ID: 1071503518

View in Genome Browser
Species Human (GRCh38)
Location 10:86219549-86219571
Sequence AGTGTGCAGAGCAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 737}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503518_1071503529 25 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503529 10:86219597-86219619 TGGCCCCCCGTCCCAGAGTGAGG No data
1071503518_1071503522 -5 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503518_1071503526 5 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data
1071503518_1071503534 30 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503534 10:86219602-86219624 CCCCGTCCCAGAGTGAGGGCAGG No data
1071503518_1071503530 26 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503530 10:86219598-86219620 GGCCCCCCGTCCCAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503518 Original CRISPR AGTGTGCAGAGCAGGGAGAA GGG (reversed) Intronic
900114499 1:1022723-1022745 AGTATGGAGAGCTGGGAGGAGGG - Intronic
900758332 1:4453443-4453465 AGTGTGGAGAGAAGGGGGACTGG + Intergenic
900834513 1:4989998-4990020 AGAGTGCACAGCAGGGGGCATGG - Intergenic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
901826910 1:11868070-11868092 AGTATCAAGAGGAGGGAGAAGGG - Intergenic
902138190 1:14329128-14329150 AGACAGCAGAGCAGAGAGAATGG - Intergenic
902251683 1:15157568-15157590 AGTGTGAAGTGCAGACAGAAAGG - Intronic
902692784 1:18120447-18120469 AAAGTGCAGAGCTGGTAGAAAGG + Intronic
902722758 1:18315035-18315057 AGAGGGGAGAGCAGGGACAAGGG + Intronic
903158820 1:21469836-21469858 AGTGTGCAGACCAGGGACTCTGG + Intronic
903554963 1:24186813-24186835 AGTGTGGACAGCAGGGAAAGTGG - Intronic
903598635 1:24516748-24516770 AGAGGGCAGAGCAGGGAGCCAGG + Intronic
903842600 1:26254625-26254647 AGTATGCAGGACAGGGAGTATGG - Intronic
904860554 1:33534468-33534490 ACTGAGCAGAGCAGGGAGGGAGG - Intronic
905274331 1:36807290-36807312 ACTGTGCAGACCAGGGTGCACGG + Intronic
905300745 1:36984922-36984944 AGGCTGGACAGCAGGGAGAAAGG + Intronic
905300936 1:36985820-36985842 GATGTGCACAGCAGGGAGACGGG - Intronic
905454589 1:38079375-38079397 TGTGTGTAGAGGAGGGAGGATGG + Intergenic
906103027 1:43275199-43275221 TGTGTGCATGGCAGGGGGAAGGG - Intergenic
906693001 1:47805076-47805098 AGGGTCCAGAGCAGGCAGGATGG + Intronic
906781650 1:48577890-48577912 AGATTACAGAGCAGGGAGGAAGG + Intronic
906950644 1:50332673-50332695 AGAGTGCAGAACTGGGAGGATGG + Intergenic
907328746 1:53657880-53657902 AGGGTGCAGAGAAGGGGCAAGGG - Intronic
907436450 1:54452328-54452350 AGTTTGCAGAGAAAGGGGAAAGG - Intergenic
908251034 1:62266043-62266065 AGTGTGAAAAGCATGTAGAATGG - Intronic
908646049 1:66279067-66279089 AGTGTGAAGAGCATGCAGAGAGG - Intronic
909742174 1:79043785-79043807 GGGGTGCAGAGCAGAGAGCAAGG - Intergenic
910366743 1:86473796-86473818 ACTGTGGAGAGAAGGGTGAAAGG + Exonic
910727455 1:90353810-90353832 AGGGTTCAGAGGAGGAAGAATGG + Intergenic
911523990 1:98962575-98962597 AGTTTGAAGAGCAGAGAAAATGG - Intronic
912274596 1:108242922-108242944 AGTGTGCAGAGCAGGGACCCTGG - Intronic
912286671 1:108376936-108376958 AGTGTGCAGAGCAGGGACCCTGG + Intronic
912293622 1:108451419-108451441 AGTGTGCAGAGCAGGGACCCTGG + Intronic
912875277 1:113351567-113351589 TTTCTGAAGAGCAGGGAGAAAGG - Intergenic
912902047 1:113661718-113661740 TGTGTGCAGAGAAAAGAGAAGGG + Intronic
912914969 1:113805526-113805548 AGTGTGCATAGCAGAAAGAGAGG + Intronic
913122208 1:115752795-115752817 AGTGCGTAGAGCAGACAGAAAGG + Intronic
913472823 1:119206730-119206752 AGTCTGCAGAGTAGGTAGACAGG + Intergenic
913543418 1:119843319-119843341 AGTGTGCAGAGCAGGGACCCTGG - Intergenic
913604246 1:120450374-120450396 AGTGTACAGAGCAGGGACCGTGG + Intergenic
913641118 1:120813085-120813107 AGTGTACAGAGCAGGGACCGTGG + Intronic
913961369 1:143340127-143340149 TGTGAGCAGAGCAGACAGAAAGG + Intergenic
914055722 1:144165700-144165722 TGTGAGCAGAGCAGACAGAAAGG + Intergenic
914084295 1:144438831-144438853 AGTGTACAGAGCAGGGACTGTGG - Intronic
914123424 1:144800662-144800684 TGTGAGCAGAGCAGACAGAAAGG - Intergenic
914277365 1:146137239-146137261 AGTGTACAGAGCAGGGACCGTGG - Intronic
914364675 1:146967643-146967665 AGTGTACAGAGCAGGGACCGTGG + Intronic
914365442 1:146973930-146973952 AGTGTACAGAGCAGGGACCATGG + Intronic
914487004 1:148119509-148119531 AGTGTACAGAGCAGGGACCGTGG - Intronic
914538413 1:148588187-148588209 AGTGTACAGAGCAGGGACCGTGG - Intronic
914587339 1:149074654-149074676 AGTGTACAGAGCAGGGACCGTGG - Intronic
915929326 1:160049361-160049383 GGAGTGCACAGCAGGGAGCAGGG - Intronic
915974297 1:160375006-160375028 AGTGGGAAGAGGAGGGAGCAGGG + Intergenic
916180061 1:162075597-162075619 TGGGTGGAGAGAAGGGAGAAAGG - Intronic
916541774 1:165763680-165763702 AGTGAGCAGAGAGGGGAGATTGG - Intronic
917193913 1:172446705-172446727 AGGGTGGAGATCAGGGAGAAGGG + Intronic
917245820 1:172999142-172999164 AGTGTGCAGAGCAGGTATGTGGG + Intergenic
917434661 1:175008264-175008286 AGTTGGCAGAGCATGCAGAATGG - Intronic
917783769 1:178429439-178429461 AGTGGTCAGAGAATGGAGAATGG - Intronic
917795970 1:178532985-178533007 AGTGTGGAGAAGAGAGAGAAAGG + Intronic
918224726 1:182471209-182471231 AGTGTGCAAGGCTGGGAGAGGGG + Intronic
918740453 1:188124172-188124194 TGTGGTCAGAGCAGGAAGAAGGG - Intergenic
919107344 1:193169938-193169960 AGGGTGGAGAGCAGAGAGAGAGG - Intronic
919727985 1:200896032-200896054 ACTGGGCTGAGCTGGGAGAAGGG + Intronic
919923886 1:202182227-202182249 AGAGAGGAGAGCAGGGAGAGAGG + Intergenic
920266773 1:204729895-204729917 AATTTGCAGAGCTTGGAGAAAGG - Intergenic
920378441 1:205522023-205522045 TGTGTGCAGAGCAGGATGAGAGG + Intronic
920928351 1:210364033-210364055 TCTGTACAGAGCTGGGAGAAAGG - Intronic
921168220 1:212522825-212522847 AGGGTGCAGAGCATGCTGAATGG + Intergenic
922490663 1:226013969-226013991 AGTGTGCAGTGCGGGCGGAAGGG - Intergenic
922590956 1:226776143-226776165 CATGTGCAGAGCAGTGAAAAAGG + Intergenic
922723193 1:227909555-227909577 AGTGAGGAGGGGAGGGAGAAGGG + Intergenic
923051368 1:230393242-230393264 AGGGAGAAGAGCAGGGAAAAGGG + Intronic
923342868 1:233022395-233022417 AGTTTGCAGAGCAAGGGGAGAGG + Intronic
923383078 1:233440945-233440967 AGTTATCAGAGCAGTGAGAAAGG - Intergenic
923447994 1:234090445-234090467 AGGCTGCAGAGCAAGGAGACAGG + Intronic
923555978 1:235000559-235000581 AGTGGCCAGAACAGGGAGAAGGG + Intergenic
923570432 1:235108411-235108433 AGGATGCAGGGCAGGGAGTAGGG - Intergenic
924798419 1:247309654-247309676 AGTGGACAGAGTAGGGGGAAGGG - Intronic
1063257396 10:4343261-4343283 AGTCTGCAGAGAGGAGAGAATGG + Intergenic
1063425691 10:5948429-5948451 CGTGGGGAGAGCAGGGAGAGGGG + Intronic
1063707756 10:8447312-8447334 CGTGTGCAGATCAGAGGGAATGG - Intergenic
1063838670 10:10045788-10045810 AGTTTGCAGAACAGGGAGTTGGG - Intergenic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064102757 10:12477556-12477578 AGACTCCAGAGCAGGAAGAACGG + Intronic
1064602160 10:17005000-17005022 ACTAGTCAGAGCAGGGAGAAAGG - Intronic
1064861857 10:19835286-19835308 AGTGTGGAGAGCAGCTAGGAAGG + Intronic
1065228111 10:23567934-23567956 AGTGTGCAGAACAGGGGATATGG - Intergenic
1065499242 10:26362861-26362883 TGTGGGAAGAGGAGGGAGAAAGG + Intergenic
1065643883 10:27814483-27814505 AGTGTGAAGATCAGTGACAATGG - Intronic
1065669710 10:28103027-28103049 AGTGACCAGAGCAGAGTGAATGG - Intronic
1065788145 10:29235478-29235500 AGTGTGGATAGGAGGCAGAAGGG + Intergenic
1067024968 10:42836880-42836902 AGGGCGCAGAGCTGGGAGAGCGG - Intergenic
1067029818 10:42872524-42872546 TGTGAGCAGAGCAGACAGAAAGG + Intergenic
1067140457 10:43652081-43652103 AGTGTGCAGAGCACTGAGGAAGG - Intergenic
1067246634 10:44552904-44552926 TGTGTGCAGAGCAGGGAGGACGG - Intergenic
1067450087 10:46376734-46376756 GGTGTGCAGAGCCGGGAGCCGGG - Intronic
1067525547 10:47036196-47036218 TGTGTGTGGAGCAGTGAGAAAGG - Intergenic
1067558072 10:47286026-47286048 CGTGTGCAGAGCAGGCAGAGGGG + Intergenic
1067685345 10:48463520-48463542 AGTGGGCAGAGCTGGAGGAAAGG - Intronic
1067762463 10:49058518-49058540 AGGATGCAGAGCAGAGAGCAGGG - Intronic
1068024959 10:51631305-51631327 AATGTGCAGTGCAGGGAAAGAGG + Intronic
1068766684 10:60772096-60772118 AGTTTGCAGAGCAGGTGGAAAGG - Intergenic
1069135940 10:64766047-64766069 AGTTTGCAAATCAGGGAGATGGG + Intergenic
1070456994 10:76627028-76627050 AGTGTGCAGAGCACTGAAATAGG - Intergenic
1070620368 10:78004895-78004917 AGTTGGTAGAGCAGGAAGAAAGG + Intronic
1070742749 10:78913453-78913475 GGTGTGCCTCGCAGGGAGAACGG + Intergenic
1071345884 10:84692173-84692195 AGTTTTCAGAACAGCGAGAATGG + Intergenic
1071455561 10:85849039-85849061 AGTGGGCACAGCAGTGAGGAGGG - Intronic
1071503518 10:86219549-86219571 AGTGTGCAGAGCAGGGAGAAGGG - Intronic
1071703084 10:87963670-87963692 AGTGAGGAAAGTAGGGAGAAGGG + Intronic
1072227086 10:93380560-93380582 AGAGTACAGAGAAGGGAGAGAGG - Intronic
1073049504 10:100658405-100658427 AGGGAGCAGAGAAGGGAGCAGGG + Intergenic
1074603860 10:114941063-114941085 AGTGGACAGAGAAGGGAGGAGGG - Intronic
1075631123 10:124001278-124001300 AGGGGGCAGAGCCGGGAGAATGG + Intergenic
1075781658 10:125021239-125021261 AGTGAGCAGAGAAGGAAGAGAGG - Intronic
1075825880 10:125356735-125356757 GCTGGGCAGAGCAGGGAGGAGGG - Intergenic
1076070451 10:127484362-127484384 AGCCTGCAGAGGAGGGAGAGAGG - Intergenic
1076594339 10:131616607-131616629 AGTCTGCACAACAGGGAGAGGGG - Intergenic
1076995398 11:295149-295171 AGCGTGGACAGCAGGGATAAGGG + Exonic
1077357970 11:2127357-2127379 AATTTGCAAAGCAGGGAGAGGGG + Intergenic
1077581130 11:3418020-3418042 ACAGTGCAGGGCAGGAAGAAGGG - Intergenic
1077648805 11:3951098-3951120 CTTGTGCAGAGGAGGGAGCAGGG + Intronic
1078362914 11:10683538-10683560 AGGGGGCAGGGCAGGGAGAAAGG - Intronic
1078525868 11:12100819-12100841 TGTGCGCAGAGGAGGGGGAATGG - Intronic
1078927835 11:15890402-15890424 TGTGCACAGAGGAGGGAGAAGGG - Intergenic
1079150926 11:17898283-17898305 AGGGTGCACGGCAGGGAGAAAGG + Intronic
1080026003 11:27615998-27616020 AGTGTCCAGAGCTGGGAATAAGG - Intergenic
1080462759 11:32470105-32470127 AATGTCCAGAGTAGGCAGAAAGG - Intergenic
1080895871 11:36448464-36448486 AGTGTTCTGAGCAGGAGGAATGG - Intronic
1081759580 11:45567902-45567924 AGTGTGCAAAGCAGGTCGCAAGG - Intergenic
1081991780 11:47341965-47341987 AGTGTGCAGGGCAGGTGGATGGG - Intronic
1082016847 11:47495567-47495589 AATGTGAAGGGGAGGGAGAAGGG + Intronic
1082209685 11:49483712-49483734 GGTGGTCAGAGCAAGGAGAATGG - Intergenic
1082796959 11:57385031-57385053 ACTGTGCAGAGCACAGAGTAGGG - Intergenic
1082814645 11:57499871-57499893 AAGTTGCACAGCAGGGAGAAGGG + Intronic
1083483563 11:62966513-62966535 AGGCTGCAGAACAGGGAGAGGGG + Intronic
1083805743 11:65072782-65072804 TGTGTGCAGAGCAGACAGAATGG + Intronic
1083882351 11:65554855-65554877 AGGGTGGAGAGCAGGCAGAGAGG - Intronic
1084068779 11:66720526-66720548 AGAGAGCACACCAGGGAGAATGG + Intronic
1084709010 11:70832509-70832531 AGTGTGCAGGGCAGGGAGGAGGG - Intronic
1084717331 11:70882319-70882341 AGTGTGGAAGGCAGGCAGAAAGG + Intronic
1084966037 11:72745097-72745119 AGTGTGCCTGGTAGGGAGAATGG - Intronic
1085225911 11:74921094-74921116 AGTGCTCAAAGCAGGGATAATGG - Intronic
1085277552 11:75309694-75309716 AGAGTGCTGAGCAGAGACAAAGG + Intronic
1085994534 11:81894424-81894446 AGTGTGCTGAGCAATGAGAAGGG + Intergenic
1086402618 11:86473082-86473104 TGTGCACAGAGCAGGGAGCAGGG + Intronic
1086639990 11:89141824-89141846 GGTGGTCAGAGCAAGGAGAATGG + Intergenic
1086912525 11:92489422-92489444 TGAGTGAAGAGCAGGGCGAAAGG - Intronic
1086951085 11:92890754-92890776 AGTGTGCTGGCCAGGGAGACAGG - Exonic
1087008110 11:93488722-93488744 CGCCTGCAAAGCAGGGAGAATGG + Intronic
1088415866 11:109588651-109588673 AGAGAGCAGAGCAGTGAAAAGGG + Intergenic
1089663706 11:120002962-120002984 AGTGTGCAAAGCACTGGGAATGG + Intergenic
1090031634 11:123211452-123211474 AGGGAGCAGAGCAAGGGGAAGGG - Intergenic
1090180150 11:124690464-124690486 AGTGAGGAGAGGTGGGAGAAAGG + Intronic
1090387025 11:126363304-126363326 AGAATGCAGAGGAGGCAGAAAGG - Intronic
1090619262 11:128547130-128547152 ACTGACCAGAGCAGGGAGAAGGG + Intronic
1090844476 11:130519352-130519374 AGAGTGCAGAGAAGGCTGAAGGG + Intergenic
1090896314 11:130978798-130978820 AGTGTGTATAGCAGGGGCAATGG + Intergenic
1091193224 11:133711630-133711652 AGTGCTAAGAGCAGGGAGGATGG - Intergenic
1091779840 12:3206915-3206937 AGGGTCCAGGGCAGGGAGAAGGG + Intronic
1092273197 12:7039301-7039323 AGTGTGCAGTGAAGGGAGGGAGG - Intronic
1092959173 12:13579680-13579702 GGTGTGCAGAACAGGTTGAAAGG + Intronic
1093105610 12:15082661-15082683 AGTCTGCAGAGATAGGAGAATGG + Intergenic
1094147175 12:27243054-27243076 TGCGTGCAGTACAGGGAGAAGGG + Intergenic
1094347972 12:29492094-29492116 AGTCTGGAGATTAGGGAGAATGG + Intronic
1094486706 12:30930917-30930939 TGTGTGCAGGGCAGTGAGAGAGG - Intronic
1094754064 12:33445778-33445800 TGTCTACAGAGCAGGCAGAAAGG + Intergenic
1095631297 12:44380194-44380216 AGTGGGATGACCAGGGAGAAAGG + Intronic
1096259611 12:50082384-50082406 AGCGTCCAGCTCAGGGAGAAGGG + Exonic
1096343241 12:50821904-50821926 ATTGAACAGAGCAGGAAGAATGG + Intergenic
1096816290 12:54203856-54203878 AGGGCCCAGAGCAGGGACAATGG + Intergenic
1098074548 12:66715029-66715051 AGTGGGCATAGGAAGGAGAAGGG - Intronic
1098636227 12:72787121-72787143 GGTGTGCAGAAAACGGAGAAAGG - Intergenic
1099584804 12:84503228-84503250 AGTGGGGAGAGAAGGGAGCAAGG + Intergenic
1099922914 12:88981349-88981371 AGTGTGCATTCTAGGGAGAATGG - Intergenic
1100403823 12:94255428-94255450 TTTGAGCAGAGCAGGGAGGAGGG + Intronic
1100689918 12:97028831-97028853 GGGGTGCAGATCAGAGAGAATGG + Intergenic
1101111869 12:101494244-101494266 AGTTAGCACACCAGGGAGAAGGG + Intergenic
1101709578 12:107252707-107252729 AGGGTGGGGAGGAGGGAGAAGGG - Intergenic
1102017630 12:109658175-109658197 ACTGGGCAGAGCAGAGAGAGGGG + Intergenic
1102568915 12:113815494-113815516 TGTGAGCAGAGCTGGGAGGAAGG - Intergenic
1102892163 12:116568361-116568383 AGTCTGCAGGGCAGAGAGACAGG - Intergenic
1103276079 12:119712841-119712863 GGTGTGCAGAGAAGGCAGAGAGG + Intronic
1103839265 12:123849592-123849614 AGTGTGCAGGGCATGGAGGGGGG - Intronic
1103982654 12:124746520-124746542 AGAGTGCAGAGCACATAGAAAGG + Intergenic
1104222121 12:126795177-126795199 AGAGTGCAGAAAAGGGATAAAGG + Intergenic
1104368104 12:128196130-128196152 AGGGTGCAGATCAGAGAGAAGGG + Intergenic
1104816668 12:131650185-131650207 AGTGTGCAGATGAGGGACATTGG - Intergenic
1105205231 13:18217736-18217758 AGAGGGCAGAGCAGGGAGATGGG - Intergenic
1106846602 13:33743831-33743853 AGTGGGAAGAGAAGGGGGAAAGG + Intergenic
1106896658 13:34310122-34310144 AGTGGGAAGAACAGGTAGAAGGG + Intergenic
1107011653 13:35676478-35676500 AGGGTGGAGAGCAGGGGGCAGGG - Intergenic
1107565571 13:41600479-41600501 AGAGTGCAGAGCAAAGAGAGGGG - Intronic
1108410932 13:50146271-50146293 AGAGTGCAGAGTAGTGTGAATGG - Intronic
1109763125 13:66857414-66857436 AGTGTGCAAAGGAGTGAGAGTGG + Intronic
1109828405 13:67754214-67754236 AGTGTACTGAGCAAGAAGAATGG + Intergenic
1111468374 13:88645946-88645968 AGTGTGGAGAGAAGAAAGAAAGG + Intergenic
1111813524 13:93121364-93121386 AGAGAACAGAGCAAGGAGAATGG + Intergenic
1112333515 13:98495656-98495678 AGTGTGTTCAGCAGAGAGAAAGG + Intronic
1113712275 13:112475066-112475088 AGTCTGCACAACAGGGAGCAGGG - Intergenic
1113963850 13:114140677-114140699 AGTGTGCAGTGCTGGGAGGATGG - Intergenic
1114333803 14:21665790-21665812 AGTGGGCCGAGCAGGTAGACAGG - Exonic
1114663131 14:24362046-24362068 CGTATGAAGAGCATGGAGAATGG - Intergenic
1114666100 14:24377914-24377936 AGTGTGTGGAGGAGGGAGGAGGG + Exonic
1115190787 14:30745192-30745214 AGGGTGGAGAGCAGTAAGAAAGG + Intergenic
1116365764 14:44060921-44060943 AGTTTGCAGAGCAAGCAGTAGGG - Intergenic
1117202106 14:53401530-53401552 TGTGTGGTGGGCAGGGAGAAGGG - Intergenic
1117334357 14:54744182-54744204 AGCATGAAGGGCAGGGAGAAAGG - Intronic
1117551073 14:56836837-56836859 AGAGTACAGAGGAGTGAGAATGG + Intergenic
1117970414 14:61245882-61245904 AGTGAGCAGATCTGGGAGGATGG + Intronic
1117984282 14:61372449-61372471 AGTTTGCAGACAAGGGAGAAAGG - Intronic
1118072261 14:62258067-62258089 AGTGTGGAGAGAAGAGAGACAGG + Intergenic
1118347600 14:64951251-64951273 TGGATGCTGAGCAGGGAGAATGG - Intronic
1119030466 14:71188332-71188354 AGTGTGCAGTGAAGGGAGCTGGG + Intergenic
1119843527 14:77811079-77811101 GGTGTAGAGAGCAAGGAGAAAGG + Intronic
1120963961 14:90151010-90151032 AGTGTGAACAGGAGGAAGAAGGG - Intronic
1121633374 14:95437513-95437535 AGTGAGGAGAGGAGGGAGAGAGG - Intronic
1121982085 14:98463418-98463440 TGTGTTCAGAGCAGGAAGGATGG - Intergenic
1122247797 14:100416645-100416667 AGTCTGGAGACAAGGGAGAAAGG - Intronic
1123607037 15:22043363-22043385 TGAGTGTAGAGCAGGGAAAATGG + Intergenic
1124656729 15:31515242-31515264 AGCGGGCAGAGCAAGGTGAATGG + Intronic
1125253240 15:37730981-37731003 AGTGAGCAGAGAAGGGAAAAAGG - Intergenic
1125362311 15:38877036-38877058 AGAGTGCAGGGAAGTGAGAATGG + Intergenic
1125368329 15:38942924-38942946 AGGGAGAAGAGCAGGGAGGAAGG + Intergenic
1125876047 15:43145874-43145896 AGAGTGAAGACCAGGAAGAAAGG - Intronic
1126705109 15:51398962-51398984 TGGATGCAGAGCAGGGAAAATGG + Intronic
1126841700 15:52723566-52723588 AGTGTGGAAAGGAGGGAGAAGGG - Intergenic
1127381954 15:58438215-58438237 AGTTGGCACAGCAGGGAGAGAGG + Intronic
1127620019 15:60724893-60724915 AGTGTGAGGAGCGGGGAGGAGGG - Intronic
1128938974 15:71771576-71771598 AGTTGGCAGAGAAGGGAGGAAGG + Intronic
1129655883 15:77525590-77525612 AGCCTGCTCAGCAGGGAGAAGGG + Intergenic
1129725279 15:77898470-77898492 AGGGTACAGAGCAGGGGGAATGG - Intergenic
1129915441 15:79266010-79266032 AGAATGCAGGGCAGGGACAAGGG + Intergenic
1130130541 15:81137842-81137864 ATGGTGCAGGGCAGGGAGTAGGG + Intronic
1130154229 15:81335860-81335882 TCCCTGCAGAGCAGGGAGAATGG - Intronic
1130260793 15:82352869-82352891 ATTGTGTAGTGAAGGGAGAAAGG - Intergenic
1130280441 15:82516138-82516160 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130282944 15:82533191-82533213 AGTCTGCAGAGCAGGTACAGCGG - Intergenic
1130471814 15:84232321-84232343 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130479308 15:84346892-84346914 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130492462 15:84441237-84441259 ATTGTGTAGTGAAGGGAGAAAGG - Intergenic
1130594111 15:85236958-85236980 ATTGTGTAGTGAAGGGAGAAAGG + Intergenic
1130788678 15:87128148-87128170 AGTATGGAGAGCAGGGAGTGAGG - Intergenic
1130814009 15:87411437-87411459 TGTGTGCAGAGGTGGAAGAAAGG - Intergenic
1130831353 15:87604271-87604293 AGTGTTCAGAGCTGGAAAAATGG + Intergenic
1130889319 15:88119947-88119969 TGTGTGCAGAGCAGGGGAATTGG - Intronic
1130905920 15:88240887-88240909 GGTGTGGAGAGCAATGAGAATGG + Intronic
1130944394 15:88540059-88540081 AATGTGCAGAGTAGGGGGCAGGG - Intronic
1130958607 15:88644861-88644883 GGAGCCCAGAGCAGGGAGAAAGG + Intronic
1131703852 15:94971463-94971485 AGTATGCAGAGAAGCCAGAAAGG + Intergenic
1131871997 15:96773030-96773052 AGAGTGCAGAGCAGTGATGAGGG - Intergenic
1132088780 15:98930333-98930355 AGCGTGCAGGGCAGGTAGATCGG + Intronic
1132486509 16:195025-195047 AGTATGCAGAGCTGGGTGACTGG + Intronic
1132793295 16:1705910-1705932 AGTGTGCAGAGCCTGGAGACGGG + Intergenic
1133009803 16:2904796-2904818 AGTGCGAAGGGCAGGGAGAGAGG + Intergenic
1133237889 16:4396531-4396553 AGTTTGCTGAGCAAGGAGAAAGG + Intronic
1133288156 16:4700732-4700754 AGTATGGAAAGCAGGGAGACAGG + Intronic
1133452704 16:5917043-5917065 AGGGTGCGGTGAAGGGAGAAAGG - Intergenic
1133467203 16:6039091-6039113 TGTGTGCATAGCGGGGAGAAGGG + Intronic
1133739399 16:8640216-8640238 AGTCAGCAGAGCTGGGAGGATGG + Intronic
1134081026 16:11325084-11325106 AGGGGGAAGAGCAGGCAGAAGGG + Intronic
1134449285 16:14353929-14353951 AGTGGGGAGAGGAGGGGGAAAGG + Intergenic
1134888195 16:17813721-17813743 AATTTACATAGCAGGGAGAAGGG - Intergenic
1135355824 16:21768247-21768269 ATTGTGCACACCAGGGAGCAGGG - Intergenic
1135454314 16:22584385-22584407 ATTGTGCACACCAGGGAGCAGGG - Intergenic
1135618551 16:23933207-23933229 AGCCTCCAGAGCAGGAAGAAAGG - Intronic
1135632400 16:24046500-24046522 AGTGTGATTAGCAGGGATAATGG + Intronic
1135659105 16:24279070-24279092 AGTGGGCTGAGTGGGGAGAATGG + Intronic
1136102136 16:28004082-28004104 TGTGTGCACAGCAGGGTGGAGGG + Intronic
1136147248 16:28322630-28322652 AGTGGGCACAGCAGGGAGAGTGG - Exonic
1136933125 16:34436361-34436383 AGTGTGCAGAGCAGAAGGTAAGG - Intergenic
1136971447 16:34975453-34975475 AGTGTGCAGAGCAGAAGGTAAGG + Intergenic
1137528737 16:49262600-49262622 AGGATGCAGCGCAGGGAGAGAGG - Intergenic
1137565354 16:49529395-49529417 CCTGAGCAGAGGAGGGAGAAAGG - Intronic
1138391792 16:56675805-56675827 ACTGTGCGGGGGAGGGAGAATGG + Intronic
1138583966 16:57958634-57958656 AGGGTGGAGAGGGGGGAGAATGG - Intronic
1138618987 16:58197424-58197446 GGTGCGCAAAGCGGGGAGAAAGG + Intronic
1138689108 16:58751158-58751180 AGTATGGAGAGCAGGGAGAGGGG + Intergenic
1139208939 16:65057315-65057337 GGTGTGCAGAGCTGGGAAGATGG - Intronic
1140960202 16:79904480-79904502 GGTGTGAAGAACAGGGAGGACGG - Intergenic
1141497514 16:84420162-84420184 GGTGTACAGAGCAGGGAGGGAGG - Intronic
1141561703 16:84872738-84872760 ACTGGACCGAGCAGGGAGAAAGG + Intronic
1141702107 16:85647239-85647261 AGGGTGCAGGGCAGGCAGGAGGG - Intronic
1142107774 16:88315558-88315580 ACTTTGCAGAGGAGGGAGCAGGG + Intergenic
1142263665 16:89053891-89053913 ACGGTGCGGTGCAGGGAGAAGGG + Intergenic
1142438108 16:90076078-90076100 GGTGTTCAGAGCAGGAAGACTGG + Intronic
1143084458 17:4405554-4405576 AGTGAGCTGTGCAGGGAGATTGG + Intergenic
1143280921 17:5753523-5753545 AGTGAGCAGAGGAGAGAGCAGGG - Intergenic
1143650796 17:8263372-8263394 AATGTACAGAGCATGGAGAATGG - Intronic
1143815837 17:9514017-9514039 ACTGGGGAGAGTAGGGAGAAGGG + Intronic
1143908997 17:10232068-10232090 AGAGGGCAGGGCTGGGAGAAGGG + Intergenic
1144021601 17:11243211-11243233 AATGTGCACAGCAGCGAGGAAGG - Intronic
1144686443 17:17229092-17229114 AGAGTGCGGAGCAGTGAGCAGGG + Intronic
1145251381 17:21298649-21298671 AGTGAGCAGAGCAGAGCAAATGG - Intronic
1145264934 17:21375372-21375394 TGTCTGCACAGCAGGGAGACTGG - Intergenic
1145275273 17:21425430-21425452 AGCGTCCCGAGCAGGGAGAAAGG + Intergenic
1145313128 17:21711327-21711349 AGCGTCCCGAGCAGGGAGAAAGG + Intergenic
1145825175 17:27871463-27871485 AGAGTGCCAAGCAAGGAGAATGG - Intronic
1145993307 17:29091944-29091966 AGTGGGCTGGGCAGGGGGAAGGG + Intronic
1147038067 17:37696486-37696508 AGTGTGAGCAGGAGGGAGAAGGG - Intronic
1147177240 17:38663560-38663582 AGGGTGGAGAGGAGGGAGAGAGG - Intergenic
1147237924 17:39071450-39071472 AGAGTGCAGAGCAGAGCAAAGGG - Intronic
1147725269 17:42562906-42562928 GGTGGGCAGGGGAGGGAGAAAGG - Exonic
1148338622 17:46859322-46859344 AGTGTGTACAGCATGGAGTAAGG + Intronic
1148623334 17:49050932-49050954 AGTGTGCTGGGAAGGGAGGAAGG + Exonic
1148647792 17:49229344-49229366 ACAGGCCAGAGCAGGGAGAAGGG + Intronic
1149285605 17:55160789-55160811 TGGGTGCAGAGAAGGGGGAAGGG - Exonic
1150007642 17:61479592-61479614 AGGGTGGAGAGCAAGGAGTAGGG + Intronic
1151146663 17:72047473-72047495 AGTGCACACAGCAGGGAGAGGGG + Intergenic
1151194993 17:72424979-72425001 AGTGTGCAGTGCAGGGAGAGAGG - Intergenic
1152117002 17:78394438-78394460 GGTGAGCAGAGCAGGGAGGCAGG - Intronic
1203192770 17_KI270729v1_random:205184-205206 AGCATGCAAAGGAGGGAGAAGGG - Intergenic
1203202134 17_KI270730v1_random:4619-4641 AGCATGCAAAGGAGGGAGAAGGG - Intergenic
1153052094 18:909144-909166 AGGGGGCAGCGCTGGGAGAAAGG + Intronic
1153056942 18:955199-955221 AGTCAGCTGAGCAGGGAAAAGGG - Intergenic
1153206509 18:2709040-2709062 AGTTACCAGGGCAGGGAGAAAGG - Intronic
1153664387 18:7355098-7355120 TGTGTCCAGAGCAGGGTGACGGG - Intergenic
1153861655 18:9216252-9216274 AGGCTGAAGAGAAGGGAGAAGGG - Intronic
1155653689 18:28171868-28171890 AGTGTCCAGGGCAGGAAGCATGG - Intronic
1156291929 18:35755055-35755077 TGTGTGGAGTGGAGGGAGAAGGG - Intergenic
1156484720 18:37457436-37457458 AGTGTGCAGAACTTGGAGAGAGG + Intronic
1157752244 18:50189590-50189612 AGTATGCAGGGAAGGGAGTAAGG + Intronic
1158950796 18:62493013-62493035 GGTGTCCAGAGCAGGGAGTAGGG + Intergenic
1159014251 18:63088620-63088642 AGGGTGGAGACCAAGGAGAAGGG + Intergenic
1159462694 18:68740902-68740924 AGTTTGCTCAGCATGGAGAAGGG + Intronic
1159832570 18:73294848-73294870 AGTGTGCAGGAAAGGGAGGATGG + Intergenic
1160035364 18:75296717-75296739 TGTGTGCAGAGCAGGGGGACGGG + Intergenic
1160517908 18:79488627-79488649 AGGCTGCAGAGCAGGGACATGGG - Intronic
1160779542 19:871779-871801 AGAGGGGAGAGCGGGGAGAAGGG + Intronic
1160821127 19:1058692-1058714 AGTGTGAAGAGAAGGAAGAGGGG - Exonic
1161678693 19:5667910-5667932 AATATGCAAAGCAGGGGGAAGGG - Intronic
1162132139 19:8533030-8533052 GGTCAGCAGAGCAGGGAGCAAGG - Intronic
1163659398 19:18567789-18567811 AGTTTACAGAGCAGGGAGCTGGG + Intronic
1163879631 19:19906164-19906186 AAGGTGCAGAGAAAGGAGAAAGG - Intronic
1165059039 19:33195843-33195865 GGTGAGCAGAGCAGGGGGACAGG + Intronic
1165077448 19:33287846-33287868 AGTGCACAGAGCAGGGAGTGGGG - Intergenic
1165784197 19:38451649-38451671 ATTCTGCAGAGCAGGGAGGAGGG + Intronic
1166135861 19:40776873-40776895 TATGTGGAGATCAGGGAGAAGGG + Intronic
1166209553 19:41297434-41297456 AGGCTGCAGAGGAGAGAGAAAGG + Intronic
1166672408 19:44718868-44718890 AGGATGGAGAGCAGGGAGGAGGG + Intergenic
1167232911 19:48296771-48296793 AGTGTCAGGAGCAGAGAGAAAGG + Exonic
1167708142 19:51093946-51093968 AATGTGCAAGGCAGAGAGAATGG - Intergenic
1167744557 19:51342898-51342920 ACTGGGCAGAGGAGGGAGACGGG - Intergenic
1168367027 19:55797017-55797039 AGTGAGGAGATCAGGGAGGATGG - Intronic
1202695205 1_KI270712v1_random:118377-118399 TGTGAGCAGAGCAGACAGAAAGG + Intergenic
925053313 2:834222-834244 GGTGGGTAGAACAGGGAGAAGGG + Intergenic
925290952 2:2748451-2748473 GGTGTGCACGGCAGTGAGAAAGG - Intergenic
925361702 2:3284510-3284532 AGTGTGCAGACCACGGACAGTGG + Intronic
925995476 2:9289222-9289244 TGTGTCCAGAGCATGGGGAAGGG - Intronic
926056199 2:9775554-9775576 ACAGTGGAGAGCAGGCAGAATGG - Intergenic
926081545 2:9990585-9990607 CCTGTCCAGAGAAGGGAGAAAGG + Intronic
926444302 2:12924823-12924845 AAAGTACAGATCAGGGAGAAAGG + Intergenic
926695651 2:15768672-15768694 GGTGTGCAAAGCAGGAAGCAGGG + Intergenic
926925039 2:17978745-17978767 AGTGTGGAGAGGCAGGAGAACGG - Intronic
927081764 2:19637468-19637490 AGTGTTGAGTGCAGGGAGAAGGG + Intergenic
927228843 2:20799666-20799688 AGGGTGCAGGGCTGGGAGGAGGG - Intronic
927478309 2:23431031-23431053 AGGCTGCACAGCACGGAGAAAGG - Intronic
928251962 2:29688954-29688976 GTGGTGCAGAGCAGGGACAATGG + Intronic
928298289 2:30104436-30104458 AGTCTGCAGAGCAGGCAGGTGGG - Intergenic
929593982 2:43164422-43164444 TTTAGGCAGAGCAGGGAGAATGG - Intergenic
930746491 2:54888518-54888540 AGTATACAGAGGAGGGAGGAGGG - Intronic
932030882 2:68183328-68183350 AGGGTGGAGTGCTGGGAGAAGGG - Intronic
932090448 2:68801292-68801314 AGTGTGCAGATGAGGGAGGGAGG + Intronic
932113339 2:69021946-69021968 AGTATGCAGAGAATGGGGAAGGG - Intronic
932614275 2:73222221-73222243 AGTGGGCAAATCAGGTAGAATGG + Intronic
933308872 2:80636126-80636148 TGTGTGCAGAGCAGGACCAAAGG + Intronic
933646206 2:84814642-84814664 AGTGTGCTGAGCATGGACCAGGG - Intronic
934276373 2:91575426-91575448 TGTGAGCAGAGCAGACAGAAAGG + Intergenic
934735674 2:96688715-96688737 AGGGTGCGGGGCAGGGAGCAGGG + Intergenic
935365620 2:102287243-102287265 AGTGTACAGAGGGGGAAGAAAGG + Intergenic
935397351 2:102621913-102621935 GGAGTGCAAAGCAGGTAGAAGGG + Intronic
935828812 2:106978062-106978084 AGGGTGCTGAGAAGGGAGACTGG + Intergenic
935839816 2:107097254-107097276 AGTTTGCAGAACAGAGAGGAAGG - Intergenic
935856407 2:107279238-107279260 AGTGGGCAAGGCAGGGAAAAGGG + Intergenic
936641552 2:114317417-114317439 ATTGTCCAGAGGTGGGAGAAAGG + Intergenic
936665547 2:114591088-114591110 CCCATGCAGAGCAGGGAGAAGGG + Intronic
936882264 2:117268052-117268074 AGTATGGAGAGCAGGGTGCAAGG - Intergenic
937052258 2:118902044-118902066 AAGGAGCAGATCAGGGAGAAGGG - Intergenic
937978600 2:127597093-127597115 AGAGAGCAGGGCAGGGAGCAGGG + Intronic
938065748 2:128281133-128281155 AGGGGGCAGGGCAGGGAGATGGG - Intronic
938302049 2:130222852-130222874 ACTGTGCCTAGCAGAGAGAAAGG + Intergenic
938454651 2:131451600-131451622 ATTGTGCCTAGCAGAGAGAAAGG - Intergenic
938964739 2:136378291-136378313 ATTGAGCAGAGAGGGGAGAATGG + Intergenic
939166700 2:138648412-138648434 AGAGGGCAGAGCAGAGAGCATGG - Intergenic
939552355 2:143630979-143631001 GGAGTGCAGAGCAGGTGGAAAGG - Intronic
939895921 2:147791327-147791349 AGTGTGCTTAGTAGGAAGAAGGG - Intergenic
940180393 2:150925306-150925328 AGAGAGAAGAGCAGGAAGAAAGG - Intergenic
941032900 2:160533241-160533263 ATTGTGCAGGAGAGGGAGAAAGG + Intergenic
941046102 2:160677460-160677482 AGCACCCAGAGCAGGGAGAAAGG + Intergenic
942249814 2:174037964-174037986 AGCGTGGGCAGCAGGGAGAAAGG + Intergenic
945473381 2:210253116-210253138 AGTATGCAGAGTGAGGAGAAAGG - Intergenic
945905064 2:215583440-215583462 AGTGTGCAGGGCAAGGAAATAGG - Intergenic
945946325 2:215999154-215999176 GGTGTGCGGAGCAAGGAAAATGG + Intronic
946059062 2:216926211-216926233 AGTGTGCAGAGTTGGAGGAAGGG + Intergenic
946187843 2:217991175-217991197 AGGGTCCAGAGGAGGGAGGAGGG + Intronic
946314126 2:218898214-218898236 AGTCTGCAGAGCAGCGACAGTGG + Intronic
947175556 2:227363483-227363505 TGTGTGTAGAGAAAGGAGAAGGG - Exonic
947384415 2:229576982-229577004 AGGGTCCAGACCACGGAGAAGGG + Intronic
947517284 2:230816948-230816970 AGTGTGCAGAGCCGGCAGTGGGG - Intronic
948467308 2:238158665-238158687 AGGGTCCAGGGCTGGGAGAAGGG + Intergenic
948495408 2:238345621-238345643 ATTGTGCAGAGAAGAGAGAGAGG + Intronic
948770418 2:240248823-240248845 AGTGTGCAGTTGAGGGAGATGGG - Intergenic
1168763033 20:362645-362667 CGTGGTCAGGGCAGGGAGAAGGG + Intergenic
1168835654 20:875664-875686 AGTGTGCAGAGCAGTGTCACGGG + Intronic
1169275553 20:4231569-4231591 AATGTGCAGAGGAAGGAAAAGGG + Intronic
1169323675 20:4656970-4656992 AAGGTGCAGAGAAGGGAAAAAGG + Intergenic
1170063595 20:12286566-12286588 TTTGTGCACAGCAGGCAGAAAGG - Intergenic
1170740885 20:19054957-19054979 AGTTTTTAGAGGAGGGAGAAGGG - Intergenic
1171249002 20:23634628-23634650 TGGGTGCTGGGCAGGGAGAAAGG - Intronic
1171255509 20:23686590-23686612 TGGGTGCTGGGCAGGGAGAAGGG - Intronic
1171258235 20:23708370-23708392 TGGGTGCTGGGCAGGGAGAAGGG - Intergenic
1171262853 20:23748515-23748537 TGTGTGCTGGGCAGGGAGAAGGG - Intronic
1171271980 20:23824719-23824741 TGTGTGCTGGGCAGGGAGAAGGG - Intronic
1171275453 20:23853414-23853436 TGGGTGCTGGGCAGGGAGAAGGG - Intergenic
1171356412 20:24549216-24549238 AGTGGGCAGAGTAGGAGGAAGGG - Intronic
1172210317 20:33193338-33193360 AGTGTGGAGAGCACCGAGAGGGG - Intergenic
1173184749 20:40831955-40831977 AATGTGCATGGCAGGGGGAATGG + Intergenic
1173270788 20:41533020-41533042 AGTGCTCAGAGAAGGGAGAAAGG + Intronic
1173321754 20:41993715-41993737 AGTGTGGAAAGCAAGAAGAAGGG - Intergenic
1173811685 20:45959739-45959761 AGTGTGCTGACCAGGGAGCTAGG + Intronic
1173865844 20:46312344-46312366 AGTGTGGGGAGAAGAGAGAAAGG - Intergenic
1173914927 20:46700311-46700333 AGCAGGCAGAGCAGGGATAAAGG + Intergenic
1173992609 20:47314873-47314895 AATGGGAAGAGCCGGGAGAAAGG + Intronic
1176057182 20:63154948-63154970 AGTGTGGGGAGGAGGGAGGAGGG - Intergenic
1176075284 20:63245483-63245505 GGTGTGCAGGGCGGGGAGCATGG - Intronic
1176178346 20:63738883-63738905 AGTGTTCAGGGCAGGGAGGCAGG - Exonic
1177049316 21:16212005-16212027 AGTGTTCAGAACAAGTAGAATGG + Intergenic
1178092926 21:29183419-29183441 AGGGTGCAGAGCAGGGTGAATGG + Intergenic
1178266869 21:31151529-31151551 AGGGAGCAGAGCATGGAGCAGGG + Intronic
1178728022 21:35072591-35072613 AGTGTGCAGGGCCAGGAAAAAGG - Intronic
1179236145 21:39548150-39548172 AGAGTGGACAGCAGGGACAAAGG - Intergenic
1179297453 21:40076133-40076155 AGTAAGCAGAGCAGGGATAATGG + Intronic
1179443266 21:41410977-41410999 AGCATCCAGGGCAGGGAGAAGGG + Intergenic
1179910300 21:44443954-44443976 AGTGGGCAGAGCAGGGGGCACGG - Intergenic
1179947923 21:44691092-44691114 AGTGTGGAGAGAGGAGAGAAGGG - Intronic
1180829005 22:18888245-18888267 AGAGGGCAGAGCGGGGAGATGGG + Intergenic
1180875926 22:19175264-19175286 AGTGTTCAGAGCAGGGGGCTGGG - Intergenic
1181438701 22:22924810-22924832 ACTGGGCAGGGCATGGAGAAAGG - Intergenic
1181910999 22:26238148-26238170 ATTGGTCAGAGCAGGCAGAAGGG + Intronic
1182393099 22:30015802-30015824 AGATTGCAGAAGAGGGAGAATGG - Intronic
1182497697 22:30721463-30721485 AGTGTGCAGAGCAGGGGTGAAGG + Intronic
1183138645 22:35915210-35915232 CATGTGCAGGGCAGAGAGAAGGG + Intronic
1183177728 22:36236923-36236945 AGTGAACAAAGCAGGAAGAAGGG - Intronic
1183378040 22:37476479-37476501 GGTCTTCAGAGGAGGGAGAAGGG - Intronic
1183986993 22:41575473-41575495 AGAGAGCAGAGCAGGAAGGAAGG - Exonic
1184059575 22:42073978-42074000 AGTGGGCCGAGCAGGGAGAGGGG + Intergenic
1184460547 22:44635306-44635328 AGGGGGCATGGCAGGGAGAAGGG + Intergenic
1184701679 22:46178465-46178487 AGGTTGCAGTGCAGGGAGAGGGG + Intronic
1184773493 22:46611588-46611610 AGTGTACAAAGCAGGATGAAAGG - Intronic
1185026623 22:48417781-48417803 AGGAAGCAGAGCAGGGGGAATGG - Intergenic
1185372168 22:50465953-50465975 AGTGTGCTGAGCATGGTGAGGGG - Exonic
1203279096 22_KI270734v1_random:114233-114255 AGAGGGCAGAGCGGGGAGATGGG + Intergenic
949282665 3:2364422-2364444 GGTTGGCACAGCAGGGAGAAAGG + Intronic
950021620 3:9791984-9792006 AGTGACTAGAGAAGGGAGAAAGG - Intronic
950102369 3:10365877-10365899 TGTGTGCATATCAGGGTGAAAGG + Intronic
950263229 3:11556864-11556886 TGTGTGCGGGGCAAGGAGAAGGG + Exonic
950276599 3:11666453-11666475 AGCGTGGAGAACAGAGAGAAAGG + Intronic
951171586 3:19548264-19548286 AGTGTGCACACCAGGAAGTAAGG - Intergenic
951568200 3:24034280-24034302 AGGGAGGAGAGCAGAGAGAAGGG + Intergenic
952041175 3:29263722-29263744 AGTGTGCAGAGTAGTGTGATAGG + Intergenic
952132951 3:30385299-30385321 AGTGTGGAGGGAAGGGGGAAGGG + Intergenic
952978371 3:38715305-38715327 AGTGGGCTGAGCAGTGGGAATGG - Intronic
953491257 3:43353981-43354003 AATGTGCAGGGCAGAGAGGAGGG - Intronic
954412677 3:50377859-50377881 AGTGTTCAGAGCAGGGACTGAGG + Intronic
954538535 3:51379008-51379030 AGTGGGAAAAGCAGGGAGCAAGG - Intronic
954722596 3:52578169-52578191 CATGGTCAGAGCAGGGAGAATGG - Intronic
955147255 3:56332034-56332056 AGGGAGCAGAGCAGGGAGAGTGG + Intronic
955709110 3:61760368-61760390 AGTTTCCAGGGCAGCGAGAAAGG - Intronic
955977437 3:64491925-64491947 TGAGTACAGAGCAGGGAGATAGG - Intergenic
956343863 3:68256360-68256382 AGTGGTCAGAGCAGGTAGACTGG + Intronic
956677668 3:71751321-71751343 ATTTTGCAGAGGAGGCAGAAGGG - Intronic
956741572 3:72279955-72279977 AGGTTGGAGAGCAGGGAGGAAGG + Intergenic
956873284 3:73439027-73439049 AGTGTGCAGGGCACTGAGGAGGG - Intronic
957053997 3:75430653-75430675 ACAGTGCAGGGCAGGAAGAAGGG - Intergenic
957652920 3:83032538-83032560 AGAGGGAAGAGGAGGGAGAAGGG - Intergenic
958883896 3:99704671-99704693 AGTCTGCAGGGCTTGGAGAATGG - Intronic
958985620 3:100776712-100776734 AGGGTGGAGAGCAGGGACTAGGG + Intronic
960196598 3:114776155-114776177 AGAATGCAGAGCAGGTACAAAGG + Intronic
961062347 3:123841466-123841488 AGAGTGAGAAGCAGGGAGAAAGG - Intronic
961714192 3:128847562-128847584 AGTGAGCTGGGCAGGGAGGAAGG + Intergenic
961887667 3:130107030-130107052 ACAGTGCAGGGCAGGAAGAAGGG - Intronic
962409728 3:135130426-135130448 AGTTGGCTGAGCAGGGAGAGAGG + Intronic
962454368 3:135551645-135551667 AGAGAGTAGAGCAAGGAGAAAGG - Intergenic
962605224 3:137027160-137027182 GGTGTGCAAATCAGGAAGAAAGG + Intergenic
962616954 3:137135827-137135849 GGGATGCAGAGCAGGGACAAGGG - Intergenic
962701423 3:138003313-138003335 AGGGTGCAGACCATGAAGAAAGG + Intronic
962938194 3:140100979-140101001 TGTGTGCAAAGCAGAGGGAAGGG + Intronic
963807068 3:149733707-149733729 AGTGTGGATAGCAGGGAGCATGG + Intronic
964407809 3:156367728-156367750 AGCATGCAAGGCAGGGAGAAGGG - Intronic
965165986 3:165194998-165195020 AGGGGGCACAGCAGGGAGAAAGG - Intronic
965754442 3:172011251-172011273 AATTTGCAGTGGAGGGAGAAAGG + Intergenic
965785148 3:172327503-172327525 AGGGGGCTGAGGAGGGAGAATGG - Intronic
966245608 3:177804667-177804689 TATGAGCAGAGCAGGGAGCAGGG + Intergenic
967813199 3:193777643-193777665 AGTTTGCTGGGCAGGGAGCAGGG + Intergenic
968036648 3:195553454-195553476 AGTCAGCAGGGCAGGGAGAATGG + Intergenic
968441554 4:626944-626966 CGGGTGCAGGACAGGGAGAAGGG - Intronic
968687406 4:1970569-1970591 AGTGGGAGGAGCAGGGAGAAAGG + Intronic
969241605 4:5902343-5902365 AGTTTGCAGATCAGAGAGATGGG + Intronic
970487236 4:16536756-16536778 ATTGTGCAGGGCTGGGAGGAAGG + Intronic
972775661 4:42237660-42237682 GGAGTGCAGAGCAGGGAGTGAGG - Intergenic
973126096 4:46586777-46586799 AGTTTGCAGAGCAGACAGAGAGG - Intergenic
973590206 4:52433486-52433508 AGTGTACAGAATTGGGAGAAGGG + Intergenic
973728993 4:53805089-53805111 AGTGGGCTGAGCAGGGGGCAGGG - Intronic
974139791 4:57870981-57871003 AGTCTGCAGAGTCTGGAGAAAGG + Intergenic
975001000 4:69223459-69223481 TGGGTGCACAGCAGGGACAACGG - Intergenic
975004438 4:69268811-69268833 TGGGTGCACAGCAGGGACAACGG + Intergenic
975012854 4:69377775-69377797 TGGGTGCACAGCAGGGACAAGGG + Intronic
975474214 4:74804277-74804299 AATGTGCTGAGTAGGAAGAAAGG + Intergenic
976260197 4:83138139-83138161 AGTGTGGAGAGCAGGGGCCATGG + Intergenic
976816779 4:89157657-89157679 AGTCTGCCGAGCAGGTAGTAGGG + Intergenic
978833932 4:113124567-113124589 AGTTTCCAGAGCAGTCAGAAAGG + Intronic
980826370 4:138078477-138078499 AGTGTGCAGAGCAGCTAACAAGG - Intergenic
981683164 4:147423413-147423435 AGTGTGCAGAGCACGGTGCTGGG - Intergenic
981991230 4:150923298-150923320 AGGATGGAGTGCAGGGAGAAGGG - Intronic
982106577 4:152016609-152016631 ATAGTGCACAGGAGGGAGAAAGG - Intergenic
983182029 4:164659108-164659130 AGTGAGCAGAGCAGTGAAACAGG - Intergenic
983573786 4:169238270-169238292 ACTCCGCACAGCAGGGAGAAAGG + Intronic
984344624 4:178506747-178506769 AGTGAGGAGAGCATAGAGAAGGG - Intergenic
984436050 4:179711678-179711700 AATGTGCAATGCAGAGAGAAAGG - Intergenic
984845698 4:184106424-184106446 AGTGTGGGGAGCTGGGAGAGGGG - Intronic
984893017 4:184510292-184510314 AGGGTGCCGAGCAAGGAGACAGG + Intergenic
984943759 4:184955336-184955358 AGGGAGGAGGGCAGGGAGAAGGG + Intergenic
985632691 5:1022187-1022209 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632703 5:1022228-1022250 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632713 5:1022269-1022291 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632725 5:1022310-1022332 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632735 5:1022351-1022373 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632747 5:1022392-1022414 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632757 5:1022433-1022455 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632769 5:1022474-1022496 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632781 5:1022516-1022538 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632791 5:1022557-1022579 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632803 5:1022598-1022620 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632815 5:1022639-1022661 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632825 5:1022680-1022702 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632837 5:1022722-1022744 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632849 5:1022763-1022785 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632861 5:1022805-1022827 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632871 5:1022846-1022868 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632883 5:1022888-1022910 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985632895 5:1022929-1022951 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632904 5:1022970-1022992 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632916 5:1023011-1023033 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632928 5:1023052-1023074 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632938 5:1023093-1023115 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632948 5:1023134-1023156 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632960 5:1023175-1023197 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632970 5:1023216-1023238 GGTGGGAAGAGCAGGGACAATGG - Intronic
985632982 5:1023257-1023279 GGTGGGAAGAGCAGGGACAACGG - Intronic
985632994 5:1023298-1023320 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633004 5:1023339-1023361 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633016 5:1023380-1023402 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633028 5:1023421-1023443 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633038 5:1023462-1023484 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633056 5:1023544-1023566 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633068 5:1023585-1023607 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633078 5:1023626-1023648 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633088 5:1023667-1023689 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633109 5:1023749-1023771 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633119 5:1023790-1023812 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633131 5:1023831-1023853 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633143 5:1023872-1023894 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633153 5:1023913-1023935 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633163 5:1023954-1023976 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633175 5:1023995-1024017 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985633187 5:1024036-1024058 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633197 5:1024077-1024099 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633209 5:1024118-1024140 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633219 5:1024159-1024181 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633229 5:1024200-1024222 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633239 5:1024241-1024263 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633249 5:1024282-1024304 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633261 5:1024323-1024345 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633271 5:1024364-1024386 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633283 5:1024405-1024427 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633293 5:1024446-1024468 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633305 5:1024487-1024509 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633317 5:1024528-1024550 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633327 5:1024569-1024591 AGTGGGAAGAGCAGGGACAATGG - Intronic
985633337 5:1024610-1024632 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633349 5:1024651-1024673 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985633361 5:1024692-1024714 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633371 5:1024733-1024755 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633381 5:1024774-1024796 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633393 5:1024815-1024837 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633401 5:1024856-1024878 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633413 5:1024897-1024919 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633421 5:1024938-1024960 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633431 5:1024979-1025001 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633441 5:1025020-1025042 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633453 5:1025061-1025083 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633463 5:1025102-1025124 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633475 5:1025143-1025165 AGTGGGAAGAGCAGGGACAAAGG - Intronic
985633483 5:1025184-1025206 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633493 5:1025225-1025247 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633503 5:1025266-1025288 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633513 5:1025307-1025329 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633523 5:1025348-1025370 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633533 5:1025389-1025411 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633543 5:1025430-1025452 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633553 5:1025471-1025493 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633563 5:1025512-1025534 AGTGGGAAGAGCAGGGACAACGG - Intronic
985633573 5:1025553-1025575 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633583 5:1025594-1025616 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633595 5:1025635-1025657 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633605 5:1025676-1025698 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633617 5:1025717-1025739 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633627 5:1025758-1025780 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633640 5:1025799-1025821 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633650 5:1025841-1025863 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633662 5:1025882-1025904 GGTGGGAAGAGCAGGGACAACGG - Intronic
985633674 5:1025923-1025945 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633684 5:1025964-1025986 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633694 5:1026006-1026028 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633706 5:1026047-1026069 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633716 5:1026088-1026110 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633729 5:1026129-1026151 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633741 5:1026170-1026192 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985633751 5:1026211-1026233 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633760 5:1026253-1026275 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633772 5:1026294-1026316 GGTGGGAAGAGCAGGGACAAAGG - Intronic
985633782 5:1026335-1026357 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633793 5:1026376-1026398 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633805 5:1026417-1026439 GGTGGGAAGAGCAGGGAAAAAGG - Intronic
985633823 5:1026499-1026521 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633835 5:1026540-1026562 GGTGGGAAGAGCAGGGACAATGG - Intronic
985633847 5:1026581-1026603 GGTGGGAAGAGCAGGGACAATGG - Intronic
986487575 5:8254285-8254307 ATTCTGCAGTGCAGGGAGTATGG - Intergenic
986822491 5:11482848-11482870 AGGGTGCAAAGCAGGGAGTGAGG + Intronic
987092642 5:14521805-14521827 AATGTGCAGAAGTGGGAGAAGGG - Intronic
988845162 5:35120120-35120142 AGTGGGTAGAGCATGGAGATGGG + Intronic
988970543 5:36463111-36463133 AAACTGCAGAGCAGGGGGAAAGG + Intergenic
989155794 5:38343645-38343667 GCTGTGCAGAGCAGGGTGGAGGG - Intronic
990533680 5:56698917-56698939 GGTAAGGAGAGCAGGGAGAATGG + Intergenic
990824921 5:59888268-59888290 GGTGGGCAGAGGAGGTAGAAGGG - Intronic
990906107 5:60805138-60805160 AATGTGCACAGCTGAGAGAAAGG + Intronic
991649785 5:68840067-68840089 AAGTTGCAGAGCAGGGAGATTGG - Intergenic
992085554 5:73275158-73275180 AATGTGGAGGGCAGGGAGATGGG + Intergenic
993137239 5:83984674-83984696 AGTTTGCAGAGCAGGAAGCCAGG + Intronic
993306716 5:86283583-86283605 AGTGTGCAGAGCAAGGACCCTGG + Intergenic
993453768 5:88104086-88104108 AGTGTGCAGAACACACAGAAAGG + Intergenic
996031202 5:118705840-118705862 AGTTTAAGGAGCAGGGAGAAGGG - Intergenic
996092192 5:119362285-119362307 AGTGTGGAGAGCAGTGATCATGG + Intronic
996354598 5:122581742-122581764 ACTCTGCACAGCAGGGAGACTGG - Intergenic
997201350 5:132011764-132011786 AGGCTGCAGGGCAGGGAGTAAGG - Intronic
997694510 5:135850591-135850613 AGTGTGAAGAGCAGGATGAGAGG - Intronic
997942241 5:138168607-138168629 AGGGTGCAGAGCCTGGAGGAAGG + Intronic
997963592 5:138339970-138339992 AGTGTGCAGGTGAGGGAGGATGG + Intronic
998565574 5:143213325-143213347 AGTGTGGGGAGGAGGAAGAAGGG - Intronic
998623533 5:143820674-143820696 ACTGTGCAGAGCAGAGGCAAAGG - Exonic
998900959 5:146853817-146853839 AGTATTCCAAGCAGGGAGAATGG - Intronic
999196304 5:149783922-149783944 TGTGTGCAGAGACGGGTGAAGGG - Intronic
999386180 5:151156007-151156029 AGTGTGCAGAGGAGGGGCCAGGG - Intronic
999729740 5:154467832-154467854 AGAGTGCAGAAGAGGGAGTATGG + Intergenic
999775725 5:154811743-154811765 ATTGTGGGGAGCAGGGAGAGGGG - Intronic
1001253478 5:170166377-170166399 AGTGTCCCAAGCAGGGAGCAAGG + Intergenic
1001586428 5:172836084-172836106 AGGGTGAGGTGCAGGGAGAAAGG - Intronic
1002052181 5:176577349-176577371 GGTGGGCAGAGCAGGGGGACAGG + Intronic
1002440417 5:179261731-179261753 AGTGTGCAGGGCAGGGTGTGTGG - Intronic
1002980237 6:2128826-2128848 AGAGCTCAGAGGAGGGAGAAAGG + Intronic
1003308652 6:4950050-4950072 TGAGTGCTGAGCAGAGAGAAGGG + Intronic
1003841878 6:10129011-10129033 AGTGGGCAGAACAGTGAGAATGG - Intronic
1004748578 6:18537676-18537698 AGTAGGGAGAGCAGGGAAAAAGG - Intergenic
1005110916 6:22280583-22280605 AGACTGCACAGCAGGCAGAAGGG + Intergenic
1005998833 6:30949720-30949742 AGTCTACAGAACATGGAGAAAGG + Exonic
1005999089 6:30951463-30951485 AGTCTACAGAACATGGAGAAAGG + Exonic
1006012278 6:31053170-31053192 AGTGGGCAAGGCAGGGATAAGGG + Intergenic
1006191125 6:32210190-32210212 AGTGTCAATAGCAGGGATAAAGG + Intronic
1006378756 6:33685729-33685751 CGTGTGCAGAGCAGTGAGATGGG + Exonic
1006514014 6:34536073-34536095 GGTGTGCCAGGCAGGGAGAAAGG + Intergenic
1006577186 6:35055110-35055132 AGTGTGCACATCAGGGAGAAAGG + Intronic
1008123965 6:47648187-47648209 AGTGTGCACTGCATGGACAAAGG - Intergenic
1012261872 6:97096822-97096844 AGTAAGCAGAGCAGTGAGACGGG + Intronic
1012374702 6:98547407-98547429 ACTGAGCAGAGCAGGGTGGAAGG - Intergenic
1012604822 6:101144854-101144876 AGGGTGCAGAGTAGGGTGAAGGG + Intergenic
1012955264 6:105563163-105563185 TGTGTGCAGAGCCAAGAGAAAGG - Intergenic
1013272810 6:108559441-108559463 AGTGGGGAGAGGAGGGAGAAGGG - Intergenic
1013733374 6:113197038-113197060 AGTCTGCATATCAGGGAGATAGG + Intergenic
1014410722 6:121116591-121116613 AGTGTGCAGTGGGTGGAGAAAGG + Intronic
1014975417 6:127875428-127875450 AGTCAACATAGCAGGGAGAAAGG + Intronic
1016410203 6:143775005-143775027 AGGGTGCATAACTGGGAGAAAGG + Intronic
1016889811 6:148994773-148994795 AGTGAGCAGGGCAAGGAAAACGG - Intronic
1017156186 6:151324505-151324527 AGTGGGCACAGCAAAGAGAAGGG - Intronic
1017192478 6:151668903-151668925 AGAGAGAAGAGCAAGGAGAATGG + Intronic
1017664615 6:156707484-156707506 AGTGGGCTGAGGAGAGAGAATGG + Intergenic
1017952052 6:159143498-159143520 AGAGTGCAGGGCAGGCAGAGAGG + Intergenic
1018471254 6:164100465-164100487 TGTGTGGAGACCAGGGAGCAGGG - Intergenic
1018638021 6:165881929-165881951 AGTGTGCCGCCCAGGCAGAAGGG + Intronic
1018671035 6:166177688-166177710 AGTGAGGTGGGCAGGGAGAAGGG + Intergenic
1018775446 6:167010493-167010515 TGTCTGGAGAGTAGGGAGAAGGG + Intronic
1019296600 7:280107-280129 AGTTTGCAGAGCATGTAGGATGG - Intergenic
1019349752 7:549227-549249 AGTATTCAGAGCAGAGATAAGGG + Exonic
1020188175 7:5974461-5974483 AGAGAGGAGAGTAGGGAGAAAGG + Intronic
1020294742 7:6750307-6750329 AGAGAGGAGAGTAGGGAGAAAGG - Intergenic
1022152039 7:27618160-27618182 AGTGTACAGAGCAGGGGGAAGGG - Intronic
1022385823 7:29898210-29898232 AGTGTACAGTGGAAGGAGAAAGG - Intronic
1022532450 7:31075558-31075580 AGTGAGAAGAGCATGGAGGAAGG - Intronic
1022661878 7:32375328-32375350 CATGAGCAGAACAGGGAGAAGGG + Intergenic
1023184003 7:37514653-37514675 AGCGTGCAGTGCAGCAAGAAGGG - Intergenic
1024284828 7:47748000-47748022 AGCGTGAAGATCTGGGAGAATGG - Intronic
1025016902 7:55446994-55447016 AGTGATCAAAGCAGGGTGAACGG + Intronic
1026494209 7:70888461-70888483 AGAGTGGGGAGAAGGGAGAAAGG + Intergenic
1026548852 7:71349337-71349359 TGTGCGCTGTGCAGGGAGAAAGG + Intronic
1026976111 7:74499381-74499403 AGTGTGCAAGGAAGGGAGGAAGG + Intronic
1028940664 7:96519031-96519053 AAAGTAGAGAGCAGGGAGAAGGG + Intronic
1029012942 7:97281939-97281961 ACTGTGGAGAGGAGAGAGAATGG + Intergenic
1029090108 7:98041165-98041187 AGTCTGCAGAGCAGTGATCAGGG - Intergenic
1029957170 7:104652248-104652270 GGTGTGTAGAGTATGGAGAAAGG + Intronic
1030015238 7:105212682-105212704 AGAGTGTAGAACAGGTAGAAAGG + Intronic
1030471671 7:109971706-109971728 ACTGGGGAGAGAAGGGAGAATGG + Intergenic
1031569565 7:123342317-123342339 AGTCTCCAGAGGATGGAGAAAGG + Intergenic
1032464276 7:132134084-132134106 AGTCTGCAGGGCAGGGACTAGGG + Intronic
1032709831 7:134451791-134451813 AGTCTGCACAGCAAGGAGGAGGG + Intronic
1033359201 7:140626240-140626262 GGTGTGCAGGGGACGGAGAAGGG - Intronic
1033547203 7:142412460-142412482 AGTTTGCAGGGGAGAGAGAATGG + Intergenic
1034165606 7:149022793-149022815 TCTGTGCCGGGCAGGGAGAAGGG + Intronic
1034204297 7:149302370-149302392 AGTGGGCAGTGCAGGGAGCCAGG - Intergenic
1034282192 7:149862170-149862192 TTTTTGCAGAGCATGGAGAACGG - Exonic
1034308470 7:150066249-150066271 GGTGTGCAGAGGGGGGATAAAGG + Intergenic
1034798383 7:154034422-154034444 GGTGTGCAGAGGGGGGATAAAGG - Intronic
1034817225 7:154182925-154182947 AGTGGGAAGAGAAGTGAGAAAGG - Intronic
1035104178 7:156428397-156428419 AGTTTGCAGAAGTGGGAGAAGGG + Intergenic
1035929776 8:3767267-3767289 AGTGTGCAGGTCGGGGAGAAAGG - Intronic
1036124134 8:6047665-6047687 TCTGTGCAGAGGAGGGAGACTGG + Intergenic
1037438174 8:18886768-18886790 CGTGTGCAGTGCAGGGCAAAAGG - Intronic
1037584275 8:20265790-20265812 TCTGCGCAGAGCAGGGAGATGGG - Intronic
1037596330 8:20357419-20357441 ACTGTTCATTGCAGGGAGAAAGG + Intergenic
1038080822 8:24134192-24134214 GCTGTGCTGACCAGGGAGAAGGG + Intergenic
1038312572 8:26455880-26455902 AGGCTGCAGAGGAGAGAGAAGGG - Intronic
1039436230 8:37561237-37561259 GATGTTCAGAGCAGGGACAATGG + Intergenic
1039443349 8:37611050-37611072 AGTGCTCAGAGCTGGGAAAAGGG - Intergenic
1039663053 8:39488001-39488023 TGTGTGATGAGCAAGGAGAAAGG + Intergenic
1039763195 8:40600175-40600197 GGACTGCAGAGGAGGGAGAAAGG + Intronic
1039898223 8:41731318-41731340 AGAGCTCAGAGCAGGGAGGATGG + Intronic
1039924297 8:41915455-41915477 TGGGTGCAGATAAGGGAGAAAGG - Intergenic
1040024646 8:42770566-42770588 AGGGTGCAGAGCAGGAGGATGGG + Intronic
1040070302 8:43181727-43181749 AGTGGGTAGGGCAGGGAGAGTGG + Intronic
1041421090 8:57667547-57667569 GGTGTGGAGAGCAGGCAGGAGGG + Intergenic
1042579689 8:70263232-70263254 AGTGTGGAGATGAGGGACAAAGG + Intronic
1043643927 8:82493109-82493131 AGAGTGCAGACCACAGAGAAGGG - Intergenic
1043768289 8:84164487-84164509 AGTGAGAAGTGTAGGGAGAAAGG - Intergenic
1044720218 8:95138087-95138109 AGAGTGTAGGGCAGGGACAAAGG - Intronic
1045730558 8:105234500-105234522 AGTGTGCAGTGAAGGGGGAAAGG - Intronic
1046325770 8:112643187-112643209 AGAGAGCAGAACAGGGATAACGG + Intronic
1046885865 8:119366353-119366375 AGTGGGCAGGGCAGAGAGACTGG - Intergenic
1047248784 8:123166315-123166337 GATGTACAGAGCAGGGAGCAGGG + Intergenic
1047591463 8:126331558-126331580 AGTGTGGAGGGCAGAGAGGAGGG - Intergenic
1047619710 8:126593838-126593860 AAAGTGCTGAGCAGAGAGAATGG + Intergenic
1047643286 8:126843748-126843770 ATAGTGCAGACCAGGGAGCAAGG - Intergenic
1048149009 8:131874963-131874985 AGTGAGGTGAACAGGGAGAAAGG + Intergenic
1048256117 8:132906506-132906528 AGAGGGCAGGGCAGAGAGAAAGG + Intronic
1048351997 8:133623922-133623944 AGGGTGCAGTGCTGGGAGAGGGG - Intergenic
1048396636 8:134020224-134020246 AGTGTGCAGAGGAGGGACTTTGG - Intergenic
1048467904 8:134682799-134682821 GGTGTGCAGAGTGGGGAAAAAGG - Intronic
1048878421 8:138854547-138854569 AGTGTGCTGAGCAGGCCAAAGGG - Intronic
1049239241 8:141528580-141528602 AGTGGGCAGAGGAGGGAGGAGGG + Intergenic
1049319499 8:141988469-141988491 ACTGAGAAGAGCAGGGAGCACGG - Intergenic
1049356817 8:142193129-142193151 AGAGGAGAGAGCAGGGAGAAGGG + Intergenic
1049492489 8:142912734-142912756 ACGGTGCAGAGCAGGGATCAGGG + Intronic
1050597945 9:7223072-7223094 AGTGGGGAGGGCAGAGAGAAAGG + Intergenic
1051516669 9:17937372-17937394 CGTGTGCAGTGAAGGCAGAAAGG - Intergenic
1052056257 9:23910960-23910982 AGTGGCCATATCAGGGAGAAGGG + Intergenic
1053163803 9:35830730-35830752 TGTGGGCAGACCGGGGAGAAGGG - Intronic
1053258239 9:36637767-36637789 AGTGGGCAGAACAGTGAGAAAGG - Intronic
1053430240 9:38037429-38037451 AGTGATCAGAGAAGAGAGAAGGG - Intronic
1054743653 9:68833326-68833348 AGTGTGCTTGGCAGAGAGAATGG + Intronic
1054805660 9:69393860-69393882 AGATTCCAGAGCAGTGAGAAAGG - Intergenic
1054805979 9:69396082-69396104 AGAATGCAGAGCAGGAAGAGGGG + Intergenic
1055380173 9:75697987-75698009 AGTGTTCAGAGCAGAGAAAAAGG + Intergenic
1055416519 9:76090225-76090247 AATGTGGGGTGCAGGGAGAAGGG - Intronic
1055449504 9:76418133-76418155 AGTGGGCAGAGAGGGGAGGAGGG + Intergenic
1056054611 9:82807984-82808006 AGTGTCCAAGGCAGAGAGAAAGG - Intergenic
1056224509 9:84482193-84482215 AGTCTGCAGGGCAGAGAGAAGGG - Intergenic
1056286438 9:85092080-85092102 AGTGTGAAGAGAAGAGAGCAGGG + Intergenic
1056599726 9:88037103-88037125 AGTGTCCACAGAAGGGAGGAAGG - Intergenic
1056884168 9:90424106-90424128 AGTGTGCAGTGAAGGGGGAAGGG - Intergenic
1057251846 9:93509316-93509338 AGTGGGCTCAGCAGGGAGCATGG + Intronic
1057705119 9:97390402-97390424 ACTCTGCAGAGCAGAGAGGATGG + Intergenic
1058654417 9:107207096-107207118 AGGGGGCAGAGAATGGAGAAAGG + Intergenic
1058706166 9:107639584-107639606 AGTGTGCAGGGGAGGGAGGAGGG - Intergenic
1059325904 9:113503861-113503883 AGTGTGGAAAGCTGGGGGAAAGG - Intronic
1059528987 9:115018404-115018426 AGTACACAGAGCAGGGAGAAGGG + Intergenic
1059921235 9:119162223-119162245 AGTTTGCTGAGAAGGGAGGAGGG + Intronic
1060224013 9:121780555-121780577 AGTGTGTGGAGCAAGGAGAAGGG + Intronic
1060291951 9:122311351-122311373 AGAGTGGAGTGCAGTGAGAAGGG - Intronic
1060375816 9:123114665-123114687 AGGGTACAGAGGAGGTAGAATGG - Intronic
1060819446 9:126652829-126652851 TGTGGGCACAGCAGGGACAATGG + Intronic
1060877052 9:127091161-127091183 ACATTGCAGAGTAGGGAGAAGGG - Intronic
1060913601 9:127370391-127370413 AGTGTGCTGCCCAGAGAGAAGGG + Intronic
1061231262 9:129317179-129317201 AGTGTGCAGAGAAGGAACAAGGG - Intergenic
1061791738 9:133062758-133062780 AGTGTGGAGAGCAGGCAGACGGG + Intronic
1061932011 9:133838168-133838190 AGAGAGCAGAGCAGGTACAAAGG - Intronic
1062059501 9:134487378-134487400 AGGGCACATAGCAGGGAGAAGGG - Intergenic
1062633867 9:137479656-137479678 AGGGAGCAGAGGAGGGAGACGGG + Intronic
1187362286 X:18640243-18640265 AGAGTGCAGTTCAGGGAAAAAGG - Exonic
1187713508 X:22077843-22077865 ATTCTGCAAAGCCGGGAGAAGGG - Intronic
1188852938 X:35154018-35154040 AGTGAGTACAGCAGTGAGAATGG + Intergenic
1189510727 X:41658621-41658643 AGTGTGAAGAGGTGGGAGAGGGG + Intronic
1189681164 X:43518220-43518242 AGTGGGAAGTGGAGGGAGAAAGG - Intergenic
1190118264 X:47639588-47639610 ATTGTGGAGAGAAGAGAGAAAGG - Intronic
1190366459 X:49698934-49698956 AGTGTTCAGAGCAGTGAGAAAGG + Intergenic
1190699578 X:52977279-52977301 GGTGTGCGGGGCAGGGAGAGAGG - Intronic
1190839838 X:54133731-54133753 AGTGTTAAGAGCAGGGAGGTAGG + Intronic
1190969526 X:55335149-55335171 AGGGTGCAGAAGAGAGAGAAAGG - Intergenic
1191001452 X:55663707-55663729 GGTGTGCGGGGCAGGGAGAGAGG + Intergenic
1191791370 X:64975826-64975848 AGCGGGCGGAGCTGGGAGAATGG - Intronic
1192941790 X:75920506-75920528 AGACTGCAGAGCAGGAAAAATGG - Intergenic
1193093974 X:77527335-77527357 AGCATGGAGAGCAAGGAGAAGGG + Intronic
1193162072 X:78239761-78239783 GCTGTGAAAAGCAGGGAGAAAGG + Intergenic
1193734516 X:85141105-85141127 TGTATGCAAAGCAGGCAGAAAGG + Intergenic
1195144293 X:101998017-101998039 AGTGTGCAGATTAGAAAGAAAGG + Intergenic
1195875495 X:109536520-109536542 AGTGGGCAGAGCTTGGGGAAAGG - Intronic
1195977712 X:110545543-110545565 AGAGTGCACAGCAGGCAGAATGG - Intergenic
1198959047 X:142164525-142164547 AGTGGGCAGGGCAGGAAGAGTGG - Intergenic
1200180446 X:154147242-154147264 ATTGGGCAGTGCAGGGACAAGGG - Intronic
1200186274 X:154185637-154185659 ATTGGGCAGTGCAGGGACAAGGG - Intergenic
1200191926 X:154222775-154222797 ATTGGGCAGTGCAGGGACAAGGG - Intronic
1200197681 X:154260579-154260601 ATTGGGCAGTGCAGGGACAAGGG - Intronic