ID: 1071507889

View in Genome Browser
Species Human (GRCh38)
Location 10:86243744-86243766
Sequence AACCCCATGCTGTTAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071507889_1071507893 0 Left 1071507889 10:86243744-86243766 CCACCCATTAACAGCATGGGGTT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1071507893 10:86243767-86243789 CCCACCTTCCAGTCTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071507889 Original CRISPR AACCCCATGCTGTTAATGGG TGG (reversed) Intronic
900650956 1:3729903-3729925 GCCCCCATGCTGCGAATGGGTGG - Intronic
903926397 1:26833745-26833767 AACACCATGCTGTTAGGGGAAGG - Intronic
905502887 1:38453478-38453500 AACCCCATGCTGTTAGTCCAAGG + Intergenic
906078629 1:43069313-43069335 ATCCCCATCCTGTTCCTGGGAGG - Intergenic
909935233 1:81543469-81543491 AACAACATACTGTAAATGGGTGG - Intronic
913142105 1:115951712-115951734 CACCCCTTTCTGTTAAGGGGTGG - Intergenic
913254878 1:116944457-116944479 AACCCCATGCTAGAAGTGGGTGG - Intronic
914720211 1:150283030-150283052 AATCCCAAGCTCTTAATGGGCGG + Exonic
917938257 1:179891053-179891075 AAACCAAGGCTGTTTATGGGAGG - Intronic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
920323160 1:205140213-205140235 AACCCCAAGCTATTAAGAGGTGG + Intergenic
922575376 1:226657874-226657896 AAGCCCTTGCTGTTTATGTGAGG - Intronic
1062779786 10:191988-192010 AACCCCATGCTGTTGTTTTGAGG - Intronic
1063244442 10:4203787-4203809 AACACCATCCTTTTACTGGGAGG + Intergenic
1063855921 10:10253784-10253806 AACCCTATTCTCTTAATGTGAGG - Intergenic
1071497665 10:86179920-86179942 AATCCCATGCTGCACATGGGCGG + Intronic
1071507889 10:86243744-86243766 AACCCCATGCTGTTAATGGGTGG - Intronic
1073138122 10:101230723-101230745 TACCCCATTCTGTTTATGTGGGG + Intergenic
1076445962 10:130513995-130514017 TCCCCCATGCTGTTATTGAGTGG + Intergenic
1077354362 11:2108374-2108396 AAATCCATCCTGTTAATGTGAGG + Intergenic
1080986972 11:37480293-37480315 AATCTCATGTTTTTAATGGGGGG - Intergenic
1083623792 11:64061564-64061586 AACCCAATGCAGCAAATGGGGGG - Intronic
1091133531 11:133166981-133167003 AACCCTAGACTGATAATGGGAGG - Intronic
1096882819 12:54686432-54686454 AATCCCATGCTGGGGATGGGGGG + Intergenic
1104158155 12:126153163-126153185 ACCCCCATCCTGTACATGGGAGG + Intergenic
1120723191 14:87909607-87909629 AACCCCATGAGGTTGAGGGGAGG - Intronic
1122441329 14:101734244-101734266 AGCCCCGTGCTGGTTATGGGAGG - Intergenic
1124568487 15:30837932-30837954 AGACCCATGCAGTTAATCGGAGG + Intergenic
1129553330 15:76476954-76476976 CAAGCCATGGTGTTAATGGGGGG + Intronic
1129601936 15:77004223-77004245 AGCCCTTTGCAGTTAATGGGAGG + Intronic
1135059117 16:19255845-19255867 GGCCTCATGCTGTAAATGGGAGG + Intronic
1151810183 17:76435517-76435539 AAGCCCATGCAGTAAACGGGGGG - Intronic
1151959127 17:77396164-77396186 ATCCCCATGCTGTCACTGGAAGG - Intronic
1157739683 18:50081302-50081324 AAGCCCATGCTCCCAATGGGAGG + Intronic
1166496051 19:43303986-43304008 AACCTGATGCTGTTATGGGGAGG - Intergenic
926884130 2:17581788-17581810 AAGCTCTTGCTGTTAATGGGAGG + Intronic
928178048 2:29048335-29048357 AACACAATTCTTTTAATGGGGGG - Intronic
939680774 2:145129418-145129440 AAGCCCATGTTGTTCAAGGGTGG - Intergenic
946523261 2:220489632-220489654 GAACCCATGCTATTAATTGGAGG - Intergenic
947636582 2:231683479-231683501 AACCCCAAGTTGATAATGAGTGG + Intergenic
948296512 2:236864641-236864663 TCCCCCATGCTGGTAGTGGGTGG - Intergenic
1170516323 20:17134115-17134137 AACCCCATGCTAATAATTGCAGG - Intergenic
1172009927 20:31840874-31840896 ACCCCCATGATGTTATTGTGAGG - Intergenic
1177766265 21:25460819-25460841 AACACCATCCTGTTGATGGATGG - Intergenic
1178148641 21:29768659-29768681 AACCCCATGCTGCAGATCGGAGG + Intronic
1181971863 22:26696991-26697013 AACCCCATTTTTTTAATGGGCGG - Intergenic
1182778678 22:32850310-32850332 AACCCCACACTGTTAACAGGTGG - Intronic
1184824594 22:46940359-46940381 ACCTCCATGCTGTTCAAGGGTGG - Intronic
1184824604 22:46940419-46940441 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824628 22:46940651-46940673 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824646 22:46940789-46940811 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824665 22:46940932-46940954 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824680 22:46941072-46941094 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824689 22:46941150-46941172 GTCCCCATGCTGTTCAAGGGTGG - Intronic
1184824742 22:46941970-46941992 GGCCCCATGCTGTTCAAGGGTGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949626589 3:5874192-5874214 AACTGCATGCTGTTAATAAGGGG + Intergenic
955546322 3:60034867-60034889 AACTCAATGCTGTGAATGGCTGG - Intronic
959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG + Intronic
961465462 3:127078467-127078489 TTCCCCATTCTGTAAATGGGCGG - Intergenic
965676835 3:171206502-171206524 ATCTGCATGGTGTTAATGGGAGG - Intronic
970462262 4:16286712-16286734 AATGCCATTATGTTAATGGGTGG + Intergenic
977313442 4:95414732-95414754 ATCCACATGATGTTAATGAGAGG + Intronic
977928077 4:102723661-102723683 AACCCCATGGGGTTAGTGTGGGG - Intronic
978620402 4:110631112-110631134 AACCCCATGGGGTTAAATGGGGG - Intronic
982665407 4:158254887-158254909 AACTCCATTTTGTTAATGAGGGG - Exonic
993571569 5:89546350-89546372 AAACACATGCTGTTAGTGAGTGG + Intergenic
994090261 5:95803491-95803513 AACCCCATAGTGTCACTGGGAGG + Intronic
996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG + Intergenic
1002134192 5:177097953-177097975 AACCTCCTGCTGGTATTGGGAGG - Exonic
1003668265 6:8131670-8131692 AAACCCATACTGTTAAGGGGCGG + Intergenic
1005724304 6:28633864-28633886 AACCCAATTTTGTTAATGAGTGG + Intergenic
1005807266 6:29486621-29486643 AACCCCTTGCTGTTTGTGGTTGG - Intergenic
1006170536 6:32089343-32089365 GAACCCGTGCTGTGAATGGGGGG + Intronic
1021851159 7:24809765-24809787 GACCCCAGGCTGTGAGTGGGTGG - Intronic
1022704773 7:32792122-32792144 AAACCCATGCTGTTGAGGTGAGG + Intergenic
1022910108 7:34892725-34892747 AAACCCATGCTGTTGAGGTGAGG + Intergenic
1023921857 7:44636115-44636137 ATCCTCATGCAGTTCATGGGAGG + Intronic
1026555758 7:71407370-71407392 ACCCCCATGCTGGTAATTGATGG - Intronic
1038428350 8:27479872-27479894 AAGCCCAGGCTGTTAATAGATGG - Intronic
1043775999 8:84269550-84269572 AACCACATGCTGTCAATGACAGG + Intronic
1044006378 8:86941999-86942021 AACTCACTGCTGTCAATGGGTGG + Intronic
1047613122 8:126540179-126540201 AACCCCCAGGTGTTAAGGGGAGG + Intergenic
1055398169 9:75895155-75895177 GTCCACATGCTGTCAATGGGGGG - Intronic
1057146427 9:92762326-92762348 ACACGCATGCTGTTGATGGGGGG + Intronic
1059608415 9:115862199-115862221 CATCCCCTGCTGTCAATGGGAGG - Intergenic
1187012404 X:15293463-15293485 AACCTCATGAAGTTATTGGGTGG + Intronic
1187264756 X:17720787-17720809 ATACACATGCTGTTACTGGGGGG - Intronic
1190384162 X:49868358-49868380 AACACCATGGTGGTAATGGTCGG + Intergenic
1198135175 X:133742316-133742338 AACACCATGCTCTTAGTGTGGGG + Intronic