ID: 1071504990

View in Genome Browser
Species Human (GRCh38)
Location 10:86226813-86226835
Sequence GCTCAGGGAGGACCGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071504990_1071504996 10 Left 1071504990 10:86226813-86226835 CCAGCTGGCGGTCCTCCCTGAGC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1071504996 10:86226846-86226868 TGCACACACTAACTAGGAAATGG No data
1071504990_1071504997 22 Left 1071504990 10:86226813-86226835 CCAGCTGGCGGTCCTCCCTGAGC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1071504997 10:86226858-86226880 CTAGGAAATGGAACTGCCAAAGG No data
1071504990_1071504995 4 Left 1071504990 10:86226813-86226835 CCAGCTGGCGGTCCTCCCTGAGC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1071504995 10:86226840-86226862 CCAGCTTGCACACACTAACTAGG No data
1071504990_1071504998 30 Left 1071504990 10:86226813-86226835 CCAGCTGGCGGTCCTCCCTGAGC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1071504998 10:86226866-86226888 TGGAACTGCCAAAGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071504990 Original CRISPR GCTCAGGGAGGACCGCCAGC TGG (reversed) Intronic
900183487 1:1322619-1322641 GCGGAGGGAGGACAGGCAGCAGG + Intronic
900790279 1:4675438-4675460 GCCCAGGGAGCATTGCCAGCCGG + Intronic
901329100 1:8390840-8390862 CGTCAGGGAGGACCCCCCGCTGG - Intronic
902371209 1:16008185-16008207 GATCAGGGAGGACTTCCTGCAGG + Exonic
902396985 1:16137781-16137803 GCTTAAGGAGGACGGCCATCTGG - Intronic
902554617 1:17239655-17239677 GCTCAGGGAGCACTGCCTGGAGG - Intronic
902722475 1:18313154-18313176 GGACAGGGAGGACCGCCGGGAGG + Intronic
905026763 1:34855803-34855825 GCGCCGGGAGGATCGCAAGCTGG - Exonic
905925777 1:41748688-41748710 GCTCAGAGAGGTCACCCAGCTGG + Intronic
906280049 1:44546883-44546905 GGTGAGAGAGGACCGCCAGGAGG - Intronic
906804255 1:48764854-48764876 GCTCAGCAAGGACTGCCTGCTGG + Intronic
910837962 1:91534618-91534640 GTACAGTGAGGGCCGCCAGCAGG - Intergenic
915105822 1:153534649-153534671 ACTCAGAGAGGACCCCCAGAGGG + Exonic
916966165 1:169945079-169945101 GCTCAGGGAGGGAGGCCAGGGGG - Intronic
918378773 1:183934406-183934428 GCTGAGGGAGGAAGGCCAGCAGG - Intronic
920680238 1:208066689-208066711 CCTCAGGGAGGACCTTCAGGAGG + Intronic
922271875 1:224043009-224043031 GGTTAGGGAGGACTGCCAGAGGG + Intergenic
922772214 1:228192076-228192098 GCCCAGGAAGGACCCCCGGCTGG + Intergenic
922793207 1:228322033-228322055 GCTCACTGAGGCCCGCCAGGCGG + Exonic
923522059 1:234742742-234742764 GCTCAGAGAGGACGGGCTGCGGG - Intergenic
1065815541 10:29479522-29479544 GCTCAGCGAGGCCCACCTGCTGG + Intronic
1065957397 10:30705699-30705721 GCTCAGTGAGACCCGCCTGCTGG - Intergenic
1066215163 10:33279417-33279439 GATCTGGGAGCACCCCCAGCTGG - Intronic
1066264607 10:33764006-33764028 GCTCAGGGAGGATGGGCAGGTGG - Intergenic
1067531180 10:47074735-47074757 GCTCAGGGAAAACCTCCACCTGG - Intergenic
1067942836 10:50670514-50670536 GCTAAGGCAGGACCTCCAGCAGG - Intergenic
1070096585 10:73343372-73343394 GCTCAGGCAGGACGGGAAGCTGG + Intronic
1070864080 10:79695478-79695500 GCTAAGGCAGGACCTCCAGCAGG - Intergenic
1071463630 10:85920787-85920809 GCTCAGGGTGGGCTCCCAGCAGG + Intronic
1071504990 10:86226813-86226835 GCTCAGGGAGGACCGCCAGCTGG - Intronic
1071519504 10:86320327-86320349 TCTCAGGGAGGGCAGCCAGGAGG + Intronic
1071630977 10:87217704-87217726 GCTAAGGCAGGACCTCCAGCAGG - Intergenic
1072667873 10:97407572-97407594 CCTCAGGATGGACGGCCAGCAGG - Intronic
1073288855 10:102403494-102403516 GACCAGGGAGGGCCGCCAGCAGG + Intronic
1075795586 10:125117231-125117253 GCACTGGGATGGCCGCCAGCTGG + Intronic
1076182267 10:128419398-128419420 GATCAGAGAGGCCCGCCAGGTGG + Intergenic
1076441946 10:130486121-130486143 GCCCAGGTAGAGCCGCCAGCGGG - Intergenic
1077108497 11:851964-851986 CCTCATGGAGGACCCCCAGGTGG + Intronic
1077356458 11:2121109-2121131 GCGCAGGGAGGCACCCCAGCTGG - Intergenic
1077458996 11:2699536-2699558 GCCCAGGGAGGACCGCGCGGAGG + Intronic
1077468527 11:2745772-2745794 GCTCAGCGAGGGCCGCCTTCAGG + Intronic
1078933283 11:15929685-15929707 GGTCAGGGAGGAAAGCCTGCAGG - Intergenic
1079710657 11:23679556-23679578 GCTCAGGGAAGACCCGCAGTGGG + Intergenic
1081604793 11:44520462-44520484 GCTCAGGGCGGAAATCCAGCAGG - Intergenic
1081812796 11:45922844-45922866 GCTCAGGGAGGGACGCGACCCGG - Exonic
1083033419 11:59615220-59615242 GCTCCGGCATTACCGCCAGCCGG - Intronic
1083796295 11:65018685-65018707 GCGCATGCAGGACTGCCAGCGGG + Exonic
1083922994 11:65790408-65790430 GCTCAGGGAGGCCAGCAGGCTGG + Intronic
1084410893 11:69005373-69005395 GCTCAGGGTGGTCTTCCAGCGGG - Exonic
1086012318 11:82120469-82120491 GCTCAAGGAGGCCTGCCTGCCGG + Intergenic
1087014187 11:93540361-93540383 GCTCAGAGAGGTCAGGCAGCAGG + Intronic
1088828142 11:113513084-113513106 GCTCAGGGAGGACAGGGAGGTGG + Intergenic
1089396249 11:118137855-118137877 GCTCAGGGAGGAAGGCCTGGGGG - Intronic
1090978311 11:131694621-131694643 GCTCAGGCAGGACAGGGAGCTGG + Intronic
1091356261 11:134940143-134940165 GCTCAGGGAGCACCCCCTGGTGG + Intergenic
1091900909 12:4143152-4143174 GCTCAGGCACGACCGTCAGTGGG - Intergenic
1092056433 12:5511912-5511934 GCTCGGGGAGGAAAGCTAGCGGG - Intronic
1093940789 12:25051707-25051729 GCACAGGAAGGACCGCCCCCAGG - Intronic
1094470346 12:30796463-30796485 GCGCAGCGAGGACCGCCCGGAGG + Intergenic
1095953970 12:47796128-47796150 GCCCAGGTAGGGCCGCCTGCTGG + Intronic
1096257765 12:50073432-50073454 GGTGAGGAAGGACGGCCAGCTGG + Intronic
1096427895 12:51519820-51519842 ACTCAGGGAGTACTGGCAGCTGG + Intergenic
1101880581 12:108623101-108623123 GCCCAGGGAGGACCGTGAGGGGG - Exonic
1102650952 12:114442074-114442096 GTTGATGGAGGACCGCCAGTGGG + Intergenic
1103092049 12:118104249-118104271 GCTCAGCGGGGACTGCCAGGGGG - Intronic
1105213427 13:18271182-18271204 GCTTAGGGAGAAGCTCCAGCAGG + Intergenic
1105502329 13:20983410-20983432 GCTCAGGGAAGACCTCCATCCGG + Exonic
1113145181 13:107200214-107200236 GGTCAGGGAGGACCTCCTCCTGG + Intronic
1113363653 13:109655785-109655807 GCTGGAGGAGGACAGCCAGCTGG - Intergenic
1113799878 13:113080778-113080800 GCTCAGGGAGGCCGGGCAGCAGG + Intronic
1113900417 13:113793820-113793842 TTCCAGGGAGGACCCCCAGCGGG + Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115761032 14:36579854-36579876 GCTGAGGGAGGGCCGCCTGGGGG - Intergenic
1117253407 14:53955987-53956009 TCTCAGGGCGCCCCGCCAGCTGG + Intronic
1120701717 14:87705594-87705616 GGTCAGGAAGGACTGCAAGCTGG + Intergenic
1121137107 14:91509590-91509612 GCTCAACGAGGACCGGCAGTGGG - Exonic
1121629114 14:95409741-95409763 GCTAAGGGAGAAACGACAGCTGG + Intronic
1122152160 14:99731162-99731184 GCTCAGCCAGGACTGCCAGGAGG - Intergenic
1122256252 14:100479261-100479283 GCTCAGGGAGCACAGGCAGAGGG - Intronic
1122899906 14:104778121-104778143 GCTCAGGCAACACCTCCAGCTGG + Intronic
1124342346 15:28898048-28898070 GCTCAGGGAGCACCGGCAGCTGG + Intronic
1126463323 15:48936960-48936982 CCACAGGGATGACCTCCAGCTGG - Intronic
1128512226 15:68320376-68320398 TCTCAGGGAGTACTGCCAGAGGG - Exonic
1129440567 15:75578572-75578594 GGTGAGGGAGGCCCGCGAGCCGG + Intronic
1129676168 15:77633232-77633254 ACCCAGGGAGGACCGCACGCCGG - Intronic
1129983696 15:79897257-79897279 GCTCAGGGAGGTCAGGCGGCAGG - Intronic
1130551183 15:84890804-84890826 GATCAGGGAGGACTTCCAGGAGG + Intronic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1132746607 16:1438835-1438857 GCTGATGGAGGAGCGCCTGCGGG - Exonic
1132842481 16:1984758-1984780 GTTTAGGGAGGACTGCCCGCCGG + Exonic
1135934174 16:26765317-26765339 GAGCAAGGAGGACAGCCAGCAGG - Intergenic
1136022670 16:27449911-27449933 GCTCAGGTAGCACAGCCAGAAGG - Exonic
1139340450 16:66264771-66264793 GCCCGGGCAGGACAGCCAGCGGG + Intergenic
1139514321 16:67444433-67444455 GCTCAGGGTCGCCCCCCAGCGGG + Intronic
1139597726 16:67968149-67968171 GCCCAGGGAGGCCAGCCGGCCGG - Intronic
1143344877 17:6242161-6242183 GGCCAGTGAGGCCCGCCAGCTGG - Intergenic
1147211671 17:38875555-38875577 TCTTGGGGAGGACGGCCAGCCGG - Intronic
1147586233 17:41655301-41655323 GCTCAGGGAGGGAGGCCAGTGGG - Intergenic
1148075954 17:44935294-44935316 GCGCCTGGAGGCCCGCCAGCAGG - Exonic
1148082852 17:44977002-44977024 GCTCAGGGAGGTCTTACAGCTGG + Intergenic
1148219262 17:45850431-45850453 GCTCAGGGAGGGGAGCCTGCAGG - Intergenic
1150290149 17:63976464-63976486 CCTCAGGGAAGACCATCAGCTGG - Intergenic
1150458686 17:65328939-65328961 TCTCAGGGAGGACCCTGAGCTGG + Intergenic
1151380260 17:73720727-73720749 ACACAGGGAGGACAGGCAGCAGG - Intergenic
1151804824 17:76398805-76398827 GCTCTGGAAGGGCAGCCAGCAGG - Intronic
1151929689 17:77224473-77224495 GCTCAGAGAGGGCAGGCAGCAGG - Intergenic
1152274963 17:79350764-79350786 GCTCAGGCAGGGCGGCCTGCAGG + Intronic
1152362956 17:79840757-79840779 GCTCTTGAAGGACCGCGAGCAGG + Intergenic
1152789674 17:82272638-82272660 GTTCAGAGAGAACCCCCAGCGGG + Intronic
1159973219 18:74678492-74678514 CTTCAGAGAGGACAGCCAGCAGG - Intronic
1160216049 18:76932625-76932647 GCTCAGTGAGGCCGGCCAGCAGG - Intronic
1160502832 18:79410796-79410818 GCTCCGGGAGGACAGGCTGCTGG - Exonic
1161077240 19:2291750-2291772 GCTCAGGACGCACAGCCAGCAGG + Exonic
1161551764 19:4916869-4916891 GATCAGGAGGGACCTCCAGCCGG - Intronic
1161676246 19:5651673-5651695 GCACAGGGAGGAGGGCCAGGCGG - Intronic
1162566338 19:11447305-11447327 CTGCAGGGAGGACCGACAGCTGG - Intronic
1162908318 19:13836359-13836381 GCCCAGGGAGGCCAGGCAGCAGG + Intergenic
1163416994 19:17192897-17192919 GACCCGGTAGGACCGCCAGCAGG - Exonic
1163518553 19:17779066-17779088 CCTCAGGGAGGGCCCCCACCTGG - Intronic
1164546053 19:29163972-29163994 GCTCAGGGACCACTGCCTGCAGG - Intergenic
1164598826 19:29547750-29547772 GCTCAGGGAGGGCTGCCTGGAGG + Intronic
1168274015 19:55266137-55266159 GTTCAGGGTGGCCCACCAGCAGG + Exonic
925289880 2:2740404-2740426 GCTGATGGAGGAACACCAGCTGG + Intergenic
926291864 2:11538140-11538162 GCTCGGGCAGAACCTCCAGCGGG + Intronic
927864013 2:26577331-26577353 ACTCAGTGAGGACACCCAGCTGG + Intronic
928411538 2:31058070-31058092 GCTCAGGGACTAACACCAGCAGG - Intronic
931450331 2:62362778-62362800 GCAATGGGAGGACCTCCAGCAGG + Intergenic
933892445 2:86784069-86784091 GCTCAGGGAGGAGCGACATGGGG + Intergenic
934566166 2:95342767-95342789 GCTCAGGGATGGCCACCAGACGG - Intronic
934665221 2:96164763-96164785 GCTCTGGGAGCGCCGCCACCAGG - Intergenic
934941262 2:98504125-98504147 GCCCATGGAGGACTGCCAGTGGG + Intronic
934943477 2:98519457-98519479 GCTCTGGGAAGAAAGCCAGCAGG + Intronic
936015715 2:108957476-108957498 GCTCATGGAGGCCCCCCAGGGGG + Intronic
938119930 2:128626161-128626183 GCTCAGGGAGACCAGCCTGCAGG - Intergenic
941309702 2:163913443-163913465 GGTCTGTGAGGACTGCCAGCAGG - Intergenic
947435382 2:230068291-230068313 GTTCAGGGCAGACCGCCAGGCGG - Intronic
948087994 2:235266790-235266812 GCTCAGGGAGTGACGCCTGCCGG - Intergenic
948323685 2:237093403-237093425 GCCCAGGGAGAAAGGCCAGCTGG + Intronic
1169327418 20:4686882-4686904 ACTCCGGGAGGGCCGCCAGCGGG + Intronic
1170612945 20:17929129-17929151 GCTCACTGAAGAACGCCAGCAGG - Intergenic
1170656284 20:18290011-18290033 GCCCAGAGAGGACTGCCTGCTGG + Exonic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1174395160 20:50242799-50242821 TCTCTGGGAGGACCCCCAGATGG - Intergenic
1175283866 20:57823893-57823915 GCTCAGGCAGGTCCTTCAGCAGG - Intergenic
1175942831 20:62545886-62545908 GCTCAGGGAGGACCCCGGGCAGG - Intergenic
1176135241 20:63519667-63519689 GCTCAGTGAGGACCCACAGCTGG - Intergenic
1176271899 20:64239691-64239713 GCCCAGAGAGGACCCCCAGGAGG + Intronic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1179944904 21:44666572-44666594 GCACAGGGAGGACTGGCAGGAGG + Exonic
1180816259 22:18791582-18791604 GCTTAGGGAGAAGCTCCAGCAGG + Intergenic
1181202448 22:21225914-21225936 GCTTAGGGAGAAGCTCCAGCAGG + Intronic
1183018161 22:35006753-35006775 GGTAAGGGAAGACCCCCAGCTGG - Intergenic
1183301487 22:37061166-37061188 GATGAGGCAGGACCTCCAGCGGG - Intronic
1184504297 22:44891637-44891659 GCTCAGGAAGGGCCGTCAGTGGG + Intronic
1203224465 22_KI270731v1_random:69499-69521 GCTTAGGGAGAAGCTCCAGCAGG - Intergenic
1203266362 22_KI270734v1_random:17293-17315 GCTTAGGGAGAAGCTCCAGCAGG + Intergenic
949198641 3:1344215-1344237 TCTCAGGGAGGTCCACCTGCAGG + Intronic
951306457 3:21068887-21068909 GCTCTGGGAACACCGGCAGCAGG - Intergenic
952175544 3:30858793-30858815 GCTCAGAGAGAACCTACAGCAGG + Intronic
954439221 3:50512392-50512414 CCTCAGGGAGGATCGCCATGTGG + Intergenic
954575487 3:51673813-51673835 CCTCAGGGACGACTGCCAGAGGG - Intronic
954613450 3:51958017-51958039 GGGCAGGCAGGACCACCAGCAGG - Exonic
961641040 3:128365007-128365029 GCTAAGGGAGCAGAGCCAGCTGG - Intronic
965731307 3:171774882-171774904 GTTCAGGGAGGATATCCAGCAGG + Intronic
969622747 4:8286905-8286927 GCCCAGGGAGGACTGGCAGCTGG + Intronic
972731163 4:41796752-41796774 GCTCAGGGAGGACGCCCATTAGG + Intergenic
979192619 4:117880869-117880891 GATCAGGGAAGAGAGCCAGCAGG - Intergenic
979609562 4:122674780-122674802 GCTTAGGAAGGAGGGCCAGCTGG + Intergenic
985764473 5:1769488-1769510 CCTCAGGGAGGCCCTCCTGCGGG - Intergenic
996064148 5:119063577-119063599 ACTCAGGGATGAACCCCAGCTGG - Intronic
997292330 5:132747170-132747192 GCTCAGGGAGCACGGCCGGCAGG + Intergenic
997413827 5:133710072-133710094 GCTCAGGGAGGAGTGCCATGAGG + Intergenic
998148270 5:139742809-139742831 GCTCAGGGAGGAGCTCCCTCTGG + Intergenic
998845446 5:146304573-146304595 ACTCAGAGCGGACCCCCAGCAGG - Intronic
999251068 5:150182686-150182708 GCCCAGGCAGGACCCCCAGGAGG - Intronic
1002261458 5:177996358-177996380 GCTCAGGGAGGATCACAAGCCGG + Intergenic
1002309166 5:178304171-178304193 CCTCAGGGAGGAATCCCAGCCGG + Intronic
1003372273 6:5539889-5539911 GCAGAGGGAGCACCGCCAGCTGG - Intronic
1006449218 6:34096367-34096389 GCTCAGGGAGGGCTGCCTGGAGG - Intronic
1013942676 6:115683403-115683425 GCTCAAGGAAGATGGCCAGCTGG + Intergenic
1016904861 6:149138275-149138297 GCCCGGGGAGGCCCGCCAGCAGG + Intergenic
1019983944 7:4641772-4641794 GCGCAGGGCGGGCCGCGAGCAGG - Intergenic
1020274598 7:6616407-6616429 GCTCTGAGAAGGCCGCCAGCAGG - Intronic
1022814973 7:33905107-33905129 GCTCCGGGAGGGCCGAGAGCCGG + Exonic
1024766676 7:52668606-52668628 GCTCTGGGTGACCCGCCAGCTGG + Intergenic
1028952732 7:96655081-96655103 TTTCAGGGAGGCCAGCCAGCAGG + Intronic
1029706337 7:102278225-102278247 GCTTAGGGAGGGCAGCTAGCAGG - Intronic
1032128657 7:129212136-129212158 GCTCAGGGGGCGGCGCCAGCGGG - Exonic
1032348263 7:131136818-131136840 GCTCTGGGAGGACCTTCTGCAGG + Intronic
1038540682 8:28387287-28387309 GCTCAGTCAGGACTGCAAGCCGG - Intronic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1048050169 8:130808969-130808991 ACTCAGGCCGGACCTCCAGCTGG + Intronic
1055264629 9:74480843-74480865 TCTCAGGGAGGACAGTCAGCTGG + Intergenic
1056122775 9:83505666-83505688 GCTCAGGCAGCACCACGAGCAGG - Intronic
1057941943 9:99292787-99292809 GTTCAGGGAGGACCCCCAAGAGG + Intergenic
1060954658 9:127629861-127629883 GCCCAGGGAGAGCAGCCAGCAGG + Intronic
1061390943 9:130316733-130316755 ACCCAGGGAGGACAGCGAGCTGG - Intronic
1061715886 9:132518664-132518686 ACACAGGCAGGACCGCCAGCTGG - Intronic
1062630850 9:137462465-137462487 CCGCAGGGAGGACCCCCGGCCGG - Intronic
1062636477 9:137494194-137494216 GCCCAGGAAGGACCGGCAGAGGG - Intronic
1190360489 X:49644455-49644477 GCTCAGGGAGCACCCACATCTGG + Intergenic
1190918897 X:54831347-54831369 GCTGAGGGAGGAGGGGCAGCAGG - Intergenic
1199485712 X:148345935-148345957 GCTCAGCGAGGCCCATCAGCTGG - Intergenic
1200089442 X:153627527-153627549 GCTGTGTGAGGACCGCCGGCGGG - Intergenic
1200210536 X:154344996-154345018 GGTCACAGAGGACAGCCAGCAGG - Intergenic
1200220316 X:154387096-154387118 GGTCACAGAGGACAGCCAGCAGG + Intergenic