGTGGAGAGGAGGGAGGAGGGG + Intronic
1161380761 19:3963918-3963940 GGCTGCAGAACAGGGAGATGTGG + Exonic
1161678692 19:5667909-5667931 ATATGCAAAGCAGGGGGAAGGGG - Intronic
1162479305 19:10919506-10919528 GTGGGCAGACCTGGGGGAAGGGG + Intronic
1163571494 19:18084863-18084885 GTCTGGAGGGCAGAGAGAAGTGG + Intronic
1163674933 19:18650916-18650938 GTGTGCACTGCAGGGAGAGGCGG + Intronic
1163779590 19:19239502-19239524 GGGAGGAGAGGAGGGAGAAGGGG - Intronic
1164639910 19:29817166-29817188 GTGTGGGGATCAGGGAGCAGGGG - Exonic
1165180173 19:33960641-33960663 TAGTGCAGTGGAGGGAGAAGTGG - Intergenic
1165380913 19:35479514-35479536 GTGGGCAGAGCACGAAGAACTGG - Intergenic
1165754165 19:38282372-38282394 TTGTGCTGAGCAGGCAGAGGTGG + Intronic
1165784198 19:38451650-38451672 TTCTGCAGAGCAGGGAGGAGGGG + Intronic
1166738229 19:45098565-45098587 GTCTGCAGGGCAGGGTGAGGGGG + Intronic
1166913616 19:46178994-46179016 GTGAGTAGAGCAGAGAGAAGAGG + Intergenic
1167124351 19:47539081-47539103 GTGGGCAGAGCTGGGAGCAGAGG - Intronic
1167744556 19:51342897-51342919 CTGGGCAGAGGAGGGAGACGGGG - Intergenic
1167771855 19:51525728-51525750 TGGTGAAGAGCAGGGAGTAGGGG - Intronic
1167904528 19:52647841-52647863 AGGTGCAGAGATGGGAGAAGAGG - Intronic
1167925823 19:52820484-52820506 GAGAGCAGAGAGGGGAGAAGAGG - Intronic
1167981423 19:53279573-53279595 GTGGGCACAGCAGAGAGATGGGG + Intergenic
1167984668 19:53304112-53304134 GTGGGCACAGCAGAGAGATGGGG - Intergenic
1168101810 19:54145374-54145396 GTGGGGAGAGGAGGGAGCAGTGG + Intronic
1168269093 19:55240033-55240055 TGGTGCAGAACACGGAGAAGGGG - Exonic
925429449 2:3778479-3778501 GTCTGCTGACCAGGGAGCAGAGG + Intronic
925948356 2:8887635-8887657 GTGTGTATATCAAGGAGAAGAGG + Intronic
925986220 2:9217322-9217344 GTCAGCAGAGCAGTGAGGAGAGG - Intronic
926985832 2:18622240-18622262 GTGGGCAGCGAAGGGAGAAATGG - Intergenic
927706328 2:25298644-25298666 GTGGGCAGAGGAGGGTGCAGGGG + Intronic
927848189 2:26482505-26482527 GTTTGCAGAGTGGGGGGAAGAGG + Exonic
928373198 2:30756116-30756138 GTTTGCAGAGCAGGGACTGGGGG - Intronic
928426962 2:31187353-31187375 GAGGGGAGCGCAGGGAGAAGGGG - Intronic
929571295 2:43024675-43024697 GTCTCCAGAGCAGGGAGCAGAGG + Intergenic
929955509 2:46455245-46455267 GTGTGCTGAGCATGTAGAAGTGG - Intronic
931907076 2:66854126-66854148 GGGTGCTGTGCAGTGAGAAGTGG - Intergenic
932412261 2:71554515-71554537 GTGTCCAGTGCAAGGAGATGGGG + Intronic
932818290 2:74878930-74878952 GTGTGCAGGGCCTGGAGATGCGG + Intronic
933343642 2:81054214-81054236 CTGTGGTGAGCAGGGAGGAGTGG - Intergenic
933665474 2:84961077-84961099 GTGTGTGGAGCAGGGAGGTGGGG - Intergenic
933707193 2:85300558-85300580 GTGTGCCAAGCAGAGAGGAGAGG - Intronic
933725946 2:85427415-85427437 CTGGGCAGATCTGGGAGAAGGGG - Intronic
933803407 2:85980932-85980954 GTGAGCAGAGCAGGGAGCAATGG - Intergenic
933987581 2:87604679-87604701 GTGGGGAAAGGAGGGAGAAGGGG - Intergenic
934732000 2:96665302-96665324 GAGTTCACAGGAGGGAGAAGGGG - Intergenic
934736789 2:96693698-96693720 CTGGGCAGAGCAAGGGGAAGAGG + Intergenic
935072112 2:99704216-99704238 ATTTTCAGAGCAGGGAGAACAGG - Intronic
935147727 2:100407543-100407565 TTCTGCATGGCAGGGAGAAGTGG + Intronic
935209947 2:100930923-100930945 GTGTGCATATTGGGGAGAAGAGG + Intronic
936075628 2:109399915-109399937 GGCTGCAGCGCAGGGAGAAATGG - Intronic
936161417 2:110086487-110086509 TTGGGCAGGGCAGGCAGAAGTGG + Intronic
936183246 2:110284867-110284889 TTGGGCAGGGCAGGCAGAAGTGG - Intergenic
936306259 2:111346129-111346151 GTGGGGAAAGGAGGGAGAAGGGG + Intergenic
937098075 2:119248577-119248599 GTGAGCAGAGCTGGAAGGAGGGG + Intronic
937154413 2:119708792-119708814 GGGTCCAGAGAAGGGAGGAGAGG - Intergenic
937465213 2:122126364-122126386 ATGTCCAGAGCAGGAGGAAGGGG - Intergenic
938118704 2:128619418-128619440 GTGTCCAGAGCAGGGAGGCGAGG - Intergenic
939257519 2:139763809-139763831 GAATGAAGAGCAGGCAGAAGGGG + Intergenic
939552354 2:143630978-143631000 GAGTGCAGAGCAGGTGGAAAGGG - Intronic
939957691 2:148540294-148540316 GCGTGCAGTGCAGGGGGAACAGG + Intergenic
940014833 2:149093125-149093147 GTTTGGAGGGCAGGGAGCAGAGG + Intronic
940103460 2:150069980-150070002 ATGTGCAGAGTTGGGAGAAGTGG - Intergenic
941173565 2:162169520-162169542 GTGTGCAGAACAGAGAGAGAAGG + Intergenic
942835500 2:180291936-180291958 GAATGCAGAGCAGGGTGAAGTGG + Intergenic
943516852 2:188899378-188899400 ATCTTCAGAGCAGGAAGAAGGGG + Intergenic
944311123 2:198235083-198235105 ATGGGGAGAGCAGGGACAAGAGG + Intronic
944593893 2:201244412-201244434 GGGTACAGAGGAGGGAGAAGTGG - Intronic
945267347 2:207903357-207903379 GTGGGCAGTGGAGGGAGTAGCGG + Intronic
945828716 2:214757029-214757051 GTGGTCAGAGCAGGAGGAAGAGG - Intronic
945975183 2:216264947-216264969 ATTTGTAGAGCAGGGAGCAGAGG - Intronic
946059063 2:216926212-216926234 GTGTGCAGAGTTGGAGGAAGGGG + Intergenic
946409584 2:219509453-219509475 GTGTGCAGAGACGGGAGAACTGG + Intergenic
947384416 2:229576983-229577005 GGGTCCAGACCACGGAGAAGGGG + Intronic
947521046 2:230846313-230846335 GTGTTCAGAGGAGGTAGAACAGG - Intergenic
948154537 2:235770816-235770838 GTGTGGTGAGCAGGAAGATGGGG + Intronic
948467309 2:238158666-238158688 GGGTCCAGGGCTGGGAGAAGGGG + Intergenic
949058305 2:241941892-241941914 GTGAGCAGAGCAGGCAGACGTGG - Intergenic
1168835655 20:875665-875687 GTGTGCAGAGCAGTGTCACGGGG + Intronic
1169784215 20:9341557-9341579 GTAAGCAGAGGAGGAAGAAGAGG + Intronic
1169829775 20:9811490-9811512 GTGAGAACAGAAGGGAGAAGTGG + Intronic
1170063594 20:12286565-12286587 TTGTGCACAGCAGGCAGAAAGGG - Intergenic
1171184088 20:23112311-23112333 GTGTGCGGAGCAGGGAGGAGAGG - Intergenic
1171249001 20:23634627-23634649 GGGTGCTGGGCAGGGAGAAAGGG - Intronic
1171255508 20:23686589-23686611 GGGTGCTGGGCAGGGAGAAGGGG - Intronic
1171262852 20:23748514-23748536 GTGTGCTGGGCAGGGAGAAGGGG - Intronic
1171265708 20:23770979-23771001 GGGTGCTGGGCAGGCAGAAGGGG - Intergenic
1171266128 20:23773486-23773508 GGGTGCTGGGCAGGGAGATGGGG - Intergenic
1171271979 20:23824718-23824740 GTGTGCTGGGCAGGGAGAAGGGG - Intronic
1171275452 20:23853413-23853435 GGGTGCTGGGCAGGGAGAAGGGG - Intergenic
1171283355 20:23919136-23919158 GGGTGCAGGGCAGGGGGAGGTGG + Intergenic
1171300079 20:24052416-24052438 CAGGGCAGAGCAGGGAGATGAGG - Intergenic
1172010348 20:31842815-31842837 GTGTGCAGGGCATGGTGAGGAGG - Intergenic
1172807079 20:37619714-37619736 GTGAGCAGGGCAAGGAGGAGTGG + Intergenic
1173020668 20:39265354-39265376 TTGTGAAGTGCAGGGAGATGAGG + Intergenic
1173856950 20:46256434-46256456 GTGCACAAAGCTGGGAGAAGAGG + Intronic
1173875158 20:46365720-46365742 GTGTCCCTGGCAGGGAGAAGAGG + Intergenic
1174415202 20:50361386-50361408 GGGTGCAGGGCAGGGAAGAGAGG + Intergenic
1174557781 20:51408051-51408073 GTGTCCAGGGGAGGGAGAGGTGG + Intronic
1174881469 20:54283899-54283921 CTGCTCAGAGCAGGGAGCAGAGG + Intergenic
1175198477 20:57262672-57262694 CTCTGCAGTGCAGGGCGAAGGGG + Intronic
1175348010 20:58296597-58296619 GTGTGCAGAGCCAGGGGATGGGG - Intergenic
1175392633 20:58636726-58636748 GTGGGAAGAGCAGGGAGGGGAGG - Intergenic
1175455901 20:59113649-59113671 GTGAGCATAGCAGTGAGAACAGG + Intergenic
1176075283 20:63245482-63245504 GTGTGCAGGGCGGGGAGCATGGG - Intronic
1178092927 21:29183420-29183442 GGGTGCAGAGCAGGGTGAATGGG + Intergenic
1178239173 21:30879720-30879742 ATGTGCAGGGAAGGGAGCAGTGG - Intergenic
1178266870 21:31151530-31151552 GGGAGCAGAGCATGGAGCAGGGG + Intronic
1178920052 21:36732860-36732882 GTGTGAAGAGCAGAGTGGAGGGG + Intronic
1179145729 21:38765867-38765889 GTGGGGAGAGCAGGAAGATGTGG + Intergenic
1179151581 21:38813406-38813428 CAGGGCAGAGCAGGGAGATGAGG - Intronic
1179443267 21:41410978-41411000 GCATCCAGGGCAGGGAGAAGGGG + Intergenic
1179708084 21:43194038-43194060 GGGTGCAGAGCAGGGCCTAGAGG - Intergenic
1179947922 21:44691091-44691113 GTGTGGAGAGAGGAGAGAAGGGG - Intronic
1180631558 22:17233629-17233651 ATGTTCAGTGCAGGGAGCAGAGG - Intergenic
1180847890 22:18994351-18994373 CTGCGTAGAGAAGGGAGAAGAGG - Intergenic
1181079272 22:20403166-20403188 TTGCACAGAGCAGAGAGAAGAGG - Intronic
1181724198 22:24800099-24800121 GTGGGCAGAGCCAAGAGAAGTGG - Intergenic
1181728081 22:24825386-24825408 GTGAGCACAGCGGGGAGAAGAGG - Intronic
1182033013 22:27174897-27174919 GGGCACAGAGCAGGGAGAAGAGG + Intergenic
1182667457 22:31970334-31970356 GTGTGAAGAGCAGCGGGATGCGG + Intergenic
1183016702 22:34994430-34994452 GGGGACTGAGCAGGGAGAAGAGG - Intergenic
1183177727 22:36236922-36236944 GTGAACAAAGCAGGAAGAAGGGG - Intronic
1183442653 22:37831946-37831968 AGATGCAGAGCATGGAGAAGAGG - Exonic
1183467063 22:37985131-37985153 GTCTGCAGAGAAGGGACCAGGGG - Intronic
1183546655 22:38457750-38457772 GTGTGGGGTGCAGGGAGAGGAGG + Intergenic
1183596671 22:38816836-38816858 GTGTGCAGAGCTGGGAGTGGAGG + Intergenic
1183724700 22:39582033-39582055 TTGTGCAGAGCCGTGGGAAGAGG + Intronic
1183749642 22:39712547-39712569 GGGTGCAGAGGATGCAGAAGGGG + Intergenic
1184059576 22:42073979-42074001 GTGGGCCGAGCAGGGAGAGGGGG + Intergenic
1184460548 22:44635307-44635329 GGGGGCATGGCAGGGAGAAGGGG + Intergenic
1184747485 22:46464747-46464769 AGGTGCAGAGGAGGTAGAAGGGG - Intronic
1184961720 22:47934061-47934083 GTGTGGTGAGCAGTGAGCAGAGG + Intergenic
1185006001 22:48277339-48277361 GCGTGCAGGGCAGGCTGAAGGGG - Intergenic
1185102706 22:48850249-48850271 GTGTGCAAAGGAGGGAGGTGAGG + Intronic
1185105969 22:48870060-48870082 GTGGACAGGGCAGAGAGAAGGGG - Intergenic
1185152248 22:49170646-49170668 GTGTGCTGAGCTGAGAGGAGCGG + Intergenic
949282666 3:2364423-2364445 GTTGGCACAGCAGGGAGAAAGGG + Intronic
949571846 3:5301151-5301173 GTGTGCGGAGCAGGGAGTGATGG - Intergenic
949576283 3:5341957-5341979 GTGTGCAGAGAACAGAGAATTGG - Intergenic
950273561 3:11639449-11639471 GGCTTCAGAGCAAGGAGAAGTGG + Intronic
951568201 3:24034281-24034303 GGGAGGAGAGCAGAGAGAAGGGG + Intergenic
951913884 3:27779107-27779129 GTGTGTTGAGGAGGAAGAAGAGG + Intergenic
952690058 3:36194913-36194935 ATGTGGAGAGCAAGGAGAAGAGG - Intergenic
953787265 3:45920640-45920662 GTGGGCTGAGCAGTGGGAAGTGG + Exonic
953856295 3:46501815-46501837 ATGTGCAGAGCAGGGGAAATTGG - Intergenic
954534519 3:51349150-51349172 GTGCTCAGAGAAGGGAGAAGTGG + Intronic
954798664 3:53174597-53174619 CTGTGCAGAGCAGGGACTTGTGG + Intronic
955147256 3:56332035-56332057 GGGAGCAGAGCAGGGAGAGTGGG + Intronic
955566255 3:60250023-60250045 GTGTCAAGAGCAGGGACAGGTGG - Intronic
955977436 3:64491924-64491946 GAGTACAGAGCAGGGAGATAGGG - Intergenic
956084767 3:65597607-65597629 GTGTGTGGACCAGGGAGGAGGGG - Intronic
957053996 3:75430652-75430674 CAGTGCAGGGCAGGAAGAAGGGG - Intergenic
957610018 3:82453838-82453860 ATGGCTAGAGCAGGGAGAAGGGG - Intergenic
957755187 3:84476048-84476070 GTCTGAGGAGCAGGAAGAAGAGG + Intergenic
958787661 3:98615292-98615314 GTTTGTGGAGCAGGTAGAAGAGG + Intergenic
959280913 3:104338044-104338066 GTGATCAGAGCAGGAAGAAAAGG + Intergenic
960845912 3:122004561-122004583 GTGCCCAGTGCAGGGAGTAGTGG - Intronic
960865204 3:122192843-122192865 GTGAGAAGAGCAGAGAAAAGAGG - Intronic
960874532 3:122283916-122283938 AGCAGCAGAGCAGGGAGAAGAGG - Exonic
961001898 3:123379568-123379590 CTGTGAAGTGCAGGGAGCAGTGG + Intronic
961478144 3:127161380-127161402 GAGTGGAGAGCAGACAGAAGGGG - Intergenic
961561404 3:127732914-127732936 CTGAGCAGAGCTGGGAGGAGCGG + Intronic
961887666 3:130107029-130107051 CAGTGCAGGGCAGGAAGAAGGGG - Intronic
962162648 3:133015147-133015169 GGCTGAAGAGCAGGAAGAAGAGG - Intergenic
962392454 3:134984399-134984421 GGCTTCAGAGAAGGGAGAAGTGG + Intronic
962461912 3:135621902-135621924 ATGTGCAGAGGAGGGTGGAGGGG - Intergenic
962605225 3:137027161-137027183 GTGTGCAAATCAGGAAGAAAGGG + Intergenic
963909244 3:150800873-150800895 ATGAGCAGGGCAGGGAGAACTGG + Intergenic
964047076 3:152341777-152341799 GTGTACAGAGCAGCTAAAAGAGG + Intronic
964407808 3:156367727-156367749 GCATGCAAGGCAGGGAGAAGGGG - Intronic
964449032 3:156792160-156792182 GGGTGCCAAGCAGGGAGAATTGG - Intergenic
965165985 3:165194997-165195019 GGGGGCACAGCAGGGAGAAAGGG - Intronic
965390948 3:168102861-168102883 GTGTGCTTAGCAGAGACAAGTGG - Intergenic
966245609 3:177804668-177804690 ATGAGCAGAGCAGGGAGCAGGGG + Intergenic
966571655 3:181450807-181450829 CTGTGAAGAGCAAGGAGCAGAGG - Intergenic
967619017 3:191609170-191609192 GTGTCCACAGGAGTGAGAAGAGG - Intergenic
968074817 3:195810518-195810540 GTGTACAGAGCTGGGAGGGGAGG - Intronic
968074900 3:195810869-195810891 GTGTACAGAGCTGGGGGTAGAGG - Intronic
968168366 3:196487488-196487510 GTTGGCAGAGGAGGAAGAAGAGG - Exonic
968441553 4:626943-626965 GGGTGCAGGACAGGGAGAAGGGG - Intronic
968919833 4:3516825-3516847 GTCAGCAGAGGAGGGAGCAGGGG - Intronic
969130569 4:4987980-4988002 GTGGGCAGAGAAGGGAAGAGTGG - Intergenic
969133005 4:5005447-5005469 TTCTGCAGAGAAGGGAGGAGGGG - Intergenic
969554957 4:7901214-7901236 GCGTGCCTAGCAGGGAGATGGGG + Intronic
969637903 4:8379975-8379997 GCCTGCAGAGGAGGGAGCAGTGG + Intronic
970098222 4:12489002-12489024 GTGAGCAGTGAACGGAGAAGAGG - Intergenic
970287346 4:14532623-14532645 GAGTGAAGAGCAGGTTGAAGAGG + Intergenic
970502697 4:16694342-16694364 GTGTGGAGAGAAGGGGGAGGAGG - Intronic
970535988 4:17030210-17030232 GTGTCAAGAGCAGGGCCAAGTGG - Intergenic
971034448 4:22677789-22677811 CTGGGAAGAGTAGGGAGAAGAGG - Intergenic
971748187 4:30611839-30611861 GTGGCCAGAGCAGGAGGAAGGGG - Intergenic
972094203 4:35328013-35328035 GGGTGGAGGGCAGGGAGGAGAGG - Intergenic
972775660 4:42237659-42237681 GAGTGCAGAGCAGGGAGTGAGGG - Intergenic
974354867 4:60798405-60798427 GTATACAGAGGATGGAGAAGAGG - Intergenic
974699718 4:65425339-65425361 GTGTGCATAGCAGTGAGAAGTGG - Intronic
976127251 4:81846977-81846999 GTATTAAGAGCAGGGAGAGGTGG + Intronic
976260045 4:83136765-83136787 GTGTGAAGGGCCTGGAGAAGTGG - Intronic
976594091 4:86878244-86878266 GAGTGCAGAGACTGGAGAAGGGG - Intronic
976803416 4:89019012-89019034 GGCTGCAGAGAAGTGAGAAGAGG + Intronic
977366498 4:96075487-96075509 GTGTGTGTGGCAGGGAGAAGTGG - Intergenic
977706397 4:100075674-100075696 GGGTTCAGAGGAGGGAGAAACGG - Intergenic
978323284 4:107522041-107522063 ACCAGCAGAGCAGGGAGAAGAGG + Intergenic
980664005 4:135904532-135904554 GTGTGGAGAGTAGGGGCAAGAGG + Intergenic
981099558 4:140815332-140815354 TTGTGCAGAGGAGGGCGAAAAGG - Intergenic
981225622 4:142290521-142290543 GTGAGCAGTGCATGGAGGAGAGG - Intronic
981991229 4:150923297-150923319 GGATGGAGTGCAGGGAGAAGGGG - Intronic
982607572 4:157534284-157534306 GTGAGGAAAGGAGGGAGAAGTGG - Intergenic
982682848 4:158452854-158452876 GTGGGCAGGGCAGGGGGAAGTGG - Intronic
982690563 4:158543308-158543330 ATGTTCAAAGCAGGAAGAAGGGG + Intronic
982702425 4:158671730-158671752 GTCTGAAGAGGAGGGAGAAGAGG + Exonic
983689393 4:170450255-170450277 ATGTACAGACCAGAGAGAAGTGG - Intergenic
984443568 4:179804713-179804735 CTGTGCAGAGCAGACAGGAGTGG - Intergenic
984693934 4:182760177-182760199 GTGTGAAGAGCAGCATGAAGCGG - Intronic
984807894 4:183768215-183768237 GTGTGAAGAGCAGGTGGAGGAGG + Intergenic
985632690 5:1022186-1022208 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632702 5:1022227-1022249 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632712 5:1022268-1022290 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632724 5:1022309-1022331 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632734 5:1022350-1022372 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632746 5:1022391-1022413 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632756 5:1022432-1022454 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632768 5:1022473-1022495 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632780 5:1022515-1022537 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632790 5:1022556-1022578 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632802 5:1022597-1022619 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632814 5:1022638-1022660 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632824 5:1022679-1022701 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632836 5:1022721-1022743 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632848 5:1022762-1022784 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632860 5:1022804-1022826 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632870 5:1022845-1022867 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632882 5:1022887-1022909 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985632894 5:1022928-1022950 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632903 5:1022969-1022991 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632915 5:1023010-1023032 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632927 5:1023051-1023073 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632937 5:1023092-1023114 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632947 5:1023133-1023155 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632959 5:1023174-1023196 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632969 5:1023215-1023237 GTGGGAAGAGCAGGGACAATGGG - Intronic
985632981 5:1023256-1023278 GTGGGAAGAGCAGGGACAACGGG - Intronic
985632993 5:1023297-1023319 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633003 5:1023338-1023360 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633015 5:1023379-1023401 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633027 5:1023420-1023442 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633037 5:1023461-1023483 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633055 5:1023543-1023565 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633067 5:1023584-1023606 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633077 5:1023625-1023647 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633087 5:1023666-1023688 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633108 5:1023748-1023770 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633118 5:1023789-1023811 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633130 5:1023830-1023852 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633142 5:1023871-1023893 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633152 5:1023912-1023934 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633162 5:1023953-1023975 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633174 5:1023994-1024016 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633186 5:1024035-1024057 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633196 5:1024076-1024098 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633208 5:1024117-1024139 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633218 5:1024158-1024180 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633228 5:1024199-1024221 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633238 5:1024240-1024262 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633248 5:1024281-1024303 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633260 5:1024322-1024344 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633270 5:1024363-1024385 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633282 5:1024404-1024426 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633292 5:1024445-1024467 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633304 5:1024486-1024508 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633316 5:1024527-1024549 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633326 5:1024568-1024590 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633336 5:1024609-1024631 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633348 5:1024650-1024672 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633360 5:1024691-1024713 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633370 5:1024732-1024754 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633380 5:1024773-1024795 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633392 5:1024814-1024836 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633400 5:1024855-1024877 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633412 5:1024896-1024918 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633420 5:1024937-1024959 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633430 5:1024978-1025000 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633440 5:1025019-1025041 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633452 5:1025060-1025082 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633462 5:1025101-1025123 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633474 5:1025142-1025164 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633482 5:1025183-1025205 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633492 5:1025224-1025246 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633502 5:1025265-1025287 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633512 5:1025306-1025328 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633522 5:1025347-1025369 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633532 5:1025388-1025410 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633542 5:1025429-1025451 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633552 5:1025470-1025492 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633562 5:1025511-1025533 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633572 5:1025552-1025574 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633582 5:1025593-1025615 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633594 5:1025634-1025656 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633604 5:1025675-1025697 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633616 5:1025716-1025738 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633626 5:1025757-1025779 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633639 5:1025798-1025820 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633649 5:1025840-1025862 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633661 5:1025881-1025903 GTGGGAAGAGCAGGGACAACGGG - Intronic
985633673 5:1025922-1025944 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633683 5:1025963-1025985 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633693 5:1026005-1026027 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633705 5:1026046-1026068 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633715 5:1026087-1026109 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633728 5:1026128-1026150 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633740 5:1026169-1026191 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633750 5:1026210-1026232 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633759 5:1026252-1026274 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633771 5:1026293-1026315 GTGGGAAGAGCAGGGACAAAGGG - Intronic
985633792 5:1026375-1026397 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633804 5:1026416-1026438 GTGGGAAGAGCAGGGAAAAAGGG - Intronic
985633822 5:1026498-1026520 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633834 5:1026539-1026561 GTGGGAAGAGCAGGGACAATGGG - Intronic
985633846 5:1026580-1026602 GTGGGAAGAGCAGGGACAATGGG - Intronic
985636644 5:1038953-1038975 GAGTGCAGACCAGTGAGGAGGGG + Intergenic
985822732 5:2170943-2170965 GTGTTGAAAGGAGGGAGAAGAGG + Intergenic
986260351 5:6140224-6140246 GAGTGCAGAGCAGGGCCAGGTGG - Intergenic
986799560 5:11245500-11245522 CTGTGCTGAGCATGGAGGAGGGG + Intronic
987862989 5:23508845-23508867 GTGTTCAGAGCAGGAAGATGTGG - Intronic
988549307 5:32185857-32185879 GGGAGCAGGGGAGGGAGAAGGGG - Intergenic
988898752 5:35708474-35708496 GTGTACGGAGCAGGTATAAGGGG - Intronic
989267204 5:39489594-39489616 GTTTGGAGGGCATGGAGAAGGGG - Intergenic
989297281 5:39844354-39844376 CTGTGAAGGGTAGGGAGAAGTGG - Intergenic
990199608 5:53356639-53356661 TTATGCTGAGCAGGAAGAAGTGG - Intergenic
990215640 5:53528976-53528998 GTGAGCAGGGCTGGGAGCAGTGG - Intergenic
990533681 5:56698918-56698940 GTAAGGAGAGCAGGGAGAATGGG + Intergenic
991603479 5:68376944-68376966 AAGTGCAGAGCAGGAAGAAGAGG - Intergenic
992085555 5:73275159-73275181 ATGTGGAGGGCAGGGAGATGGGG + Intergenic
994100221 5:95883325-95883347 GTGTGGAGAGTAGGAGGAAGAGG + Intergenic
995771135 5:115671685-115671707 GTGTGAAGAGTAGTGAAAAGTGG + Intergenic
995774291 5:115709243-115709265 GACTGCTGAGAAGGGAGAAGAGG - Intergenic
996824776 5:127669760-127669782 ATGTGAAGAGCAAGGAGTAGGGG + Intergenic
996944540 5:129050671-129050693 GTGTGAAGATGAGGGAGAGGAGG + Intergenic
997230511 5:132239070-132239092 GGGCGCAGAGCAGGGGAAAGAGG - Intronic
997251418 5:132391600-132391622 GTTTGAGGAGGAGGGAGAAGGGG + Intronic
997390603 5:133511842-133511864 GTGGGTGGAGCAGGCAGAAGGGG + Intronic
997419286 5:133753212-133753234 AGATGCAGAGCAGGGAGCAGAGG - Intergenic
997442608 5:133919234-133919256 GTGTGCAGACCAGGGAATAGCGG + Intergenic
997587864 5:135054457-135054479 GTGTGTACAGCAGGGTGAACCGG + Intronic
997782635 5:136675446-136675468 GTGAGCACACCAGAGAGAAGGGG + Intergenic
997960366 5:138316221-138316243 GTGCCAAGAGCAGAGAGAAGTGG - Intronic
998808212 5:145939333-145939355 CTCTTCAGAGCAGGGAGATGTGG - Intronic
998937920 5:147250369-147250391 GTGTGGAGACCAAGGAGAAGAGG + Intronic
999247813 5:150164650-150164672 GTACACAGAGGAGGGAGAAGAGG - Intergenic
1000064134 5:157680636-157680658 GTCTGGAGAGCAGGCAGAACAGG - Intergenic
1001433285 5:171680405-171680427 GGGTGTAGAGAAGAGAGAAGTGG - Intergenic
1001981060 5:176037313-176037335 GGGTGGCGAGCAGGGAGAAAAGG + Intergenic
1002236401 5:177806753-177806775 GGGTGGCGAGCAGGGAGAAAAGG - Intergenic
1002570306 5:180136273-180136295 GTGTGCAGGGTGGGGAGATGAGG + Intronic
1002785598 6:397371-397393 GTGTGCAGCTCGGGGAGAGGGGG + Intronic
1003130812 6:3393907-3393929 GTGTGGAGTGCAGGGAGAGGAGG - Intronic
1003468930 6:6410300-6410322 GGGAGCAGAGCTGGGAGATGAGG - Intergenic
1003556660 6:7146020-7146042 GTGCGCAGAGCAGGAAGGAGAGG - Intronic
1003569825 6:7248440-7248462 CTGTGCAGAGCAGGGTGCAGTGG + Intronic
1004140173 6:13010889-13010911 GGGTACAGAGCAGGGTCAAGAGG + Intronic
1004194822 6:13493974-13493996 CAGTGCAGCGCAGGGAGCAGGGG - Intergenic
1004813549 6:19287359-19287381 GTTTGCAGAGCACGGTGAAATGG - Intergenic
1005110917 6:22280584-22280606 GACTGCACAGCAGGCAGAAGGGG + Intergenic
1006288595 6:33116934-33116956 CTGTGAAGAGCAGGGAGAGATGG - Intergenic
1006380032 6:33692057-33692079 GTGTGGAAAGCAGGGAAAAGTGG - Intronic
1006914308 6:37584822-37584844 GAGCACAGAGAAGGGAGAAGGGG - Intergenic
1006934061 6:37705346-37705368 GTGTGAGGAGAAAGGAGAAGGGG + Intergenic
1007319157 6:41013988-41014010 GAGTGCAGAGGAGGGAGCACTGG + Intergenic
1008228884 6:48959027-48959049 GTTTGCAGTATAGGGAGAAGAGG + Intergenic
1008480296 6:51978746-51978768 ATGTGCAGATGAGGAAGAAGAGG - Intronic
1008748785 6:54707269-54707291 CTGTCCAGTGCAGGGAAAAGAGG + Intergenic
1009029184 6:58036127-58036149 GTAAGAAGAGCAGAGAGAAGTGG + Intergenic
1009204517 6:60785931-60785953 GTGAGAAAAGCAGAGAGAAGTGG - Intergenic
1009204725 6:60787525-60787547 GTGAGAAGAGCAGAGAGAAGTGG + Intergenic
1010184153 6:73123465-73123487 CTGTGCAGGGCAGAGAGAAATGG + Intronic
1010275645 6:73965800-73965822 GTTTGGAGAGGAGGGTGAAGAGG + Intergenic
1011899549 6:92275253-92275275 GTGGGCAGAGGGAGGAGAAGAGG - Intergenic
1012150545 6:95745297-95745319 GTGAGCAGAGCGGAGAGAACTGG - Intergenic
1012261873 6:97096823-97096845 GTAAGCAGAGCAGTGAGACGGGG + Intronic
1012593811 6:101016891-101016913 TTAGGCAGAACAGGGAGAAGAGG + Intergenic
1012955263 6:105563162-105563184 GTGTGCAGAGCCAAGAGAAAGGG - Intergenic
1013064108 6:106666780-106666802 CTGAGCAGAGCAGGTGGAAGAGG + Exonic
1013272809 6:108559440-108559462 GTGGGGAGAGGAGGGAGAAGGGG - Intergenic
1013326713 6:109053074-109053096 GTGTGCACAGCAGGGAATTGGGG + Intronic
1014392002 6:120874324-120874346 GTGAGCAGGGCAGGGAAGAGCGG - Intergenic
1014764500 6:125391152-125391174 AGGTGCAGAGAAGGGAGAGGAGG + Intergenic
1015123519 6:129727153-129727175 GTGTGCACAGCAGAGGAAAGGGG - Intergenic
1015353231 6:132247211-132247233 GTGTGCAGAGCTTGGAGAAGAGG + Intergenic
1015519156 6:134114254-134114276 GTGTGCAGAGCAGGAGGCAGAGG + Intergenic
1016434747 6:144024383-144024405 GTGTCAAGAGCAGGGACAGGTGG + Intronic
1016878601 6:148888178-148888200 GTGGCCAGAGCAGGAACAAGAGG + Intronic
1016882463 6:148924279-148924301 GTGAGCAGGGCAGGGACGAGGGG - Intronic
1017039516 6:150296434-150296456 GTGTGCAGAGCAGGGGAGCGTGG + Intergenic
1017095517 6:150801246-150801268 GTATGGAGAGCAAAGAGAAGGGG + Intronic
1017329274 6:153176823-153176845 GTGGACAGAGCCGAGAGAAGAGG + Intergenic
1017389790 6:153925652-153925674 ATGTGTAGGGCAGGGAGGAGGGG - Intergenic
1018159775 6:161027846-161027868 GGCTGCAGAGCAGGGACAAATGG + Intronic
1018198629 6:161376212-161376234 GTGTGGGGAGCATGGATAAGGGG + Intronic
1018381759 6:163264380-163264402 GTGTGTAGAGCAGTGCGCAGTGG - Intronic
1018471253 6:164100464-164100486 GTGTGGAGACCAGGGAGCAGGGG - Intergenic
1018549665 6:164981298-164981320 ATGCACAGAGCAGAGAGAAGGGG + Intergenic
1018671036 6:166177689-166177711 GTGAGGTGGGCAGGGAGAAGGGG + Intergenic
1018972060 6:168536662-168536684 GTGTGGAGAGAGGGGAGATGAGG + Intronic
1019109801 6:169700832-169700854 GTTGGCACAGCAGGGAGAGGAGG - Intronic
1019349753 7:549228-549250 GTATTCAGAGCAGAGATAAGGGG + Exonic
1019641509 7:2106106-2106128 GTGTGCTGGGCAGGGTGGAGGGG - Intronic
1020125936 7:5532497-5532519 ATCTGCAGAGCAGGGATGAGAGG + Intronic
1020650360 7:10867635-10867657 TGGTGCAGATCAGGGAGGAGTGG - Intergenic
1020856278 7:13428683-13428705 GTGGGAAGAGCAGGAGGAAGAGG + Intergenic
1021198365 7:17697825-17697847 ATGTGCAGAGTAGGCAGAGGTGG - Intergenic
1021477160 7:21075267-21075289 GTTTACAGAGCAGGTAGATGGGG - Intergenic
1022527407 7:31047270-31047292 GTGTGCAGAAGATGGAGGAGAGG + Intergenic
1022761896 7:33364638-33364660 GAGTGGAGAGGAGGGGGAAGGGG - Intronic
1023184002 7:37514652-37514674 GCGTGCAGTGCAGCAAGAAGGGG - Intergenic
1023612133 7:41981804-41981826 CTGAGCAGAGAAGGGAGAACTGG + Intronic
1024575071 7:50756564-50756586 GGGTGCAGAGCAGGCAGACCTGG + Intronic
1025198734 7:56949520-56949542 GAGTGGGGAGGAGGGAGAAGAGG - Intergenic
1025255286 7:57380797-57380819 GTGTGCAGGGCAGGGAAGACAGG - Intergenic
1025673214 7:63627411-63627433 GAGTGGGGAGGAGGGAGAAGGGG + Intergenic
1025724654 7:64045642-64045664 GTGTCCCGAGAAGGGGGAAGAGG + Intronic
1025978675 7:66390012-66390034 GTGGGCAGAGAAGGGGGAGGTGG - Intronic
1026147535 7:67760323-67760345 ATGACCAGAGCAGGAAGAAGAGG - Intergenic
1026304132 7:69125219-69125241 ATGTTAAGAGCAGGGGGAAGGGG + Intergenic
1026470822 7:70693440-70693462 GTGTGAGGAGCTGGGAGGAGAGG + Intronic
1026835187 7:73634008-73634030 GTGAGAAGAGGATGGAGAAGCGG + Intergenic
1026844414 7:73689950-73689972 GTGTGTACAGCAGGGCGGAGGGG + Intronic
1026903153 7:74048064-74048086 GAGGGCAGAGCAGGGGGAGGGGG + Intronic
1027204262 7:76084715-76084737 GTGGGCAGAGAAGGGGGAGGTGG - Intergenic
1027549580 7:79574209-79574231 GTGAGAAGAGCTGTGAGAAGAGG + Intergenic
1028478395 7:91276439-91276461 GGGAGAAGAACAGGGAGAAGAGG - Intergenic
1028668801 7:93377145-93377167 GTTTGGAGTGAAGGGAGAAGGGG + Intergenic
1029090107 7:98041164-98041186 GTCTGCAGAGCAGTGATCAGGGG - Intergenic
1029283314 7:99450408-99450430 GTGGGCAGAGAAGGGAGGACTGG - Intronic
1029726349 7:102408167-102408189 GTGTTCAAAGCAAGAAGAAGGGG + Intronic
1029957171 7:104652249-104652271 GTGTGTAGAGTATGGAGAAAGGG + Intronic
1031123433 7:117747032-117747054 GTGTGCTGGGCAGGGTGCAGGGG - Intronic
1031806534 7:126314707-126314729 GTGTGGAGAGAAAGGAGAGGAGG - Intergenic
1032398265 7:131606279-131606301 TCCTGCAGAGAAGGGAGAAGAGG - Intergenic
1032709832 7:134451792-134451814 GTCTGCACAGCAAGGAGGAGGGG + Intronic
1032731065 7:134643423-134643445 GAGTGGAGAGCAGGAAAAAGAGG + Intergenic
1032913252 7:136458472-136458494 GTGTGCATTGCAAGGAGAATTGG - Intergenic
1033359200 7:140626239-140626261 GTGTGCAGGGGACGGAGAAGGGG - Intronic
1033536915 7:142320905-142320927 CTGTGCAGAACAGAGAGCAGTGG + Intergenic
1034165607 7:149022794-149022816 CTGTGCCGGGCAGGGAGAAGGGG + Intronic
1034219027 7:149430288-149430310 GTGGCCAGAGGAGGGAGCAGAGG - Intergenic
1034282191 7:149862169-149862191 TTTTGCAGAGCATGGAGAACGGG - Exonic
1034447003 7:151118856-151118878 TGGTGGAGAGCAGAGAGAAGTGG - Intronic
1034867692 7:154656173-154656195 GGGGGGAGAGCTGGGAGAAGGGG + Intronic
1034867705 7:154656212-154656234 GGGGGGAGAGCTGGGAGAAGGGG + Intronic
1034867718 7:154656251-154656273 GGGGGGAGAGCTGGGAGAAGGGG + Intronic
1034867755 7:154656368-154656390 GGGGGGAGAGCTGGGAGAAGGGG + Intronic
1034908694 7:154973894-154973916 GTGTCCAGAACAAGGTGAAGCGG + Intronic
1035196514 7:157225825-157225847 TTTTGCAGAGCAGGGACAACAGG - Intronic
1035389718 7:158496680-158496702 GGGTGCAGGGAAGGGGGAAGGGG - Intronic
1035394386 7:158525790-158525812 GTGAGCACAGCAGAGAGAGGTGG - Intronic
1035513225 8:207920-207942 TTGTGCTTAGGAGGGAGAAGAGG - Intergenic
1035598441 8:880168-880190 AAGTGCAGTGGAGGGAGAAGGGG - Intergenic
1036124135 8:6047666-6047688 CTGTGCAGAGGAGGGAGACTGGG + Intergenic
1036733717 8:11288593-11288615 ATGTGCAGAGAAGAGCGAAGAGG + Intronic
1037438173 8:18886767-18886789 GTGTGCAGTGCAGGGCAAAAGGG - Intronic
1037501875 8:19494411-19494433 GTGTACAGAACAGAGAGAATTGG - Intronic
1037525506 8:19720418-19720440 GAGTTCAGAGGAGGGAGAAATGG + Intronic
1037525672 8:19721564-19721586 GAGTTCAGAGGAGGGAGAAATGG + Intronic
1037736650 8:21572287-21572309 GGGTGCCGAGCAAGGAGAATCGG + Intergenic
1037854967 8:22365421-22365443 AAGTGGAGAGCAGAGAGAAGTGG + Intergenic
1037898188 8:22672215-22672237 AGGTACAGAGTAGGGAGAAGTGG - Intergenic
1038060694 8:23908624-23908646 TTGTGCAGAGGCTGGAGAAGAGG + Intergenic
1038319485 8:26514115-26514137 GTGGGCAGGGAGGGGAGAAGCGG + Intergenic
1038428431 8:27480630-27480652 GCTTGGAGAGCAGGGAGAAGAGG + Intergenic
1039011018 8:33092851-33092873 ATGTGCAGGGGAGGGAGAAGAGG + Intergenic
1039436231 8:37561238-37561260 ATGTTCAGAGCAGGGACAATGGG + Intergenic
1039663054 8:39488002-39488024 GTGTGATGAGCAAGGAGAAAGGG + Intergenic
1039823467 8:41154114-41154136 GTGTGCAGAGCTAAGGGAAGAGG + Intergenic
1039911801 8:41832459-41832481 GTGGGCAGGGCATGGAGGAGGGG - Intronic
1040024647 8:42770567-42770589 GGGTGCAGAGCAGGAGGATGGGG + Intronic
1041612377 8:59866684-59866706 GTGAGCTGAGGAGGAAGAAGAGG + Intergenic
1041645730 8:60250443-60250465 GTTTGGAGATCAGGGAAAAGAGG - Intronic
1042807150 8:72783395-72783417 GTTTGAAGAACAGAGAGAAGAGG - Intronic
1044740425 8:95320985-95321007 GTATGCAGAGCACAGAGAAAAGG + Intergenic
1045884877 8:107084038-107084060 GTGAACAGAGCAGGGAGCAAAGG + Intergenic
1045946798 8:107805432-107805454 GAGAGCAGAGCAGAGAGCAGCGG - Intergenic
1046502621 8:115097730-115097752 GAGGGCAGAGGAGGAAGAAGAGG + Intergenic
1046890483 8:119416365-119416387 GGCTGCAGTGCAGGGAGGAGGGG - Exonic
1047005033 8:120611285-120611307 GAGTGCAGAAGAGGGAGAAAAGG + Intronic
1047520336 8:125591114-125591136 GAGTGCAGCTCAGGGAAAAGAGG - Intergenic
1048160447 8:132016043-132016065 GAGTGCAGACTAGGGACAAGAGG - Intergenic
1048467903 8:134682798-134682820 GTGTGCAGAGTGGGGAAAAAGGG - Intronic
1048803089 8:138212380-138212402 CTCTTCAGAGCAGGGAAAAGCGG - Intronic
1048878420 8:138854546-138854568 GTGTGCTGAGCAGGCCAAAGGGG - Intronic
1048917763 8:139200995-139201017 GTGACCAGAGCAAGGGGAAGGGG - Intergenic
1049301051 8:141870662-141870684 GTGTGCAGAGAAGGGAGCCCAGG - Intergenic
1049337668 8:142095067-142095089 GTGTGCTGAGCAGGGGTCAGGGG + Intergenic
1049610626 8:143553240-143553262 GCGCGCAGAGCACGGAGGAGGGG - Exonic
1050194546 9:3067665-3067687 GTGCACAGTGCAAGGAGAAGAGG + Intergenic
1051189114 9:14492554-14492576 ATGGCCAGAGCAGGAAGAAGAGG + Intergenic
1051428906 9:16962206-16962228 GTCTACAGGGCAGAGAGAAGAGG - Intergenic
1051726551 9:20092727-20092749 GTGTGCAGGGCAGGGGGATGAGG + Intergenic
1051797068 9:20883977-20883999 GTGGAAAGGGCAGGGAGAAGAGG + Intronic
1052209352 9:25883457-25883479 GTTGGCAGAGCATGGAGAAAAGG - Intergenic
1052387278 9:27836631-27836653 CTGTGCAGATGATGGAGAAGTGG + Intergenic
1052458744 9:28735219-28735241 GTGTGCAGAGCAGAGAAAGGAGG - Intergenic
1052712309 9:32071612-32071634 AGGCGCAGAGCAGGAAGAAGAGG + Intergenic
1053199799 9:36144649-36144671 GTGGGCAGGGCAGGGATATGGGG - Intronic
1053258238 9:36637766-36637788 GTGGGCAGAACAGTGAGAAAGGG - Intronic
1054355842 9:64061913-64061935 GTGTTCAGAGCTGGGAAAACTGG - Intergenic
1055380174 9:75697988-75698010 GTGTTCAGAGCAGAGAAAAAGGG + Intergenic
1055449505 9:76418134-76418156 GTGGGCAGAGAGGGGAGGAGGGG + Intergenic
1055544970 9:77360839-77360861 GGGTGAATAGCAGGGAGAAAAGG + Intronic
1055696436 9:78889832-78889854 TTTTGCAAAGGAGGGAGAAGTGG + Intergenic
1056286439 9:85092081-85092103 GTGTGAAGAGAAGAGAGCAGGGG + Intergenic
1056448080 9:86685954-86685976 GGGTGCAGGAGAGGGAGAAGGGG + Intergenic
1056532438 9:87498658-87498680 GTGTGCAGAGAAAGGGGAGGCGG + Intronic
1056713891 9:89012857-89012879 GAGTGCAGTGCAGGGAGCACAGG + Intergenic
1056884167 9:90424105-90424127 GTGTGCAGTGAAGGGGGAAGGGG - Intergenic
1057039229 9:91835385-91835407 GTGTGCAGAGAAGAGAGCAATGG - Intronic
1057171951 9:92968354-92968376 GCAAGCTGAGCAGGGAGAAGAGG - Intronic
1057200603 9:93137768-93137790 GTGTACAGAGCAGGGAGGTAAGG + Intergenic
1057935930 9:99238952-99238974 GTGGGCAGAGCGGGGGGAGGGGG - Intergenic
1058404522 9:104656985-104657007 GTGGGCAGAGCAGGTGGAGGAGG + Intergenic
1058798075 9:108517793-108517815 ATGAGCAGAGCAGAGAGGAGAGG - Intergenic
1059528988 9:115018405-115018427 GTACACAGAGCAGGGAGAAGGGG + Intergenic
1059536594 9:115086603-115086625 GTGTGGACTGCAGCGAGAAGAGG - Exonic
1060119898 9:120979131-120979153 GACTGCAGAGGAGTGAGAAGAGG - Intronic
1060819447 9:126652830-126652852 GTGGGCACAGCAGGGACAATGGG + Intronic
1060921734 9:127425097-127425119 CAGTGGAGAGTAGGGAGAAGTGG + Intronic
1061231261 9:129317178-129317200 GTGTGCAGAGAAGGAACAAGGGG - Intergenic
1061791814 9:133063111-133063133 GTGTGGAGAGCAGGCAGCAGAGG - Intronic
1061795489 9:133083677-133083699 GTGTGGAGAGCAGGCAGCAGAGG - Intronic
1061801955 9:133117560-133117582 GTGTGCGGAACTGGGAGAATTGG + Intronic
1061989518 9:134151261-134151283 GTGTGCAGAGCAGAGAGCTTCGG + Intronic
1062059500 9:134487377-134487399 GGGCACATAGCAGGGAGAAGGGG - Intergenic
1062226489 9:135455390-135455412 CTGTGCAGCACAGGGAGCAGAGG - Intergenic
1062454622 9:136629688-136629710 GTTTGCCAAGAAGGGAGAAGGGG - Intergenic
1062633863 9:137479645-137479667 GAGAACAGAGCAGGGAGCAGAGG + Intronic
1185661987 X:1735411-1735433 GGGAGGAGAGGAGGGAGAAGAGG - Intergenic
1185891758 X:3828276-3828298 GTGGCCACAGCAGGGACAAGGGG - Intronic
1185896866 X:3866692-3866714 GTGGCCACAGCAGGGACAAGGGG - Intergenic
1185901984 X:3905118-3905140 GTGGCCACAGCAGGGACAAGGGG - Intergenic
1187145359 X:16632040-16632062 TTTTGAAAAGCAGGGAGAAGTGG - Intronic
1187276112 X:17817775-17817797 GTTTGCAGAGCAGGGAGGCCTGG + Intronic
1187814172 X:23213179-23213201 GTATGCAGAGCAGGCACATGTGG + Intergenic
1189337181 X:40176934-40176956 GGGTGGGGAGCAGGGAGTAGAGG - Intronic
1190189944 X:48268766-48268788 ATGTGCAGCGTAGGGAGAAGAGG + Intronic
1190291768 X:48997725-48997747 GAGAACAGAACAGGGAGAAGAGG + Intronic
1190463796 X:50705712-50705734 GTTGGCAGGGCAGGGAGAGGTGG - Intronic
1190911276 X:54774677-54774699 CTGGGCAGAGCAGGGAGAGGAGG + Intronic
1190919941 X:54841533-54841555 CTGGGCAGAGCAGGGAGAGGAGG - Intergenic
1192202240 X:69073813-69073835 GGGGGCAGAGTAGGGAGAAGAGG - Intergenic
1193163170 X:78252352-78252374 GGGTGGGGAGCAGGGGGAAGTGG - Intergenic
1193734517 X:85141106-85141128 GTATGCAAAGCAGGCAGAAAGGG + Intergenic
1194573650 X:95584323-95584345 GAGTCCAGAGAATGGAGAAGAGG + Intergenic
1195285890 X:103383308-103383330 GAGTGCAGAACTGGGAGAAGTGG - Intergenic
1195346456 X:103954819-103954841 CTGTGGGGAGCAGGGAGCAGGGG - Intronic
1195726588 X:107923930-107923952 CTGTGCAGAGCAGGGAAACATGG - Intronic
1195977711 X:110545542-110545564 GAGTGCACAGCAGGCAGAATGGG - Intergenic
1196688182 X:118530527-118530549 GTGTACAGAACAGGGAGGAATGG - Intronic
1197349272 X:125363110-125363132 GTGTGAAGAGAAGGGAGAGATGG + Intergenic
1197866403 X:131023393-131023415 GTGTGCAGAGCGAGAAGAAAAGG - Intergenic
1198388597 X:136150881-136150903 CTGTATAGAGTAGGGAGAAGTGG + Intronic
1198428084 X:136539860-136539882 GTGGGCAGAGCAGGTTGAGGGGG - Intronic
1199334767 X:146605780-146605802 ATGGCCAGAGCAGGAAGAAGGGG + Intergenic
1199608093 X:149592683-149592705 TGGTGCAGAGCTGGGAGATGGGG + Exonic
1199631027 X:149776677-149776699 TGGTGCAGAGCTGGGAGATGGGG - Exonic
1200180445 X:154147241-154147263 TTGGGCAGTGCAGGGACAAGGGG - Intronic
1200186273 X:154185636-154185658 TTGGGCAGTGCAGGGACAAGGGG - Intergenic
1200191925 X:154222774-154222796 TTGGGCAGTGCAGGGACAAGGGG - Intronic
1200197680 X:154260578-154260600 TTGGGCAGTGCAGGGACAAGGGG - Intronic