ID: 1071508163

View in Genome Browser
Species Human (GRCh38)
Location 10:86245334-86245356
Sequence CTGTCTGAGGGGTAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071508163_1071508169 -7 Left 1071508163 10:86245334-86245356 CCCAGCACCTACCCCTCAGACAG 0: 1
1: 1
2: 1
3: 24
4: 212
Right 1071508169 10:86245350-86245372 CAGACAGTCACCCATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071508163 Original CRISPR CTGTCTGAGGGGTAGGTGCT GGG (reversed) Intronic
900598710 1:3493984-3494006 CTGTGAGAGGGGTGAGTGCTTGG - Exonic
901931588 1:12599364-12599386 CTTTCTGTGGGGCTGGTGCTTGG - Intronic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
907044800 1:51294219-51294241 CTCTCTAAGGGGCAGGGGCTGGG + Intronic
907469508 1:54664140-54664162 CTATCTGAAGAGTGGGTGCTGGG + Intronic
907942590 1:59103816-59103838 CTGTCAGAGGGGAGGGGGCTAGG + Intergenic
908162677 1:61426476-61426498 CGGTTTGCGGGGGAGGTGCTGGG - Exonic
909525238 1:76614891-76614913 GTGACTGGGGGGTAGGGGCTAGG + Intronic
915658279 1:157380044-157380066 CTGTCGGAAGGGGAGGTGCTGGG + Intergenic
915670733 1:157486645-157486667 CTGTCAGAAGGGGAGGTGCTGGG - Intergenic
916273032 1:162964243-162964265 CTGTCTAAGGGGTGGGGGATAGG + Intergenic
916576249 1:166069790-166069812 CTGTCTGACTGGAGGGTGCTGGG - Intronic
917521037 1:175748660-175748682 TTGTCTGTATGGTAGGTGCTGGG - Intergenic
919918538 1:202154054-202154076 CTTTCTGAGAGGTATGAGCTGGG + Intronic
920212754 1:204340352-204340374 CTGTCTGAGAGGCGGCTGCTGGG + Intronic
922892905 1:229075237-229075259 CACTCTGAGGGGCTGGTGCTTGG + Intergenic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
924648001 1:245897298-245897320 CTCTCTGAGGAGTAGGTCGTGGG + Intronic
1063348436 10:5333389-5333411 CTGTCGGAGGGATGGGGGCTAGG + Intergenic
1067189371 10:44056834-44056856 GTGACTGAATGGTAGGTGCTGGG - Intergenic
1067989454 10:51194385-51194407 CTGTCAGGGGGTTGGGTGCTAGG - Intronic
1069693321 10:70368970-70368992 TTTTCTGAAGGGTAGGTCCTGGG - Intronic
1069870626 10:71530617-71530639 CTGTCGGAATTGTAGGTGCTTGG - Intronic
1069890235 10:71648055-71648077 CTGTCAGAGGGGAAGGGCCTGGG - Intronic
1070912939 10:80133695-80133717 CCGCCTGAGGGGTAGGTGAGGGG - Intronic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1072068305 10:91891759-91891781 CTATCTAAGGGGTTGGTGCCTGG + Intergenic
1072635732 10:97176650-97176672 CTGTCTGAGGAGGAGGTCCAAGG - Intronic
1073028472 10:100506069-100506091 CTCTGTGATGGGTAGGAGCTGGG - Exonic
1074418229 10:113286028-113286050 CTGCCTGAGAAGTGGGTGCTGGG + Intergenic
1074658270 10:115619464-115619486 TTGTGTCAGGGGTGGGTGCTGGG + Intronic
1075494367 10:122907133-122907155 CTGTCTGGGGAGTGCGTGCTGGG - Intergenic
1075681719 10:124338178-124338200 CTGTCTGCAGGGTGAGTGCTGGG - Intergenic
1075862893 10:125692723-125692745 CTTTTTGAGGGGAAGATGCTGGG + Intergenic
1076255007 10:129015647-129015669 CTGTCGGGGGGGTGGGGGCTGGG + Intergenic
1076707618 10:132310227-132310249 CTGACTGAGAGGCAGGTGCCTGG - Intronic
1077697657 11:4409151-4409173 CTGTCTGGGGGTGAGGGGCTAGG + Intergenic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078958293 11:16229070-16229092 CTATGTGATGGGTAGGTGCTAGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1081024395 11:37992113-37992135 CTCTCTGAGCGGTGGGTGGTGGG - Intergenic
1081029002 11:38054139-38054161 CTGACTGAAGGGTAGGTGAAAGG - Intergenic
1087116696 11:94533091-94533113 CTTTGTAAGGGGTAGGGGCTGGG - Intergenic
1088626321 11:111733015-111733037 CTGACTGAGGCGAAGGGGCTGGG + Intronic
1089042966 11:115471330-115471352 CTGTTTGAGCAATAGGTGCTTGG - Intronic
1089598301 11:119596662-119596684 CTGCCTGAGGGCTGGGTGCAGGG - Intergenic
1090659522 11:128871693-128871715 CAGTCTGAGGAGTAAATGCTGGG - Intergenic
1094811909 12:34146754-34146776 CTGTCTGAGGGTGGGGAGCTGGG + Intergenic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1098105783 12:67068696-67068718 CCGTCTGTGGGGTGGGTGCTGGG - Intergenic
1098858575 12:75682203-75682225 CTGTCTGGGGGTTGGGGGCTAGG + Intergenic
1107203391 13:37750795-37750817 CTGTCGGAGGGTTGGGGGCTAGG - Intronic
1107342062 13:39417981-39418003 CTGTCTGTGGATTGGGTGCTAGG - Intronic
1108592420 13:51923490-51923512 CTGCCTGAGGGTCTGGTGCTTGG - Intergenic
1111080628 13:83302184-83302206 CTGTCTGTGGCCTAGGGGCTTGG + Intergenic
1111494171 13:89026167-89026189 CTGTCGGGGGGTGAGGTGCTAGG + Intergenic
1112860441 13:103824110-103824132 CTGTCGGTGGGGTAGGGGCTGGG - Intergenic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113166376 13:107448101-107448123 CTGACTGAGAGGCAGGGGCTCGG - Intronic
1113427448 13:110220809-110220831 GGGTCTGAGGGGTGGGAGCTGGG + Intronic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1115212714 14:30983971-30983993 GTGTCTGAGAGGCAGGTACTAGG + Intronic
1120557587 14:85948140-85948162 CCGTCTCAGTTGTAGGTGCTGGG - Intergenic
1121576528 14:94993298-94993320 CTGACTGAGAGGCAGGTGTTTGG - Intergenic
1122269868 14:100564075-100564097 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122269888 14:100564132-100564154 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1123857432 15:24427251-24427273 ATGTCTGAGGGGTCTGCGCTGGG + Intergenic
1124232987 15:27961792-27961814 CTGTCGGAGGGTTGGGGGCTAGG + Intronic
1124577767 15:30924853-30924875 CTTTGTGAGGGGCAGCTGCTGGG + Intronic
1126198873 15:45962472-45962494 AGGTCTGAGGGGTAGGTGTGAGG + Intergenic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1133610270 16:7426819-7426841 CTGTCTGGGGGACAGGTCCTTGG + Intronic
1134188409 16:12101913-12101935 CTGTCTGAGGGTAGGGGGCTAGG - Intronic
1136393880 16:29982549-29982571 CTGTCTGGGGAGTAGGTACTGGG + Intronic
1136630188 16:31485432-31485454 CAGTCTGAGGGGTCTATGCTGGG + Intronic
1137936201 16:52637719-52637741 CTGGCAGAGGGGGAGTTGCTTGG + Intergenic
1137963560 16:52909421-52909443 CTGTCTCCGAAGTAGGTGCTGGG - Intergenic
1138531448 16:57636558-57636580 CTATGTGAGGGGTAGGGGATAGG - Intronic
1138624097 16:58235717-58235739 CTCTCAGAGGAGGAGGTGCTGGG + Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140031780 16:71344937-71344959 CTTTCTATGGGGTTGGTGCTGGG - Intergenic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1141272490 16:82553960-82553982 GTGTCTGATGGGTAGGGGCTAGG - Intergenic
1141383123 16:83593873-83593895 CTGTGGTAGTGGTAGGTGCTGGG + Intronic
1141910584 16:87056083-87056105 CTGTCTGACAGGTAGGAGGTGGG - Intergenic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1145230476 17:21170032-21170054 CTGGTTGAGGGGTGGGGGCTTGG - Intronic
1146890418 17:36503010-36503032 CTGTCTTAGGGCTAGGGGCTGGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147995765 17:44359706-44359728 CTGGCTGGGGGGTAGGGGGTGGG - Intronic
1149107998 17:52992373-52992395 CTGTATCAGGGGTTGGTGTTGGG + Intergenic
1151376371 17:73691577-73691599 CTGTATGAGGGAAAGCTGCTGGG - Intergenic
1151834309 17:76573174-76573196 AGGTATGAGGGGTAGGAGCTGGG - Exonic
1151909188 17:77070371-77070393 CTGTCTGACGGTGTGGTGCTTGG - Intergenic
1152887950 17:82863583-82863605 CTGGTTGAGGGGTTAGTGCTCGG + Intronic
1161010583 19:1957787-1957809 GTGTGTGGGGGGTATGTGCTCGG + Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161501287 19:4617488-4617510 CTGACTGAGGGGTCAGGGCTGGG - Intergenic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162730527 19:12715786-12715808 CAGTGGGAGGGGGAGGTGCTAGG - Intronic
1165807158 19:38587487-38587509 CTGCCTTAGGGGGAGGGGCTTGG - Intronic
1165981187 19:39725683-39725705 CTGTCTGGGGGTTGGGGGCTAGG + Intergenic
1166042984 19:40214294-40214316 CTGCCTGAGGGGTCGTGGCTGGG - Intronic
1166224682 19:41387635-41387657 TTATCTGAGGGGAAGGTCCTAGG - Intronic
1166331952 19:42083457-42083479 CTGTCAGAGGGTGAGGGGCTAGG - Intergenic
1167339142 19:48904476-48904498 CTGTGGGAGGGGTACGTGCTGGG + Intronic
1168543363 19:57231017-57231039 CTCTCTGAGCGGTTGGTGCCGGG + Intronic
926729508 2:16025613-16025635 CTGTCACATGGGTAGGGGCTGGG + Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929567987 2:43001694-43001716 CTCTCTGAGGGGCAGGCACTGGG - Intergenic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG + Intronic
934916007 2:98301523-98301545 GTGTCTGACAGGTAGGTGTTAGG + Intronic
935361802 2:102251540-102251562 CTGTCTTAAGGGAAGGTGCCTGG - Intergenic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
938267924 2:129942515-129942537 CTGTCAGGGGGTGAGGTGCTGGG - Intergenic
938839109 2:135140987-135141009 CTTTCTGAAGGGTAGGAGGTAGG + Intronic
940206642 2:151210037-151210059 CTGTCGGGGGGTGAGGTGCTGGG - Intergenic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
946408221 2:219503824-219503846 GCGTCTGAGAGGTAGGTGGTGGG + Intronic
1169956431 20:11108192-11108214 CTGGGTGGGGGGTAGGTTCTGGG + Intergenic
1170052267 20:12158995-12159017 CTGCCTGAGGGAAAGCTGCTTGG - Intergenic
1173190937 20:40875181-40875203 CTGTCTTAGAGTTAAGTGCTAGG - Intergenic
1173768613 20:45637522-45637544 GGGTCTGAGGGGTGGATGCTGGG - Intergenic
1175245864 20:57581584-57581606 CTTGCTGTGGGCTAGGTGCTGGG + Intergenic
1175768140 20:61605287-61605309 CTGCCTGTGGGGTGGGTCCTTGG + Intronic
1176703554 21:10090012-10090034 CTGTCAGAGGGTGAGGGGCTAGG + Intergenic
1177700222 21:24629587-24629609 CTCTCTCATGGGTAGGTTCTGGG - Intergenic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180629913 22:17221434-17221456 CTGTCGGGGGGGTCGGGGCTGGG - Intronic
1181378639 22:22481229-22481251 CTGTCTGAGGGATGTGTGCATGG - Intergenic
1182116420 22:27759161-27759183 CTTTCTCAGTGGTAGGTTCTTGG - Intronic
1184413264 22:44337981-44338003 CTTTCTGAGAGGGTGGTGCTTGG + Intergenic
1184453848 22:44598154-44598176 CTCACTGAGGGGTAGGGGCTGGG - Intergenic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185223835 22:49642173-49642195 CTATCTGGGGGGAAGGTGCCAGG - Intronic
950494501 3:13325673-13325695 CCGTCTGAGGGGTTGGGTCTGGG - Intronic
950545712 3:13636891-13636913 GTGTCTGAGGGCTAGGAGCCTGG + Intronic
951046075 3:18039990-18040012 CTTCCTGAGGGGTAGGGGTTAGG + Intronic
951073505 3:18361487-18361509 CTGGCTTAGGGGAAGATGCTTGG - Intronic
951916518 3:27806290-27806312 CTGGCAGAGGGGTTGGGGCTGGG + Intergenic
952128834 3:30335876-30335898 CTTTCTGGAGGGTAGGTGCAGGG - Intergenic
952820722 3:37483568-37483590 CAGTCTCTGGGGTGGGTGCTGGG + Intronic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
955093851 3:55777400-55777422 TGGTCTGAGGGGTAGGTCCTTGG - Intronic
955364538 3:58299833-58299855 CTGGCAGAGGGGTGGGTGCTGGG + Intergenic
957010701 3:75003033-75003055 CTGTCAGGGGGTTGGGTGCTAGG - Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
958888706 3:99758803-99758825 CAGTCTCAGTGGTAGGTGCAGGG - Intronic
959598009 3:108148597-108148619 CTGTCGGAGGGTTGGGTGCCAGG + Intergenic
960847131 3:122014859-122014881 CTGGTTGAGGGGCAGATGCTTGG + Intronic
960903025 3:122570959-122570981 CTATCTGAAGGCTAGATGCTCGG + Intronic
961151746 3:124644473-124644495 CTGTCTGGGGGTTGGGGGCTAGG - Intronic
961450081 3:126998722-126998744 CTTGCTGAGGGGTTGCTGCTGGG + Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
963328818 3:143891896-143891918 CTGTCTTAGGGGCAGCTTCTGGG - Intergenic
964393322 3:156219864-156219886 CTGTCAGGGGGTTAGGGGCTGGG - Intronic
966041041 3:175488430-175488452 TTGTCTGGTGTGTAGGTGCTGGG + Intronic
966578658 3:181534116-181534138 CTGCTTGAGGTGTAGCTGCTGGG - Intergenic
968703507 4:2067503-2067525 CTGGCTGTGTGGCAGGTGCTGGG + Exonic
969058221 4:4415233-4415255 CTGACTGAGTGCTGGGTGCTGGG + Intronic
969442005 4:7222776-7222798 CTGTGTGGGGTGTGGGTGCTGGG + Intronic
969613206 4:8238314-8238336 CTGTCTGGAGAGGAGGTGCTGGG + Intronic
970212236 4:13721623-13721645 CTGTCTGAGGGGTGGGGTGTGGG + Intergenic
970323760 4:14901630-14901652 CTGTCTGTGGGGCAGGGGTTGGG + Intergenic
975648506 4:76568787-76568809 CTCCCTGAGGGGTAGGAGGTGGG - Intronic
976831745 4:89322949-89322971 CTGTCAGAGGAGTAGTTTCTAGG - Intergenic
980375773 4:131946368-131946390 CTGTCAGAGGGTGAGGGGCTAGG + Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
982998021 4:162375957-162375979 CTGTCTGAAGAGTAGTTTCTTGG - Intergenic
985848698 5:2372882-2372904 CTGTCTGGGGGTTGGGGGCTAGG - Intergenic
986557452 5:9025796-9025818 GTGTCTCAGCAGTAGGTGCTGGG - Intergenic
987343768 5:16960928-16960950 CTGGCTGAAGGGAATGTGCTGGG + Intergenic
991187288 5:63825083-63825105 TGGTCTGAAGTGTAGGTGCTAGG - Intergenic
991651621 5:68861404-68861426 TTTTTTGAGGGGTAGGGGCTGGG - Intergenic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
993641481 5:90410656-90410678 ATGTCTGGTGCGTAGGTGCTCGG + Intergenic
996882901 5:128321441-128321463 CTGTCGGAGGGTGAGGGGCTAGG - Intronic
997967956 5:138374918-138374940 CTATTTGAGGGGTAGATGCTAGG + Intronic
999052207 5:148534735-148534757 CAGACTGAAGGGTATGTGCTGGG - Intronic
1000075648 5:157782892-157782914 TGGTCTCAGGGGTAGGTGATTGG - Intergenic
1001039185 5:168320606-168320628 CTGTGTGTTTGGTAGGTGCTGGG + Intronic
1001139736 5:169134594-169134616 CTGTCGGAGGGCTGGGGGCTGGG + Intronic
1001452042 5:171834173-171834195 CCTGCTGAGGGTTAGGTGCTTGG - Intergenic
1002157457 5:177294383-177294405 CTGACTGAGGGTGAGGAGCTTGG - Exonic
1003740862 6:8937530-8937552 CTGTCAGAGGGTCAGGGGCTGGG - Intergenic
1004886278 6:20054197-20054219 CTGTCTGCTGGGTAGGTGCGAGG - Intergenic
1005869511 6:29964100-29964122 CTGTCTGAGGGTAGGGGGCTAGG + Intergenic
1006446959 6:34084973-34084995 CTGTGTGCAGGGCAGGTGCTAGG + Intronic
1007620720 6:43212912-43212934 CTGGCTCAGGGCTAGGCGCTGGG + Intronic
1008058153 6:46966905-46966927 CTCTCTGCGTGGTAGGTGCCGGG - Intergenic
1010250648 6:73703755-73703777 CTGTATAAGGGGTGGGGGCTGGG + Intronic
1010606515 6:77895707-77895729 CTAACTCAAGGGTAGGTGCTGGG - Intronic
1012334755 6:98041414-98041436 CTGTGTTAGGGGTTGGAGCTGGG - Intergenic
1013040901 6:106432500-106432522 CTCCCTGGGGGGTAGGTACTGGG - Intergenic
1015925737 6:138308644-138308666 CTGTCTCAGTGGAACGTGCTGGG + Intronic
1017131309 6:151110550-151110572 CTGGCTGAGAGGAAGGGGCTTGG + Intergenic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1017862565 6:158412771-158412793 CCATCTGAGAGGCAGGTGCTGGG + Intronic
1018913869 6:168120959-168120981 CTGCCTGAGGTGCTGGTGCTGGG + Intergenic
1019144816 6:169969859-169969881 CTGTCGGATGGGGATGTGCTGGG - Intergenic
1025943841 7:66091923-66091945 CTGGCAGAGGGGCAGGTCCTGGG + Intronic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1026944324 7:74306400-74306422 CTCCCGGAGGGGCAGGTGCTTGG - Intronic
1028476782 7:91262945-91262967 CTGACGGAGAGGTAGGTGCAAGG - Intergenic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032835089 7:135665169-135665191 CTCTCAGAAGGGTAGGTGATAGG + Intronic
1033289422 7:140070453-140070475 CTTTCAGAGGGGCAGGTCCTTGG - Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1043629757 8:82315169-82315191 CTGTCTGGGGGTTGGGGGCTAGG - Intergenic
1045798240 8:106071031-106071053 CTGTCGGGGGGATAGGGGCTAGG + Intergenic
1046466050 8:114604696-114604718 CTGTCGGAGGGTTGGGAGCTAGG + Intergenic
1048021033 8:130539311-130539333 CTGTCAGGGGGTTAGGGGCTGGG - Intergenic
1048041649 8:130735209-130735231 TTGTCTGTGGGCTATGTGCTTGG - Intergenic
1049747057 8:144267408-144267430 CTGCATGAGGGGTAAGAGCTAGG + Intronic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1049986951 9:960662-960684 CTGGCTGAGGGGTACGAGCTGGG + Intronic
1052336706 9:27327589-27327611 GTGTCTGAGTGGTGGGTGGTGGG - Exonic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053640817 9:40077033-40077055 CTGTCAGAGGGTGAGGGGCTAGG + Intergenic
1053765319 9:41388439-41388461 CTGTCAGAGGGTGAGGGGCTAGG - Intergenic
1054321504 9:63673016-63673038 CTGTCAGAGGGTGAGGGGCTAGG + Intergenic
1054543935 9:66299599-66299621 CTGTCAGAGGGTAAGGGGCTAGG - Intergenic
1055360798 9:75488466-75488488 CAGTCAGAGGGCTATGTGCTAGG + Intergenic
1057024987 9:91727955-91727977 CTTTCAGAGGGGAAGCTGCTAGG - Intronic
1058548426 9:106086437-106086459 CTGTCTGGGGGTTGGGGGCTAGG - Intergenic
1061071726 9:128314952-128314974 CTGTCAGAGTGGTAGAAGCTGGG + Intronic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1062428439 9:136516645-136516667 CTTTCTGAGGGCTCGATGCTGGG - Intronic
1202788589 9_KI270719v1_random:60107-60129 CTGTCAGAGGGTGAGGGGCTAGG + Intergenic
1186481364 X:9898343-9898365 CTGTACGATGGGTGGGTGCTTGG + Intronic
1188068999 X:25695970-25695992 ATCTCTGAGGGCTAGGGGCTGGG - Intergenic
1188891921 X:35622342-35622364 CTTTCTGGAGAGTAGGTGCTGGG + Intergenic
1192068260 X:67909859-67909881 CTGTCTGAGGGAGAGGTGTGGGG + Intergenic
1195424156 X:104708876-104708898 TTTTCTGATTGGTAGGTGCTTGG + Intronic
1196516901 X:116624545-116624567 CTGTCTGGGGGTTGGGGGCTAGG + Intergenic
1198873222 X:141197312-141197334 CTGTCTCAGGGATAGGTTCCCGG - Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic