ID: 1071507425

View in Genome Browser
Species Human (GRCh38)
Location 10:86241135-86241157
Sequence TGGGAGCTGGTGCATCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071507425_1071507430 1 Left 1071507425 10:86241135-86241157 CCCACAAGATGCACCAGCTCCCA 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1071507430 10:86241159-86241181 TTGTTTACCACTCTCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071507425 Original CRISPR TGGGAGCTGGTGCATCTTGT GGG (reversed) Intronic
900387236 1:2416250-2416272 TGGGCGCTGGTGCTGCTTGAGGG + Intergenic
901078844 1:6572195-6572217 TGTGAGCTGGGGCACCTTCTAGG + Intronic
902064916 1:13677056-13677078 TGGGAGGTGTTGGATCTTGGGGG - Intergenic
903106228 1:21082619-21082641 TGTGAGCTGCTGCATCCTGCCGG - Intronic
903589734 1:24445694-24445716 TGGGAGCTGGAGGGTCCTGTGGG - Intronic
904683963 1:32247674-32247696 CGGGAGCTGGTGAGTCTGGTGGG + Exonic
905182289 1:36174899-36174921 TGGGAGCAGGTGCTCCGTGTCGG + Exonic
905366011 1:37452009-37452031 TGGGAGCTGGCCCATGGTGTTGG + Intergenic
905516905 1:38568768-38568790 TGGAATCTGGTGCTGCTTGTGGG + Intergenic
906146731 1:43565001-43565023 TGGGAGCTGGGGCATGTGTTGGG - Intronic
906642679 1:47450699-47450721 TGGAGGCTGGGGCATCTTGGGGG + Intergenic
910087853 1:83425262-83425284 TGGGAAATGTTGCATCTGGTTGG - Intergenic
910729404 1:90376337-90376359 AGCAAGCTGGTGCATCTTGCAGG - Intergenic
912585161 1:110756672-110756694 TGGCAGCTGGTGCCTGCTGTTGG + Intergenic
912714790 1:111975392-111975414 TGGGAGCTGGTGAAGCTTGGTGG + Intronic
913551492 1:119921143-119921165 TGGGAGCTGGTGGAGCATGATGG - Intronic
913566757 1:120080275-120080297 TGGGAGGTGTTGGATCTTGAGGG + Intergenic
913631375 1:120713277-120713299 TGGGAGGTGTTGGATCTTGAGGG - Intergenic
914287512 1:146240982-146241004 TGGGAGGTGTTGGATCTTGAGGG + Intergenic
914548544 1:148691724-148691746 TGGGAGGTGTTGGATCTTGAGGG + Intergenic
914618134 1:149379987-149380009 TGGGAGGTGTTGGATCTTGAGGG - Intergenic
915511659 1:156390053-156390075 TAGGAGCTGAGGCATTTTGTGGG + Intergenic
916513174 1:165491412-165491434 TGAGATCTGGTGCCTCTTCTTGG - Intergenic
917108006 1:171514584-171514606 TGGGAGCAGGTGCTACTTCTGGG - Exonic
917931492 1:179825801-179825823 TGGAAGTAGGTTCATCTTGTCGG + Intergenic
921986168 1:221315425-221315447 TTGGAGCTGATTCATCTTATTGG - Intergenic
923520357 1:234730715-234730737 TAGGAGCTGGTGCAGCATGGAGG - Intergenic
924327378 1:242909284-242909306 TGGGAGCTGTTGCGTCATGGAGG + Intergenic
1063940185 10:11120563-11120585 TGGCAGCTGGTACTTCTGGTGGG - Intronic
1065364544 10:24922764-24922786 AGGTAGCTGGTTCATCTTATTGG + Intronic
1065865235 10:29909247-29909269 TGGGAGCAGGTGCTGCTTGCCGG + Intergenic
1070404621 10:76083851-76083873 GGGGCTCTAGTGCATCTTGTGGG + Intronic
1071507425 10:86241135-86241157 TGGGAGCTGGTGCATCTTGTGGG - Intronic
1071548661 10:86548856-86548878 GGGGTGCTGGTCCATCTTGAGGG - Intergenic
1073457693 10:103647481-103647503 GTGGAGCTAGAGCATCTTGTTGG - Intronic
1073817961 10:107228314-107228336 AGGGAGTTGGTGCATTCTGTAGG - Intergenic
1074767160 10:116707809-116707831 GAGGAGCTGGTGCATCTGCTAGG - Intronic
1077406449 11:2384464-2384486 TGTGGGGTGGGGCATCTTGTGGG + Intronic
1077406461 11:2384498-2384520 TGTGGGGTGGGGCATCTTGTGGG + Intronic
1077469427 11:2750082-2750104 TGGGTGCAGGGGCATCTTGCTGG + Intronic
1078986089 11:16600112-16600134 TGGGACCTTGTGCATCATGCAGG - Intronic
1079957429 11:26882291-26882313 AGGTACCTGGTTCATCTTGTTGG + Intergenic
1080920383 11:36702887-36702909 TGGGAGATGCAGGATCTTGTTGG + Intergenic
1081564977 11:44254298-44254320 TGGCAGGTGGGGCATCTGGTGGG + Intergenic
1081994752 11:47356183-47356205 TGTGAGCTGGTGCATTGTGTGGG - Intronic
1088595206 11:111435899-111435921 TGGGAAATCGTGCAGCTTGTGGG - Intronic
1090644700 11:128758230-128758252 TGGGAGGGGGTTGATCTTGTGGG - Exonic
1090762935 11:129853208-129853230 TGGGAGTGGGTGGATCTTGTTGG - Intronic
1090977987 11:131692201-131692223 TGGGAGGTGGCACCTCTTGTAGG - Intronic
1099870361 12:88340638-88340660 CGGGAGCTGCTGTATCTTTTTGG + Intergenic
1104467048 12:128999141-128999163 TGGCAGCTGGACCATCTTGCAGG + Intergenic
1108281717 13:48868279-48868301 TGGGAGCTGATGCCTTTTGATGG + Intergenic
1109622191 13:64925343-64925365 TGGGAGCAGGTGCCTTTTCTGGG - Intergenic
1114222036 14:20705267-20705289 TGGGATCTGATGCCTTTTGTTGG - Intergenic
1114633346 14:24173333-24173355 AGGGATCTGGAGCATCTTCTAGG - Exonic
1117223209 14:53628121-53628143 TGGGAGATGGTGGATGTGGTTGG - Intergenic
1117384857 14:55201363-55201385 GTGGAGCTGGTGCCTTTTGTGGG - Intergenic
1118226469 14:63904520-63904542 TGTGAGATGGTGTATCTTGGTGG + Intronic
1120970725 14:90204874-90204896 TGGGAGTTGGGGGAGCTTGTGGG + Intergenic
1121140603 14:91538577-91538599 TGGGAGCTGGTTCTTCATGATGG - Intergenic
1122373031 14:101239527-101239549 TGGGAGCTTGTGCATCTCCCCGG + Intergenic
1124204082 15:27702351-27702373 AGGGAGATGGTGCAGCCTGTCGG - Intergenic
1128546759 15:68573597-68573619 TGGGAGCTGAGGCATGTGGTGGG + Intergenic
1133091425 16:3407257-3407279 TGGGAGGTGGGGCATCTGGGAGG - Intronic
1135645862 16:24161549-24161571 TGGGAGCTTTTGCATCTATTTGG - Intronic
1135836042 16:25826272-25826294 TGGGTGCAGGTGCCTCTTGTAGG + Intronic
1138186678 16:54982700-54982722 TGGGAGATGGTACACCTTGTGGG - Intergenic
1139559157 16:67730633-67730655 TGGGGCCTGGTGCATCTCGCTGG + Intronic
1140900638 16:79364147-79364169 TGGGAGCTTATACATCCTGTAGG + Intergenic
1141506166 16:84480067-84480089 AGGAAGCTGCTGCCTCTTGTTGG - Intronic
1143578795 17:7811734-7811756 TGGGAGGTGGGGCATCTGGGAGG - Intronic
1145061944 17:19739132-19739154 TGGGGGCTGGGGCATCCTGTGGG - Intronic
1147905105 17:43817644-43817666 TGTGACCTGGTGCCTCTGGTAGG - Intronic
1150207607 17:63420745-63420767 AGGGAGCTGAGGCATCTGGTAGG - Exonic
1151295347 17:73181730-73181752 TGAGACCTGGTGCATCTTTATGG - Intergenic
1152331029 17:79673153-79673175 TGGGAGCTGGGACATTTTGGGGG - Intergenic
1155318703 18:24597155-24597177 TGGGAGCAGGTACATCTCATGGG + Intergenic
1156084645 18:33383342-33383364 GTGGAGCTGGTGCATTATGTTGG - Intronic
1156162273 18:34374027-34374049 AGGGAGCTGCTGCACCATGTGGG + Intergenic
1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG + Intergenic
1162179560 19:8858706-8858728 TGGGTGCTGGAGCTGCTTGTTGG + Exonic
1162335001 19:10054898-10054920 TGGGAGATGGGGCAACTTGAGGG - Intergenic
1165285778 19:34840157-34840179 TGGGAGATGGTACATCAGGTGGG + Intergenic
1167180581 19:47900184-47900206 TGGGCACTGGTGCATGTTTTAGG - Intergenic
925433530 2:3817198-3817220 TGGGATCTGGTGCCTTTTGATGG + Intronic
928091110 2:28375647-28375669 TGGGATCTGGTGTATGTTGGAGG - Intergenic
930068212 2:47344139-47344161 TGGTACCTGGGGCATCTAGTAGG - Intergenic
936017441 2:108970506-108970528 TGGGAGCTGGGGCCTCTGGACGG + Intronic
942718443 2:178921761-178921783 TGGGAGCTGGTGAACCCAGTTGG - Intronic
947902220 2:233730622-233730644 TGGGGTCTGGTGCATGATGTGGG + Intronic
947904284 2:233748705-233748727 TGGGGTCTGGTGCATGATGTGGG + Intronic
948244410 2:236466739-236466761 TGGGAGGTGATGGATCTTGGGGG - Intronic
1169905172 20:10595466-10595488 TGGGAGCTGGTGCCCCAAGTAGG + Intronic
1173699300 20:45053774-45053796 TGTGAGATGATGCCTCTTGTTGG - Intronic
1174151333 20:48488606-48488628 TGAGGGTTGGTGCATCATGTGGG + Intergenic
1177724535 21:24950230-24950252 TTGGTGGTGGTGCATCTTGCTGG - Intergenic
1178212514 21:30552601-30552623 TGGGAACTGGTGCAGCTGTTTGG + Intronic
1179901685 21:44397466-44397488 TGGGGGCTGGTGCATGTGCTGGG + Intronic
1182230098 22:28831395-28831417 TGGGTGCTGGTGTCTCTGGTGGG + Intergenic
1184685438 22:46094738-46094760 CGGGAGCTGGTGCTGCTTGATGG + Intronic
952418636 3:33111815-33111837 GGGGAGCTTGCGCATGTTGTAGG - Intergenic
953493205 3:43366643-43366665 TGGCAGCTGGAGCAGCGTGTGGG + Exonic
954132705 3:48568479-48568501 TGGGAGCAGGGGCATCTTACCGG + Exonic
954867813 3:53744545-53744567 TGGGAGGTGCTGCCTCGTGTGGG + Intronic
956085113 3:65599756-65599778 TGGGAGCTGTTCCATTTTGCAGG - Intronic
956502790 3:69904882-69904904 TGTGAGATGATGCATATTGTTGG + Intronic
956867530 3:73384430-73384452 CTTGAGCTGCTGCATCTTGTGGG + Exonic
961029044 3:123585877-123585899 GGGAAGCTGGAGCAGCTTGTGGG + Intergenic
962684109 3:137830014-137830036 TGGGAGCTGTTGGATCTTGGGGG - Intergenic
967514544 3:190350997-190351019 TGGGAGGTGTTGGGTCTTGTGGG + Intronic
967950613 3:194837587-194837609 TGGGAGCTGGTCCCGCGTGTAGG + Intergenic
968919892 4:3517071-3517093 TGGGGGCTGGACCACCTTGTAGG - Intronic
969617852 4:8264231-8264253 TGGAAGGAGGTGCATCTTGGAGG + Intergenic
974441854 4:61929132-61929154 TGGGAGGTGGGGCTTCTGGTGGG + Intronic
982149338 4:152435108-152435130 TAGGGGATGGTGCATCATGTTGG - Intronic
984874729 4:184357004-184357026 TGGGAGATGGTCCTTCCTGTGGG + Intergenic
986318804 5:6610877-6610899 GGTGAGCTGGTGAGTCTTGTTGG - Intronic
986503957 5:8430065-8430087 TGGGAGCTGGTGCCGGTAGTGGG + Intergenic
988618038 5:32794126-32794148 TGGGAGTAGGAGGATCTTGTGGG - Intergenic
990037739 5:51342615-51342637 TGGGAGCCAGAGCATCTTGTGGG - Intergenic
991651830 5:68863435-68863457 TGGGAGATGGAGCAGCTTGGAGG + Intergenic
992782865 5:80143755-80143777 CGGGAGCTGGTCCATCTTCTGGG - Exonic
995913062 5:117211093-117211115 TGAGAGCTAATGCCTCTTGTGGG - Intergenic
997901684 5:137772337-137772359 TGGGTACTGGGGCATCATGTTGG - Intergenic
999145076 5:149387133-149387155 TGGGAACTGCTGGATCTTCTGGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1009980134 6:70718048-70718070 GGGGAGCTTGTGGAGCTTGTGGG - Intronic
1010123748 6:72409683-72409705 TGGGAGCTGGTACTTCGTATGGG - Intergenic
1010570540 6:77468318-77468340 TGGGAGCTGGCTCTTCTAGTTGG - Intergenic
1012865471 6:104613077-104613099 TGAGATCTGGTGCATTTTCTAGG + Intergenic
1014406880 6:121063884-121063906 TGGGAACTGAAGCAACTTGTTGG + Intergenic
1014753424 6:125277845-125277867 TGGGAGGTGGTGAATGTGGTGGG + Intronic
1017971796 6:159318176-159318198 TAGAAACTGGTGCATTTTGTGGG + Intergenic
1018077897 6:160232639-160232661 TGGGATCTGGTGCCTTTTGATGG - Intronic
1020029920 7:4925487-4925509 TGTGGGCTGGTACCTCTTGTGGG + Exonic
1020844443 7:13265016-13265038 TGGCAGCTGGTGCAATTTTTGGG - Intergenic
1023034658 7:36120044-36120066 AGGTACCTGGTTCATCTTGTTGG + Intergenic
1025231415 7:57205303-57205325 TGGGGGTTGGTGCGTCGTGTGGG - Intergenic
1027304732 7:76881736-76881758 TGGGAAATGTTGCATCTGGTTGG - Intergenic
1028208307 7:88042299-88042321 TGTTAGCTAGAGCATCTTGTAGG + Intronic
1030166452 7:106560468-106560490 AGGTACCTGGTTCATCTTGTTGG - Intergenic
1030377540 7:108770946-108770968 GAGGAGCTGGTGCAGCTTGAAGG - Intergenic
1033704757 7:143876000-143876022 TGGGATCTTGGGCATCTTCTTGG + Exonic
1035096548 7:156360532-156360554 TGGGAGCTGGGGGATCTCGACGG + Intergenic
1037737850 8:21581405-21581427 AGGCAGCTGGTGCATGTTGCGGG - Intergenic
1039882464 8:41633445-41633467 TGAGAGCTGGTGCTTCTGTTCGG - Intergenic
1041067309 8:54094374-54094396 TGTGAGCTGGTGCAACTGGAGGG + Intronic
1046833644 8:118775619-118775641 TGGGAGATGTTGGATCATGTGGG - Intergenic
1047165702 8:122436135-122436157 TGGGAGCTGATGCATAATGAAGG + Intergenic
1048008348 8:130437293-130437315 TGTGAGCTGGGGCATCTTGAAGG - Intronic
1048271546 8:133032181-133032203 AGGGAGCTGGTGTATCCTGTGGG - Intronic
1057446223 9:95117006-95117028 TGGCATCTGGTGGATCTGGTTGG + Intronic
1057481815 9:95450626-95450648 TGGGAGCTGGGGCATTGTGCTGG + Intronic
1058939179 9:109797586-109797608 TTGAAGCTGGTGCATGTGGTGGG - Intronic
1060786342 9:126454302-126454324 TGTGAGCTGGTGCAGCATTTAGG - Intronic
1062385339 9:136307137-136307159 TGGGAGCTGGTGCTGCTGGGAGG - Intergenic
1062409656 9:136416872-136416894 TGGGCGCTGGTGCTGCTTGTTGG + Intronic
1062439870 9:136564919-136564941 TGGGAGCTGGGGCTTCCTCTTGG - Intergenic
1186390975 X:9158902-9158924 TTGTAGCTGGCGCATTTTGTGGG + Intronic
1186538528 X:10374612-10374634 TGGGAGGTGGAGCATGATGTTGG + Intergenic
1189317904 X:40068865-40068887 TGCGTGTGGGTGCATCTTGTTGG - Intronic
1190287465 X:48970903-48970925 AGGGAGCTGGTGCATCTTGAGGG + Exonic
1190335793 X:49260931-49260953 TGGGTGCTGGTGGATGTGGTAGG + Intronic
1191796776 X:65029720-65029742 TGGGAGCAGATGCAGATTGTAGG + Intronic
1193274591 X:79570754-79570776 TGACAGCTGTTGCAGCTTGTGGG - Intergenic
1194613086 X:96067558-96067580 TCAGAGCTGGTTCATCTTGCTGG - Intergenic
1195080352 X:101364520-101364542 TAGTAGCTGGTGCATTTTGCAGG + Intronic
1195112348 X:101660103-101660125 TGGGAGGGGCTGCATCTTCTCGG + Intergenic
1198279211 X:135125464-135125486 TGGGAGTTGTTGCAGCTTCTTGG - Intergenic
1198291746 X:135247056-135247078 TGGGAGTTGTTGCAGCTTCTTGG + Intergenic
1201224793 Y:11808197-11808219 TGGGAGCTGTTGCCTCATGGAGG + Intergenic