ID: 1071503522

View in Genome Browser
Species Human (GRCh38)
Location 10:86219567-86219589
Sequence ACACTACTCCCCTACAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071503517_1071503522 -4 Left 1071503517 10:86219548-86219570 CCCCTTCTCCCTGCTCTGCACAC 0: 1
1: 0
2: 8
3: 75
4: 822
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503516_1071503522 1 Left 1071503516 10:86219543-86219565 CCGCTCCCCTTCTCCCTGCTCTG 0: 1
1: 1
2: 19
3: 249
4: 2039
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503515_1071503522 2 Left 1071503515 10:86219542-86219564 CCCGCTCCCCTTCTCCCTGCTCT 0: 1
1: 1
2: 12
3: 181
4: 1703
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503512_1071503522 20 Left 1071503512 10:86219524-86219546 CCTATGAGGGGCAGCACCCCCGC 0: 1
1: 0
2: 1
3: 12
4: 80
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503518_1071503522 -5 Left 1071503518 10:86219549-86219571 CCCTTCTCCCTGCTCTGCACACT 0: 1
1: 0
2: 7
3: 74
4: 737
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503519_1071503522 -6 Left 1071503519 10:86219550-86219572 CCTTCTCCCTGCTCTGCACACTA 0: 1
1: 0
2: 3
3: 42
4: 445
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503513_1071503522 4 Left 1071503513 10:86219540-86219562 CCCCCGCTCCCCTTCTCCCTGCT No data
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data
1071503514_1071503522 3 Left 1071503514 10:86219541-86219563 CCCCGCTCCCCTTCTCCCTGCTC 0: 1
1: 1
2: 7
3: 166
4: 1463
Right 1071503522 10:86219567-86219589 ACACTACTCCCCTACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071503522 Original CRISPR ACACTACTCCCCTACAGCCC TGG Intronic
No off target data available for this crispr