ID: 1071503519

View in Genome Browser
Species Human (GRCh38)
Location 10:86219550-86219572
Sequence TAGTGTGCAGAGCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 445}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503519_1071503526 4 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503526 10:86219577-86219599 CCTACAGCCCTGGTCACGTGTGG No data
1071503519_1071503529 24 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503529 10:86219597-86219619 TGGCCCCCCGTCCCAGAGTGAGG No data
1071503519_1071503534 29 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503534 10:86219602-86219624 CCCCGTCCCAGAGTGAGGGCAGG No data
1071503519_1071503530 25 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503530 10:86219598-86219620 GGCCCCCCGTCCCAGAGTGAGGG No data
1071503519_1071503522 -6 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503519 Original CRISPR TAGTGTGCAGAGCAGGGAGA AGG (reversed) Intronic
900204451 1:1426130-1426152 GAGTGAGCAGGGGAGGGAGACGG + Exonic
900416985 1:2539905-2539927 CAGTGTGCAGTGCAGGGACTGGG - Intergenic
901766051 1:11500971-11500993 TAGTCTGCAGGAGAGGGAGAGGG - Exonic
902772274 1:18652160-18652182 GGGTGTGCAGAGCCGGTAGAGGG + Intronic
903801253 1:25970164-25970186 TAGTGTCCAGAGCACAGAGACGG + Intronic
904298882 1:29541466-29541488 CAGAAGGCAGAGCAGGGAGATGG + Intergenic
905300937 1:36985821-36985843 TGATGTGCACAGCAGGGAGACGG - Intronic
905603090 1:39270775-39270797 ATGTTTGCAGAGCAGGGATATGG + Intronic
908921958 1:69205842-69205864 TAGTTTCCAGAGCACAGAGATGG + Intergenic
909662938 1:78104165-78104187 TGGTGTGTAGAGGGGGGAGAGGG + Intronic
909950544 1:81714464-81714486 TATGGGGCAGGGCAGGGAGAAGG + Intronic
911596887 1:99808043-99808065 TAGTGTGTGGGGCAGGGAGAAGG + Intergenic
912449577 1:109760838-109760860 TGGTGGGGAGAGCAGGCAGAGGG - Intronic
912902046 1:113661717-113661739 TTGTGTGCAGAGAAAAGAGAAGG + Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913402867 1:118455337-118455359 TTGTGTGCAGCGCAGGGACTTGG - Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915638324 1:157201988-157202010 TAGGGGGCAGGGCAGGGAGCTGG + Intergenic
916664283 1:166951330-166951352 GAGAGTGCAGAGCCAGGAGATGG + Intronic
916786110 1:168088247-168088269 AGGTGGGCAGAGCAGGCAGAGGG + Intronic
917193912 1:172446704-172446726 GAGGGTGGAGATCAGGGAGAAGG + Intronic
917245819 1:172999141-172999163 AAGTGTGCAGAGCAGGTATGTGG + Intergenic
918128066 1:181601769-181601791 TTCTGTGCAGAGCGGGGACATGG - Intronic
918202910 1:182283854-182283876 TAGTTTTCAGAGCAGGGAGAAGG + Intergenic
918224725 1:182471208-182471230 CAGTGTGCAAGGCTGGGAGAGGG + Intronic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
919931102 1:202222135-202222157 GAGCGTGCAGAGCTGGAAGAGGG - Intronic
920988079 1:210909308-210909330 GAGTGTGTAAAGGAGGGAGAAGG - Intronic
921622658 1:217343241-217343263 TTGTGTGCAGAGTAGGGCAATGG - Intergenic
921735218 1:218619877-218619899 TAGTGAGAAGAGCTGTGAGATGG + Intergenic
922584348 1:226722433-226722455 CAGTCTGCAGAGGCGGGAGACGG + Intronic
922720762 1:227899200-227899222 GAGTGGCCAGAGCAGGGGGAGGG + Intergenic
923555977 1:235000558-235000580 GAGTGGCCAGAACAGGGAGAAGG + Intergenic
924615100 1:245606022-245606044 GTGTCTGCAGAGCAGGCAGAAGG - Intronic
924817717 1:247457264-247457286 TAGTGAGCTGAGCAGGGCCATGG - Intergenic
1063425690 10:5948428-5948450 GCGTGGGGAGAGCAGGGAGAGGG + Intronic
1063680381 10:8181717-8181739 TAGTCTGCAGGTCAGGGAGCAGG + Intergenic
1063838671 10:10045789-10045811 CAGTTTGCAGAACAGGGAGTTGG - Intergenic
1063938950 10:11107823-11107845 TAGGGGGCAGAGGAGGGAGGAGG - Intronic
1065144695 10:22756337-22756359 TATTGTGCAAAGAAGGGAGGAGG - Intergenic
1065251021 10:23814158-23814180 TATTTTGCAGGGCAGGGAGGGGG + Intronic
1065444058 10:25779550-25779572 TAATGTGCAGAGCCAGAAGACGG - Intergenic
1065623301 10:27605850-27605872 GAGTGTGCAGGGCAGGGAAGGGG + Intergenic
1067111226 10:43401941-43401963 AATTGTGCAGAACAGAGAGATGG + Intronic
1067292776 10:44956465-44956487 GTGTGATCAGAGCAGGGAGAAGG + Intergenic
1067450088 10:46376735-46376757 GGGTGTGCAGAGCCGGGAGCCGG - Intronic
1067558071 10:47286025-47286047 CCGTGTGCAGAGCAGGCAGAGGG + Intergenic
1067668581 10:48299824-48299846 ATCTGTGCAGAGCAGGGAGCAGG - Intergenic
1068322346 10:55435583-55435605 TACTTTGCAGAGCAGGAGGATGG - Intronic
1069135939 10:64766046-64766068 CAGTTTGCAAATCAGGGAGATGG + Intergenic
1069887632 10:71634093-71634115 CAGGGTGCAGAGCTGGGAGCTGG - Intronic
1071503519 10:86219550-86219572 TAGTGTGCAGAGCAGGGAGAAGG - Intronic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1074443702 10:113500595-113500617 TTGTGTGCAGAACAGCAAGAAGG - Intergenic
1074997710 10:118772154-118772176 AAGTTGGCAGAGCAGGAAGATGG + Intergenic
1075096518 10:119474981-119475003 GAGTGGTCGGAGCAGGGAGAAGG + Intergenic
1075923730 10:126234532-126234554 TACTGGGCAGAGCAGGCACATGG - Intronic
1076209953 10:128632409-128632431 GAGGGTGCGGAGCAGGTAGAAGG + Intergenic
1076594340 10:131616608-131616630 AAGTCTGCACAACAGGGAGAGGG - Intergenic
1076728603 10:132426090-132426112 TGGTTTACAGAGCAGGGAGCAGG + Intergenic
1076898210 10:133324712-133324734 TAGTGTTCAGTGCCGGGAGTTGG + Intronic
1077159855 11:1107766-1107788 TGGTGGGCAGGGCAGGGAGGAGG + Intergenic
1077199515 11:1298507-1298529 AAGAGTGCAGAGCAAGGAGATGG - Intronic
1077357969 11:2127356-2127378 GAATTTGCAAAGCAGGGAGAGGG + Intergenic
1077482375 11:2821817-2821839 GGGTGTGCAGAGCAGGGATGTGG - Intronic
1077794079 11:5472492-5472514 TAGAGCTCAGAGCAGGGAGTGGG - Intronic
1077814029 11:5667795-5667817 TAATGTGCTGAGAATGGAGATGG + Intronic
1078094290 11:8287105-8287127 GAGTGTGGAGAGCAGGCAGTGGG - Intergenic
1078348939 11:10576420-10576442 TCTTGTGCAGAGCAGGCTGATGG - Exonic
1078372264 11:10758312-10758334 AAGTAGGGAGAGCAGGGAGAAGG + Intronic
1078632045 11:13011263-13011285 GTGAGTGCAGAGCAGGGTGAGGG + Intergenic
1079478013 11:20851539-20851561 AAGTGAGCTGAGAAGGGAGAGGG - Intronic
1080046864 11:27817963-27817985 GAAAGTGCAGACCAGGGAGAGGG - Intergenic
1080425893 11:32154018-32154040 TAGTGTACAGGGCAGGAAGAAGG + Intergenic
1080693186 11:34576781-34576803 TAGTGTAAAGAGCAGAGAAATGG + Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1081991781 11:47341966-47341988 GAGTGTGCAGGGCAGGTGGATGG - Intronic
1082783301 11:57302867-57302889 TAGGCTTCAGGGCAGGGAGATGG - Intronic
1083483562 11:62966512-62966534 CAGGCTGCAGAACAGGGAGAGGG + Intronic
1084709011 11:70832510-70832532 CAGTGTGCAGGGCAGGGAGGAGG - Intronic
1084975900 11:72798133-72798155 AAGTGTGCAGAGTAAAGAGAGGG - Intergenic
1085029979 11:73265130-73265152 TGGTGTGCTGAGCTGGGTGATGG + Intronic
1085099425 11:73788059-73788081 GAGGGTGCAGAGCGGGGAGGTGG + Intronic
1085571099 11:77558683-77558705 CAGTGGGCAGAGCAGGGTGAAGG - Intronic
1085994533 11:81894423-81894445 AAGTGTGCTGAGCAATGAGAAGG + Intergenic
1086164745 11:83764458-83764480 GGGTGTGCAGGGAAGGGAGAAGG + Intronic
1086227652 11:84531624-84531646 TATTGTGAAGAGGAGGGAAAGGG - Intronic
1087368518 11:97251786-97251808 AAGTGTTTAGAGCAGGGAGCAGG - Intergenic
1087663728 11:101017936-101017958 TAGAGTTCAGAGAAGGGAGAAGG - Intergenic
1088646951 11:111925150-111925172 AAGTCAGCAGAGGAGGGAGAAGG + Intronic
1088823708 11:113476466-113476488 GACTCTGCAGAGCAGGGAGTCGG + Intergenic
1088983899 11:114888897-114888919 TAGAGTTCAGAGGAGGGAGGGGG + Intergenic
1089606075 11:119642154-119642176 TAGTGGGCAGTTCTGGGAGAGGG + Intronic
1090619261 11:128547129-128547151 GACTGACCAGAGCAGGGAGAAGG + Intronic
1091608322 12:1978190-1978212 TAGTTTCCAGATCAGTGAGAAGG - Intronic
1091671557 12:2455809-2455831 TGGCTTGCAGAGCAGGGACATGG - Intronic
1091760544 12:3084443-3084465 TAGTCGGTGGAGCAGGGAGAGGG + Intronic
1091779839 12:3206914-3206936 GAGGGTCCAGGGCAGGGAGAAGG + Intronic
1091929905 12:4387384-4387406 TTGTGTGCAGAGTAGGGAGAAGG + Intergenic
1092969984 12:13684272-13684294 TAGTGTTCAAAGCAGGGATCTGG - Intronic
1094420904 12:30270386-30270408 GTGTGTGCAGAGCAAAGAGAAGG + Intergenic
1094428133 12:30337098-30337120 GTGTGTGCAGAGCAAAGAGACGG - Intergenic
1096137812 12:49217160-49217182 TAGTTTGTAGAGTAGGGGGAGGG + Intronic
1096259610 12:50082383-50082405 TAGCGTCCAGCTCAGGGAGAAGG + Exonic
1096559718 12:52426854-52426876 GATTGGGAAGAGCAGGGAGAAGG + Intronic
1096968468 12:55647212-55647234 TAGTTCGCAGAGCAGAGAGTGGG + Intergenic
1097668247 12:62506053-62506075 TAGTGAGTTGAGCAGTGAGAGGG + Intronic
1097691986 12:62742068-62742090 TAGTGGGCAAGGCAGGGAGGGGG + Intronic
1099968415 12:89475412-89475434 CAGTGACCAGAGCAGGGGGAAGG - Intronic
1102017629 12:109658174-109658196 CACTGGGCAGAGCAGAGAGAGGG + Intergenic
1102029542 12:109731979-109732001 CAGGGTGCACAGCAGTGAGAAGG - Intronic
1102103689 12:110301541-110301563 TAGTGTGCTGACCAAGGAAACGG - Intronic
1102226891 12:111235180-111235202 TAGTGAGCAGTGCTGGGAGGCGG + Intronic
1102677820 12:114669997-114670019 TAGGGAGCAAAGCAGGGAGACGG - Intergenic
1103218254 12:119220430-119220452 TAGAATTCAGAGCAGGGAGGTGG - Intronic
1103417422 12:120752399-120752421 TGGTGTGCAGCGCAGTGAGGAGG + Intergenic
1103518721 12:121523888-121523910 TTCTGTGCAGAGGAGGGTGAAGG - Intronic
1103839266 12:123849593-123849615 AAGTGTGCAGGGCATGGAGGGGG - Intronic
1103948484 12:124539778-124539800 CAGGGTGGAGAGCAGGGTGACGG - Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104368103 12:128196129-128196151 AAGGGTGCAGATCAGAGAGAAGG + Intergenic
1105205232 13:18217737-18217759 GAGAGGGCAGAGCAGGGAGATGG - Intergenic
1106648021 13:31657514-31657536 TAGTGTACACAGCAGTGATAGGG - Intergenic
1107565572 13:41600480-41600502 AAGAGTGCAGAGCAAAGAGAGGG - Intronic
1107612647 13:42131818-42131840 AACTGAGAAGAGCAGGGAGATGG - Intronic
1109067441 13:57716491-57716513 GAGAGTGGAGAGCAGAGAGAGGG - Intronic
1110347631 13:74466369-74466391 TAGTCTGCAGAGCAGCAACATGG - Intergenic
1110871674 13:80459631-80459653 TGTTGTGCAGAGCTTGGAGAAGG - Intergenic
1111560337 13:89936540-89936562 TAGGGGCCAGAGCGGGGAGATGG - Intergenic
1112195485 13:97222080-97222102 TAATTGGCAGAGCAGAGAGAGGG - Intronic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1114620358 14:24092857-24092879 GAGGAAGCAGAGCAGGGAGATGG - Intronic
1117098228 14:52318663-52318685 TAGTGGACAGAGGAGGGAAATGG + Intronic
1118153127 14:63211148-63211170 TAATGGCCAGAGCAGGGAGTGGG + Intronic
1118577759 14:67260558-67260580 TAGTTTGTAGAGGAGAGAGAGGG + Intronic
1119030465 14:71188331-71188353 CAGTGTGCAGTGAAGGGAGCTGG + Intergenic
1120842320 14:89096929-89096951 TAGTCTCCAGGGCAGGGAGGTGG + Intergenic
1121080908 14:91107706-91107728 TAGATTCCAGAGCAGGGAGATGG + Intronic
1121232616 14:92368907-92368929 TAGGGAGCTGAGCAGGGGGAGGG - Intronic
1121334873 14:93071086-93071108 TTGTGTTTAGAGCAGGGAGTTGG - Intronic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122544193 14:102513212-102513234 GAGTATGCACTGCAGGGAGACGG + Intergenic
1122787689 14:104171526-104171548 AGGTCAGCAGAGCAGGGAGAAGG - Intronic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1125931734 15:43604941-43604963 TAGGGTGCTGAGCTGGGAGCAGG - Intronic
1126059381 15:44765002-44765024 GAGTATGCTGAGCAGGGAAATGG + Intronic
1126389043 15:48126163-48126185 TCATGAGCAGAGCAAGGAGAAGG - Intronic
1126757897 15:51942099-51942121 TAGTGTGCAAAGCACAGAGAGGG + Intronic
1126841701 15:52723567-52723589 TAGTGTGGAAAGGAGGGAGAAGG - Intergenic
1128339109 15:66808213-66808235 AGGTGAGCAGAGCAGGGACAGGG - Intergenic
1129474948 15:75778753-75778775 TAATGTACAGAGCAGGCATATGG + Intergenic
1129655882 15:77525589-77525611 TAGCCTGCTCAGCAGGGAGAAGG + Intergenic
1130130540 15:81137841-81137863 TATGGTGCAGGGCAGGGAGTAGG + Intronic
1132793294 16:1705909-1705931 AAGTGTGCAGAGCCTGGAGACGG + Intergenic
1133108055 16:3526926-3526948 TGGGATGCAGTGCAGGGAGAGGG + Intronic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1134028119 16:10970172-10970194 TAGTCAGCAGAGCAGCAAGATGG - Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1138689107 16:58751157-58751179 GAGTATGGAGAGCAGGGAGAGGG + Intergenic
1139656673 16:68391659-68391681 CAGTAGGCAAAGCAGGGAGATGG + Intronic
1140205834 16:72932634-72932656 TTTGGTGCGGAGCAGGGAGATGG - Intronic
1140732121 16:77865810-77865832 GAGTGGGAAGAGAAGGGAGATGG + Intronic
1141206890 16:81939587-81939609 TTGTTTGCAGAGCAGGAAGGTGG - Intronic
1141391931 16:83672065-83672087 CAGTGGGCAGAGCAGGGAAATGG + Intronic
1142263644 16:89053827-89053849 AATAGTGCAGTGCAGGGAGAAGG + Intergenic
1142308012 16:89296316-89296338 GAGAGAGCAGGGCAGGGAGACGG - Intronic
1142385361 16:89760558-89760580 TAGGGTGGAGGTCAGGGAGAGGG - Intronic
1142721992 17:1782568-1782590 GAGGATGCAGAGTAGGGAGAAGG + Intronic
1143272682 17:5687477-5687499 TGGTGTGCCCAGCAGGCAGAGGG + Intergenic
1143373262 17:6453596-6453618 TAGTGGGGAGAGCAGGGATGGGG + Exonic
1143795086 17:9329880-9329902 TAGGGTGGAGGGGAGGGAGAGGG + Intronic
1146480219 17:33199095-33199117 GAGATTGCAGAGCAGGGAGCAGG + Intronic
1147617198 17:41836403-41836425 TATTATGAAGAGCAGGGTGAAGG + Intronic
1147726457 17:42568728-42568750 TGGTGTCCAGAGAAGGCAGATGG - Intronic
1147841128 17:43372244-43372266 TCGTGTGCAGAGACGAGAGACGG + Intergenic
1148805357 17:50261141-50261163 TGGTGTGAAGAGCATAGAGAAGG + Intergenic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1149515183 17:57275720-57275742 TAGTGTGTAGAGGACGGAAAGGG + Intronic
1149674434 17:58446785-58446807 TACTGTGTAGAGCTGGGACAGGG - Intronic
1149939580 17:60849441-60849463 TAGTGTGCAGAGGAGAGTAATGG + Intronic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151146662 17:72047472-72047494 GAGTGCACACAGCAGGGAGAGGG + Intergenic
1151510996 17:74560011-74560033 TAGTGTGCTGAGCAAGGACATGG - Intergenic
1152771765 17:82174142-82174164 TGGAGTGCAGAGTAGGGAGCAGG - Intronic
1153664388 18:7355099-7355121 GTGTGTCCAGAGCAGGGTGACGG - Intergenic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1154066724 18:11113505-11113527 GGGTGGGCAGAGCAGGAAGAAGG - Intronic
1154316099 18:13304381-13304403 AAGAGTGCAGAGATGGGAGATGG + Intronic
1154371118 18:13764054-13764076 TAGCCTGCATGGCAGGGAGAGGG + Exonic
1155358877 18:24980635-24980657 GTGTGTGCAGAACAGGGAGTGGG - Intergenic
1155709715 18:28861158-28861180 TAGTGTCCAAGGCAGGAAGAAGG - Intergenic
1156008187 18:32468765-32468787 CAGTGTGCAGAGATGAGAGAAGG + Intronic
1156463058 18:37332484-37332506 GAGTGGGGAGAGCAGAGAGAAGG - Intronic
1156496934 18:37531832-37531854 TTGGGTGCAGGGCAGTGAGAGGG + Intronic
1158794908 18:60833244-60833266 TACTGTGCAGTGGAGGAAGAAGG + Intergenic
1158950795 18:62493012-62493034 CGGTGTCCAGAGCAGGGAGTAGG + Intergenic
1159752887 18:72324728-72324750 CTGTGTGCAGACCAGGAAGAGGG + Intergenic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160154274 18:76421530-76421552 TTCTGTGGAGAGCAGGGGGAGGG - Intronic
1160517909 18:79488628-79488650 GAGGCTGCAGAGCAGGGACATGG - Intronic
1160590932 18:79944281-79944303 TAGTGTGCAGAGCAGCAGGTGGG + Intronic
1160624236 18:80192270-80192292 TGGGGTGCAGTGCAGGCAGAGGG + Intronic
1160814731 19:1029652-1029674 ATGGGTGCAGAGCAGGGAGAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160832648 19:1110930-1110952 TGGTGAGCAAAGCAGGGAGAGGG - Intronic
1160975493 19:1790443-1790465 AAGTGGGCAGTGGAGGGAGAGGG - Intronic
1161140225 19:2642869-2642891 AGGTGTGCAGAGCCCGGAGAGGG - Intronic
1161140263 19:2643054-2643076 AGGTGTGCAGAGCCCGGAGAGGG - Intronic
1161140275 19:2643118-2643140 AGGTGTGCAGAGCCCGGAGAGGG - Intronic
1163327985 19:16617602-16617624 TGGGGTGGAGAGAAGGGAGAGGG - Intronic
1163659397 19:18567788-18567810 CAGTTTACAGAGCAGGGAGCTGG + Intronic
1165077449 19:33287847-33287869 CAGTGCACAGAGCAGGGAGTGGG - Intergenic
1165784196 19:38451648-38451670 GATTCTGCAGAGCAGGGAGGAGG + Intronic
1165803771 19:38568113-38568135 TAGTGAGCAGGGAAGGGACAAGG - Intronic
1166135860 19:40776872-40776894 TTATGTGGAGATCAGGGAGAAGG + Intronic
1166348560 19:42182435-42182457 TGGTGAGCAGAGCAGAGTGAGGG + Intronic
1166967325 19:46537108-46537130 TTGTTTGCAGAGGAGGGACAGGG + Intronic
1166990983 19:46692596-46692618 TTGTGAGCAGAGGAGGGACAGGG - Intronic
1167721021 19:51180396-51180418 GAGTAAGCAAAGCAGGGAGAAGG + Intergenic
1167744558 19:51342899-51342921 GACTGGGCAGAGGAGGGAGACGG - Intergenic
1168136874 19:54357626-54357648 CACTGTGCAGAGGAGGGTGAAGG - Intronic
1168161208 19:54511465-54511487 CACTGTGCAGAGGAGGGTGAAGG + Intergenic
1168340724 19:55621731-55621753 TAGGCTGCAGACCAGGGACATGG - Exonic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
925203245 2:1985935-1985957 GAGGGTGCAGAGCTGGGAGCTGG + Intronic
925613208 2:5720744-5720766 AGGAGTGCAGTGCAGGGAGATGG + Intergenic
925741858 2:7012362-7012384 TATTGTCAAGTGCAGGGAGATGG + Intronic
925741864 2:7012397-7012419 TATTGTCAAGTGCAGGGAGATGG + Intronic
927081763 2:19637467-19637489 GAGTGTTGAGTGCAGGGAGAAGG + Intergenic
927181747 2:20451590-20451612 CAGTGTACAGAGTAGGGAGGTGG + Intergenic
928234691 2:29529401-29529423 TAGTGCTCAGAGCAGCGAGGGGG - Intronic
928298290 2:30104437-30104459 GAGTCTGCAGAGCAGGCAGGTGG - Intergenic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
931997329 2:67851742-67851764 GATTGTGCAGAGCCAGGAGAGGG + Intergenic
932030883 2:68183329-68183351 TAGGGTGGAGTGCTGGGAGAAGG - Intronic
932283181 2:70512359-70512381 CAGTCTGCAGAGGAGGGAGGTGG - Intronic
933384867 2:81597359-81597381 TACCGAGCAGAGCAGGGAAAGGG - Intergenic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
934901945 2:98166485-98166507 TCGTGTGCAGCACAGAGAGAAGG + Intronic
935259400 2:101342015-101342037 CACTGTCGAGAGCAGGGAGAGGG + Intergenic
936665545 2:114591087-114591109 TCCCATGCAGAGCAGGGAGAAGG + Intronic
937164917 2:119804420-119804442 TTGGGTGGAGGGCAGGGAGAGGG - Intronic
937271688 2:120656908-120656930 GAGTAAGCAGAGAAGGGAGAGGG - Intergenic
938065749 2:128281134-128281156 GAGGGGGCAGGGCAGGGAGATGG - Intronic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
938920703 2:135992132-135992154 AAGTCTCCAGAGCAGCGAGAAGG - Intergenic
939895922 2:147791328-147791350 TAGTGTGCTTAGTAGGAAGAAGG - Intergenic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943778338 2:191792851-191792873 TAGATTGGGGAGCAGGGAGAAGG + Intergenic
943853890 2:192763543-192763565 AAGTGGGAAGAGTAGGGAGAAGG + Intergenic
944937464 2:204584136-204584158 TAGTGGGCAGAGGAGAGAAATGG + Intronic
946181312 2:217950783-217950805 AAGAGTGCAGAGGAGGAAGAGGG - Intronic
946188061 2:217992338-217992360 CAGTGTGCAGAGCAGGTGGGAGG + Intronic
947517285 2:230816949-230816971 GAGTGTGCAGAGCCGGCAGTGGG - Intronic
948154535 2:235770814-235770836 TGGTGTGGTGAGCAGGAAGATGG + Intronic
948395923 2:237645032-237645054 TTGCTTCCAGAGCAGGGAGAGGG - Intronic
948506877 2:238434292-238434314 AGGTGTCCTGAGCAGGGAGAGGG - Intronic
948673450 2:239583475-239583497 AAGTGTGGAGACCAGGCAGATGG + Exonic
948730310 2:239959310-239959332 TAGTGTCCTCAGCAGTGAGAGGG - Exonic
948770419 2:240248824-240248846 AAGTGTGCAGTTGAGGGAGATGG - Intergenic
949045026 2:241868651-241868673 CAGTGTGCAGGGCAGAGAGATGG + Intergenic
1168835653 20:875663-875685 AAGTGTGCAGAGCAGTGTCACGG + Intronic
1169275552 20:4231568-4231590 TAATGTGCAGAGGAAGGAAAAGG + Intronic
1170872065 20:20214870-20214892 TAGGGCGCAGGGCAGGCAGAAGG + Intronic
1171197401 20:23210920-23210942 TAAGGTGCCGAGCTGGGAGAGGG + Intergenic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171816151 20:29787602-29787624 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1171902214 20:30868441-30868463 TGGTGTGCAGAGGAGGGAGCCGG - Intergenic
1172046830 20:32086423-32086445 TAGTGTGCACAGCTGGGAAGTGG + Intronic
1172188925 20:33049908-33049930 GAGTGGGCTGAGAAGGGAGAAGG - Intergenic
1172210318 20:33193339-33193361 GAGTGTGGAGAGCACCGAGAGGG - Intergenic
1172369703 20:34379494-34379516 TAGTTACCAGAGCAGGGAGGAGG - Intronic
1172845828 20:37929554-37929576 TGGTGAGTAGAGCAGGGACAGGG + Intronic
1173002144 20:39112053-39112075 TAGAGGCCAGAGCAAGGAGAAGG - Intergenic
1173657321 20:44709378-44709400 TCGTGTGCAGAAGAGGGCGAAGG - Intergenic
1175039843 20:56038444-56038466 TAAAGTGCAAAGCAGGGAGCAGG - Intergenic
1176907576 21:14521708-14521730 TGGGGTGGAGGGCAGGGAGACGG + Intronic
1177295326 21:19166275-19166297 CATTGTTTAGAGCAGGGAGAGGG + Intergenic
1179788574 21:43743106-43743128 TAGTGCTCAGAGCGGGGGGAGGG - Intronic
1180023330 21:45143244-45143266 GAGTTTGGAGAGCAGGGGGAAGG - Intronic
1180319606 22:11308166-11308188 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1180730660 22:17979682-17979704 TGGTGTGCTGGGCTGGGAGAAGG - Intronic
1180829004 22:18888244-18888266 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1180875927 22:19175265-19175287 GAGTGTTCAGAGCAGGGGGCTGG - Intergenic
1181525686 22:23484397-23484419 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1182118551 22:27772415-27772437 GAGTGTGGGGAGGAGGGAGACGG + Intronic
1182768589 22:32776767-32776789 TAAAGTGCAGTGCACGGAGAAGG + Intronic
1182835176 22:33336000-33336022 TAGTGTGCAGAATAAGTAGAAGG + Intronic
1183367193 22:37412988-37413010 CAGGGTGCAGAGCAGGGATTTGG - Intronic
1184059574 22:42073977-42073999 AAGTGGGCCGAGCAGGGAGAGGG + Intergenic
1184158465 22:42684219-42684241 TTCTGTGCAGAAGAGGGAGAGGG + Intergenic
1184672948 22:46025158-46025180 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184672975 22:46025297-46025319 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184673022 22:46025520-46025542 CAGCGTGCACTGCAGGGAGAGGG - Intergenic
1184673040 22:46025625-46025647 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184696727 22:46143617-46143639 AGGTGTGCAGAGGAGGGAGTTGG - Intergenic
1184701678 22:46178464-46178486 CAGGTTGCAGTGCAGGGAGAGGG + Intronic
1185372169 22:50465954-50465976 CAGTGTGCTGAGCATGGTGAGGG - Exonic
1203279095 22_KI270734v1_random:114232-114254 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1203304792 22_KI270736v1_random:101628-101650 TGGAGTGCAGAGCAGTGAAATGG + Intergenic
950047255 3:9956274-9956296 CAGTGGGCAGAGCACAGAGAAGG - Intergenic
950966971 3:17153294-17153316 CACTGTGCAGAGCAGAGACAAGG - Intergenic
951456309 3:22896102-22896124 TAGTGTGAAGAGCAGAGAACTGG - Intergenic
954663568 3:52238801-52238823 TGGTGTGCATAGCTGGGAGTGGG - Intronic
956320969 3:67995839-67995861 CAGTGGGCTGAGCAGGGAGGAGG - Intergenic
956372707 3:68581245-68581267 TGGGGTGCAGTGCAGGGGGAGGG - Intergenic
959968591 3:112382879-112382901 TAGTGTGTAGAGCCATGAGAGGG - Intergenic
960394529 3:117119980-117120002 TAGTGAGCAGTGCAGAGATAGGG - Intronic
962016244 3:131443421-131443443 TAGTGTAGAGAGCAAGGACATGG - Intergenic
964531790 3:157676121-157676143 TGGTGTGGGGAGAAGGGAGATGG - Intronic
966378292 3:179319365-179319387 TACTGTGCTAAGCAGGGAAATGG + Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
968321175 3:197770006-197770028 GAATGTGCAGATAAGGGAGACGG - Intronic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
969003509 4:4001594-4001616 TAATGTGTAGAGAAGGGAGGGGG + Intergenic
969061838 4:4442245-4442267 TGGTGTACAGTGTAGGGAGAGGG - Intronic
969241604 4:5902342-5902364 GAGTTTGCAGATCAGAGAGATGG + Intronic
969431815 4:7159519-7159541 AACTGAGCAGTGCAGGGAGAGGG - Intergenic
969808378 4:9628230-9628252 TAGAGTTCAGCTCAGGGAGAAGG + Intergenic
970323341 4:14897403-14897425 TAGTGTCCAGCCCAGGGAGGTGG - Intergenic
970968180 4:21950930-21950952 AAGTCTGCAGAAGAGGGAGAAGG - Intergenic
971231807 4:24806329-24806351 TAGGGTGCAGGGCAGGGAGCAGG - Exonic
971744091 4:30556894-30556916 TTTTGTGCAGAGGAGTGAGATGG + Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
975681545 4:76881828-76881850 TAGACTGCAGAGAAGGGAAATGG + Intergenic
975704687 4:77099979-77100001 TAGTATTCAGAGCAGGGGGATGG + Intergenic
975758581 4:77595822-77595844 TTGTCTGCAGAGCAGTTAGAGGG + Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
980410799 4:132415253-132415275 TCTTGTTCAGAACAGGGAGAAGG - Intergenic
981459905 4:145001034-145001056 TAGGGTGCAGGGCAGGGGGAGGG + Intronic
981683165 4:147423414-147423436 AAGTGTGCAGAGCACGGTGCTGG - Intergenic
981753574 4:148117685-148117707 TAGTGATCAAAGCAGGAAGAGGG - Intronic
982123459 4:152163652-152163674 TGGTGAGCAGAGAAGGGAGAGGG - Intergenic
982691839 4:158556917-158556939 TGGTGACCAGAGCAGAGAGAAGG + Intronic
984243872 4:177251294-177251316 TTGGGTGCAGGGCAGGGAAAAGG - Intergenic
984430911 4:179647925-179647947 TCTTTTGAAGAGCAGGGAGAAGG + Intergenic
984845699 4:184106425-184106447 AAGTGTGGGGAGCTGGGAGAGGG - Intronic
985821823 5:2165771-2165793 ATGTGTGCAGAGCGAGGAGAAGG - Intergenic
986428436 5:7657555-7657577 ATGTGTGCATGGCAGGGAGATGG - Intronic
988640299 5:33034313-33034335 TAGTGTCGAAAGCAGGGAGAAGG - Intergenic
988845161 5:35120119-35120141 CAGTGGGTAGAGCATGGAGATGG + Intronic
990819740 5:59824764-59824786 TAGTGAGGTGAGCAGAGAGAGGG - Intronic
990824922 5:59888269-59888291 TGGTGGGCAGAGGAGGTAGAAGG - Intronic
991295543 5:65076378-65076400 GAGTCTACAGCGCAGGGAGACGG + Intergenic
992085553 5:73275157-73275179 CAATGTGGAGGGCAGGGAGATGG + Intergenic
993205596 5:84874284-84874306 GAGTTTGCAAAGCAGAGAGAAGG - Intergenic
994141728 5:96348701-96348723 TGGTGTACAGAGGAGGCAGATGG + Intergenic
994255900 5:97595733-97595755 TGGGGTGCAGAGCAAGGGGAGGG - Intergenic
994302569 5:98163084-98163106 CAGGGTGGAGAACAGGGAGATGG + Intergenic
995254869 5:110034812-110034834 AACTGTGCAGAGCAGGAGGATGG - Intergenic
997686037 5:135788606-135788628 TAATATCCAGGGCAGGGAGAGGG + Intergenic
999035350 5:148342904-148342926 AAGGGTGCAGATCAAGGAGATGG + Intergenic
999710584 5:154314894-154314916 CAATGTGCAGAGCATAGAGATGG + Intronic
999775726 5:154811744-154811766 AATTGTGGGGAGCAGGGAGAGGG - Intronic
1000687788 5:164273914-164273936 TATTCTGCATACCAGGGAGAAGG + Intergenic
1001266679 5:170278966-170278988 TGGTGGGCATAGCAGGGAGGTGG + Intronic
1001581170 5:172799565-172799587 TTGTGTGCTGGGCATGGAGAAGG + Intergenic
1002367322 5:178723581-178723603 GAGAGTGCAGAGCAGGCAGGTGG - Intronic
1002386128 5:178868589-178868611 GAGAGTGCAGAGCAGGCAGGTGG + Intronic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1003442413 6:6155433-6155455 TGGAGTGGGGAGCAGGGAGAAGG + Intronic
1004010497 6:11681333-11681355 GAGTGAGCAGAGGAGGGGGATGG + Intergenic
1004107319 6:12677789-12677811 GGGTGTGCTGAGCATGGAGAAGG - Intergenic
1006002197 6:30973916-30973938 TAGTATAAAGACCAGGGAGAAGG + Intergenic
1006378755 6:33685728-33685750 ACGTGTGCAGAGCAGTGAGATGG + Exonic
1006578822 6:35064810-35064832 TGGAGTGCTGTGCAGGGAGATGG - Intronic
1007094298 6:39203877-39203899 GAGTATGCAGGGCAGAGAGAAGG + Intronic
1007189716 6:40003223-40003245 TGGTGGGCTGAACAGGGAGAGGG - Intergenic
1008571334 6:52819998-52820020 CAGTGCTCAGAGCAGGGAGTGGG - Intergenic
1009505040 6:64467709-64467731 CAGTGTGCAGAGCAGGCCTATGG - Intronic
1010205049 6:73315068-73315090 GAGTGTGCTGGGCGGGGAGAGGG - Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1011855342 6:91682967-91682989 TAGAGAGCAGAACAGGAAGATGG - Intergenic
1012261871 6:97096821-97096843 AAGTAAGCAGAGCAGTGAGACGG + Intronic
1012604821 6:101144853-101144875 CAGGGTGCAGAGTAGGGTGAAGG + Intergenic
1013272811 6:108559442-108559464 AAGTGGGGAGAGGAGGGAGAAGG - Intergenic
1013599857 6:111693720-111693742 ATGGGTCCAGAGCAGGGAGAGGG - Intronic
1015937463 6:138417585-138417607 TAGGCAGCAAAGCAGGGAGAGGG + Exonic
1016280085 6:142406913-142406935 TGGAGTCCAGTGCAGGGAGAAGG + Intronic
1017777176 6:157689399-157689421 TCGTGTACAAAGCAGGGAAAAGG + Intergenic
1018194044 6:161339113-161339135 TAGTGAGCAGAGCAGAGAACAGG + Intergenic
1018208655 6:161459464-161459486 TAGTGTGGAGTGCAGGGACCTGG + Intronic
1018528772 6:164741569-164741591 GGGTGTTCAGAGCTGGGAGAGGG - Intergenic
1018775445 6:167010492-167010514 TTGTCTGGAGAGTAGGGAGAAGG + Intronic
1018964373 6:168473155-168473177 CAGTGGACAGAGCAGGGAGTGGG + Intronic
1019129409 6:169862704-169862726 TAGTGCGCAGACTTGGGAGATGG + Intergenic
1019311818 7:365930-365952 TAGTGATCAAATCAGGGAGATGG + Intergenic
1019327456 7:445442-445464 GTGTGTGCTGAGTAGGGAGAGGG - Intergenic
1020420777 7:8001946-8001968 TAGGGTGGGGAGCTGGGAGAGGG + Intronic
1020811840 7:12857709-12857731 CAGTTTTCAGAGAAGGGAGATGG + Intergenic
1021368495 7:19811676-19811698 TATTGTGCTGAGCAGAAAGAAGG - Intergenic
1022152040 7:27618161-27618183 AAGTGTACAGAGCAGGGGGAAGG - Intronic
1023829802 7:44032274-44032296 AAGTGTGGATAACAGGGAGAAGG + Intergenic
1024750251 7:52456498-52456520 TTGTATGGAGGGCAGGGAGAAGG - Intergenic
1026248489 7:68645419-68645441 TAGTGTTCAGAGCTTGGAGATGG - Intergenic
1026874135 7:73869998-73870020 CAGTGTGCAGACCGGGGAGCAGG - Intergenic
1027527423 7:79287435-79287457 TATTGTGCAGAATTGGGAGAGGG + Intronic
1027999824 7:85479508-85479530 TTGTGGACAGAGCAAGGAGATGG + Intergenic
1028165980 7:87538980-87539002 TGGTGGGCAGTGCAGGCAGAAGG - Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029161363 7:98554709-98554731 GTGTGAGCAGAGCAGGTAGAGGG - Intergenic
1029270132 7:99372630-99372652 GAGAGTGCAGAGCCGAGAGAAGG - Intronic
1029623030 7:101701786-101701808 GACGGTGCAGAGCAAGGAGAAGG + Intergenic
1029740112 7:102486533-102486555 AAGTGTGGATAACAGGGAGAAGG + Intronic
1029758109 7:102585712-102585734 AAGTGTGGATAACAGGGAGAAGG + Intronic
1029776047 7:102684773-102684795 AAGTGTGGATAACAGGGAGAAGG + Intergenic
1032679638 7:134168532-134168554 TACAGGGCAGAGAAGGGAGATGG + Intronic
1033159580 7:138983556-138983578 GAGTTTGCAGAGAATGGAGAAGG - Intergenic
1033359202 7:140626241-140626263 TGGTGTGCAGGGGACGGAGAAGG - Intronic
1033450909 7:141461790-141461812 GAGTGAGCTGAGCAGGGAGTTGG + Intronic
1033950667 7:146780871-146780893 TAGGGTGAAGGGCAAGGAGAAGG + Intronic
1034235099 7:149560578-149560600 GAGTGTGCAGAGCAGGGGGTGGG + Intergenic
1034250965 7:149690539-149690561 TGGTGGGCAGAGGACGGAGAGGG - Intergenic
1034867250 7:154652207-154652229 TAATGAGCAGAGCAGGGTGCAGG - Intronic
1036648454 8:10626303-10626325 CAGAGGGCTGAGCAGGGAGAGGG + Intronic
1036762475 8:11518863-11518885 CAGAGGGCAGAGCAGAGAGACGG - Intronic
1037584276 8:20265791-20265813 CTCTGCGCAGAGCAGGGAGATGG - Intronic
1038024108 8:23573808-23573830 TGGGGGGCAGAGCAGGGAGAAGG - Exonic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040055758 8:43056038-43056060 TAGTGGCCCCAGCAGGGAGAGGG - Intronic
1041443428 8:57924259-57924281 TAATGTGTAGAGAAGTGAGAAGG + Intergenic
1043083999 8:75804245-75804267 TAATGTGAAGAGCAGGGAACTGG - Intergenic
1043542030 8:81274966-81274988 TGATGTGCTGGGCAGGGAGAAGG + Intergenic
1046638956 8:116703860-116703882 TCGTGTGCAGAGACGAGAGATGG - Intronic
1047422510 8:124718704-124718726 TTGAGTGCAGAGCAGGAAGCGGG - Intronic
1048183861 8:132220957-132220979 TGGGGTGGAGAGCAGGGGGAGGG - Intronic
1048351998 8:133623923-133623945 GAGGGTGCAGTGCTGGGAGAGGG - Intergenic
1049239240 8:141528579-141528601 GAGTGGGCAGAGGAGGGAGGAGG + Intergenic
1049408589 8:142462546-142462568 TTGTAGGCAGAGCAGGGAGCTGG - Intronic
1049610495 8:143552829-143552851 TTGTGTGTAGAGCAGGGGGCAGG + Intergenic
1050860515 9:10423305-10423327 TGGGGTGGAGGGCAGGGAGAGGG + Intronic
1051602508 9:18889482-18889504 TTCTGAGCAGGGCAGGGAGAAGG - Intronic
1051681333 9:19611012-19611034 GAGAATGCAGAGCAGGGAGAGGG + Intronic
1051798132 9:20899188-20899210 TTGTGATCACAGCAGGGAGAGGG - Intronic
1052788558 9:32852678-32852700 TTGTGTGCAGTTCAGGAAGAAGG + Intergenic
1053163804 9:35830731-35830753 TTGTGGGCAGACCGGGGAGAAGG - Intronic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1055416520 9:76090226-76090248 TAATGTGGGGTGCAGGGAGAAGG - Intronic
1056224510 9:84482194-84482216 CAGTCTGCAGGGCAGAGAGAAGG - Intergenic
1056517451 9:87368659-87368681 TAGTCTGCAGTGTAGGAAGAGGG - Intergenic
1056782344 9:89560270-89560292 TAGTGGGCAGGGAAGGGAGCTGG + Intergenic
1056884169 9:90424107-90424129 GAGTGTGCAGTGAAGGGGGAAGG - Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057006922 9:91568829-91568851 TTGTGAGCACAGAAGGGAGAGGG - Intronic
1057776550 9:98015354-98015376 TACTGTACAGAGGAGGAAGAAGG + Exonic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1058234836 9:102476964-102476986 CAGGGTACAGAGCAGGGAGTGGG - Intergenic
1058706167 9:107639585-107639607 GAGTGTGCAGGGGAGGGAGGAGG - Intergenic
1058721475 9:107768503-107768525 TAGGGTGGAGAGCAGGAAGGGGG - Intergenic
1059329201 9:113524428-113524450 TAATGTGCACAACAGAGAGAGGG - Intronic
1059528986 9:115018403-115018425 AAGTACACAGAGCAGGGAGAAGG + Intergenic
1060224012 9:121780554-121780576 GAGTGTGTGGAGCAAGGAGAAGG + Intronic
1060396137 9:123318307-123318329 TTGTGTACAAAGCAGGCAGAGGG - Intergenic
1060409203 9:123389023-123389045 TACAGAGCAGAGAAGGGAGACGG - Intronic
1060877053 9:127091162-127091184 TACATTGCAGAGTAGGGAGAAGG - Intronic
1061148950 9:128818212-128818234 TAGTTCGCAGAGCAGGCACAGGG - Intergenic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061791737 9:133062757-133062779 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1061795413 9:133083323-133083345 GAGTGTGGAGAGCAGGCAGACGG + Intronic
1061800626 9:133111814-133111836 TGGTGTGCACATCTGGGAGAAGG + Intronic
1061899730 9:133666655-133666677 CAGGGTGCAGTGCAGGGAGCTGG + Intronic
1062059502 9:134487379-134487401 TAGGGCACATAGCAGGGAGAAGG - Intergenic
1062633866 9:137479655-137479677 CAGGGAGCAGAGGAGGGAGACGG + Intronic
1203367837 Un_KI270442v1:273916-273938 TGGTGTGCAGGGGAGGGAGCCGG + Intergenic
1185568551 X:1115063-1115085 TGGTCTTCAGAGCAAGGAGAGGG + Intergenic
1186258608 X:7750811-7750833 TAGTGTGCATTTCAGGGTGAAGG + Intergenic
1186852444 X:13593612-13593634 TGGTGGGGAAAGCAGGGAGAGGG + Intronic
1188591813 X:31845889-31845911 TAGTGTGCAGATTAGGGGTAAGG + Intronic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190917037 X:54818491-54818513 GAGTGTTCGGAGCAGGGGGAAGG + Intergenic
1192925200 X:75748538-75748560 TAGGGGACAGTGCAGGGAGAGGG - Intergenic
1193352267 X:80477363-80477385 TAGAGTGCAGTGCATGCAGAGGG + Intergenic
1195724337 X:107898852-107898874 TAGAGTGGAGAGCACTGAGACGG + Intronic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196124219 X:112082340-112082362 TAGTGTGAAGGAGAGGGAGAAGG + Exonic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1198430000 X:136555929-136555951 TAATGTGCAGAGAAGGCAAATGG + Intronic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1200215171 X:154365096-154365118 GAGTGTGCAGAGCTGGGAGAGGG + Intronic
1200909396 Y:8516879-8516901 TTGGGTGCAGGGCAGGCAGAGGG + Intergenic
1200985943 Y:9303717-9303739 TTGGGTGCAGTGCAGGCAGAAGG - Intergenic
1201070853 Y:10146325-10146347 TGGTGTGCAGGGGAGGGAGCCGG - Intergenic
1201070863 Y:10146359-10146381 TGGTGTGCAGGGGAGGGAGCCGG - Intergenic
1202197018 Y:22307063-22307085 TTGTGTGCAGCGCTGGCAGAGGG + Intergenic
1202342853 Y:23887910-23887932 TAGTGAGTAGAGCATGGAGTGGG - Intergenic
1202527915 Y:25782175-25782197 TAGTGAGTAGAGCATGGAGTGGG + Intergenic