ID: 1071513742

View in Genome Browser
Species Human (GRCh38)
Location 10:86283284-86283306
Sequence CTATTTGCACAGGTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071513729_1071513742 6 Left 1071513729 10:86283255-86283277 CCAGCCCCCACACTATCCCTTCC 0: 1
1: 0
2: 1
3: 74
4: 631
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513730_1071513742 2 Left 1071513730 10:86283259-86283281 CCCCCACACTATCCCTTCCTCTG 0: 1
1: 0
2: 4
3: 48
4: 776
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513728_1071513742 7 Left 1071513728 10:86283254-86283276 CCCAGCCCCCACACTATCCCTTC 0: 1
1: 0
2: 1
3: 48
4: 372
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513734_1071513742 -10 Left 1071513734 10:86283271-86283293 CCCTTCCTCTGTGCTATTTGCAC 0: 1
1: 0
2: 4
3: 20
4: 217
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513732_1071513742 0 Left 1071513732 10:86283261-86283283 CCCACACTATCCCTTCCTCTGTG 0: 1
1: 0
2: 0
3: 26
4: 307
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513733_1071513742 -1 Left 1071513733 10:86283262-86283284 CCACACTATCCCTTCCTCTGTGC 0: 1
1: 0
2: 3
3: 46
4: 425
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513727_1071513742 19 Left 1071513727 10:86283242-86283264 CCTCTGGAAAAGCCCAGCCCCCA 0: 1
1: 0
2: 4
3: 30
4: 348
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data
1071513731_1071513742 1 Left 1071513731 10:86283260-86283282 CCCCACACTATCCCTTCCTCTGT No data
Right 1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071513742 Original CRISPR CTATTTGCACAGGTTGGGGA GGG Intronic
No off target data available for this crispr