ID: 1071521615

View in Genome Browser
Species Human (GRCh38)
Location 10:86334843-86334865
Sequence GATTTAACAGGCCTGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071521615_1071521617 -7 Left 1071521615 10:86334843-86334865 CCAGAACACAGGCCTGTTAAATC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071521617 10:86334859-86334881 TTAAATCCACTGCCATCTCCTGG No data
1071521615_1071521619 4 Left 1071521615 10:86334843-86334865 CCAGAACACAGGCCTGTTAAATC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071521619 10:86334870-86334892 GCCATCTCCTGGCCAGCCAGCGG No data
1071521615_1071521626 30 Left 1071521615 10:86334843-86334865 CCAGAACACAGGCCTGTTAAATC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071521626 10:86334896-86334918 TGGCAGGTAAACCTGTCAAGTGG No data
1071521615_1071521621 10 Left 1071521615 10:86334843-86334865 CCAGAACACAGGCCTGTTAAATC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071521621 10:86334876-86334898 TCCTGGCCAGCCAGCGGTGCTGG No data
1071521615_1071521623 14 Left 1071521615 10:86334843-86334865 CCAGAACACAGGCCTGTTAAATC 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1071521623 10:86334880-86334902 GGCCAGCCAGCGGTGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071521615 Original CRISPR GATTTAACAGGCCTGTGTTC TGG (reversed) Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
904021723 1:27471785-27471807 GATTGAACAGGCCTTCCTTCTGG - Intronic
906733900 1:48105844-48105866 GATTTAATAGGTCTGAGTTGGGG + Intergenic
907275585 1:53315001-53315023 CATGTCACAGGCCTGTGTCCTGG + Intronic
908055366 1:60280461-60280483 GATTCGACAGGCCTCTGTGCTGG + Intergenic
909779914 1:79531419-79531441 TAAATAACAGGACTGTGTTCAGG + Intergenic
909780150 1:79534732-79534754 TAAATAACAGGACTGTGTTCAGG + Intergenic
910337326 1:86149269-86149291 GTTTTAAAATGCCTGTGTTATGG - Intronic
912881486 1:113420659-113420681 AATTTAACAGGCCTATGTGAAGG + Intronic
914378400 1:147093739-147093761 AATTTAACAGGACTGTTTTAGGG + Intergenic
914808255 1:151007546-151007568 GATCCAACACGCCTGTGCTCTGG + Intronic
916512331 1:165483264-165483286 GATTTAGCTGGCATGTGTTGAGG - Intergenic
917759277 1:178137957-178137979 GATTTAAAGGGCAGGTGTTCTGG + Intronic
919606742 1:199692708-199692730 CTTTTATCAGGCCTATGTTCTGG - Intergenic
920293204 1:204938723-204938745 GATTTAAAGGCCTTGTGTTCAGG + Intronic
920675812 1:208038130-208038152 GATTTAACAGGTCTGGGGTAAGG - Intronic
921045169 1:211471367-211471389 GATTTAACTGGCCTGAGATGTGG + Intergenic
921046665 1:211482628-211482650 TATTTAGCAGGCCTGTGTGGGGG - Intronic
1065902814 10:30223608-30223630 TATTTGACAGGCACGTGTTCCGG - Intergenic
1066090105 10:32008958-32008980 GATTTTACATGGCTGAGTTCAGG - Intergenic
1070742663 10:78913059-78913081 GATTCAACAGGTCTGTGCTGGGG + Intergenic
1071521615 10:86334843-86334865 GATTTAACAGGCCTGTGTTCTGG - Intronic
1071754418 10:88520740-88520762 GTTTTAATAGGCCAGTATTCTGG - Intronic
1071964710 10:90840890-90840912 GAGTCAACAGACCTGAGTTCAGG - Intronic
1074993610 10:118735453-118735475 GATTCAGCAGGTCTGTGTTGGGG - Intronic
1082686218 11:56242170-56242192 TGTTTCACAGGCCTGTGTTAGGG - Intergenic
1091812986 12:3415307-3415329 AATTCAACAGGACTGGGTTCGGG - Intronic
1094097501 12:26723647-26723669 GCTTTGACTGCCCTGTGTTCTGG + Intronic
1094600521 12:31905165-31905187 CATATGACAGGTCTGTGTTCTGG + Intergenic
1097237817 12:57551686-57551708 CCTTTAACAAGCCTGTGTCCAGG - Intronic
1107285592 13:38787136-38787158 AATTTACCAGCCCTGTGTTCTGG - Intronic
1107375572 13:39800661-39800683 GAATTAACTGGGCTGTCTTCGGG + Intergenic
1111847301 13:93527537-93527559 GCTTTAAAATGTCTGTGTTCAGG - Intronic
1113271713 13:108681998-108682020 GATTTAGCAGGTCTGTGATGGGG - Intronic
1114446792 14:22794779-22794801 GCTTTAACAGTCCAGTGCTCAGG + Intronic
1118962023 14:70542641-70542663 AATTTAAAAGGCCTATGTCCAGG + Intergenic
1121771787 14:96551215-96551237 GAGTTAACAGGCCACTGTTGGGG - Intronic
1122043113 14:99003938-99003960 GATGTAAGATGCCTGAGTTCAGG + Intergenic
1122449306 14:101792033-101792055 GATTTAACAAACCAGTGTTGTGG - Intronic
1124932953 15:34140752-34140774 TATTTAAGAGGCCAGTTTTCAGG - Exonic
1125439017 15:39681095-39681117 GATTTAACTGGCATATCTTCAGG + Intronic
1126827486 15:52566444-52566466 AATTTAAAAGGCCTGTGCTGTGG - Intronic
1128740055 15:70077623-70077645 GTTTTTGCAGGCCTGTGTCCTGG + Intronic
1129335718 15:74851038-74851060 GAGTTCACAGGCCTGTGGGCAGG + Intronic
1138238763 16:55409065-55409087 GATGAAACAGCCCTGAGTTCTGG - Intronic
1139327343 16:66162765-66162787 GATTTAACAGATATGTGTTCAGG - Intergenic
1141610491 16:85178481-85178503 GATTTAACAGGCCTGGGGGCAGG - Intronic
1142882202 17:2890533-2890555 GGTTTAACACGCCTCTGTGCTGG + Intronic
1144792310 17:17867265-17867287 TATTTCATAGGGCTGTGTTCAGG + Intronic
1148295676 17:46500601-46500623 GATTTAGTAGGCCTGGGTTTAGG + Intergenic
1150406921 17:64909350-64909372 GATTTAGTAGGCCTGGGTTTAGG - Intronic
1154969302 18:21391537-21391559 GAGTTAAGAGACCTGGGTTCTGG + Intronic
1155987379 18:32244603-32244625 GATTTCACTGGCCTGTATTTGGG + Intronic
1156991515 18:43414236-43414258 GCTTTAACAGGGCTTTATTCCGG - Intergenic
1162051328 19:8035536-8035558 GATTTAAAAGGCCTGTGTAGCGG - Intronic
1164390281 19:27813876-27813898 GATGTAGCAGGGCTGTGATCAGG + Intergenic
1165281507 19:34802195-34802217 GAGTTCACAGGACTGTTTTCAGG + Intergenic
1165714538 19:38035954-38035976 GGTGTAGCAGGACTGTGTTCTGG + Intronic
1167560687 19:50225255-50225277 GATTTAAGAGTCCTGTTTTGTGG + Intronic
925213794 2:2074688-2074710 GATTAAACAGTCCAGTCTTCTGG + Intronic
926078555 2:9963958-9963980 GATAGAACTGGCCTTTGTTCAGG - Exonic
931022820 2:58069204-58069226 GTTTTAACAGGTCTGTGTTTGGG + Intronic
933030615 2:77324307-77324329 GACTTAACAGTCCTGTGGGCTGG + Intronic
936452079 2:112641355-112641377 GATTTTACATGCCTCTGTCCTGG - Intergenic
941816068 2:169797446-169797468 TATTTAACAGGGTTGTGCTCAGG - Intronic
942255190 2:174090022-174090044 GATTTCACAGTCCTCTGTGCTGG - Intronic
943000138 2:182316999-182317021 GGTTTAAAAGGCTTGTGTTTTGG + Intronic
944966273 2:204937881-204937903 GTTTTAACAGGATTGTCTTCGGG + Intronic
947456407 2:230258031-230258053 GCTTTCAGAGGCCTGTGTACTGG + Intronic
1169981850 20:11393724-11393746 GATTTAACTGGCCTAGGTGCTGG - Intergenic
1171114847 20:22516290-22516312 GATTTAAGAGGCACGTGTGCAGG - Intergenic
1171846145 20:30276111-30276133 GATTTAAGCGGCCTGTGGACAGG - Intergenic
1175582588 20:60112105-60112127 TATTTAAAATGCCTGTTTTCAGG - Intergenic
1175754258 20:61519540-61519562 GATGTGACGGGTCTGTGTTCAGG + Intronic
1178411056 21:32364112-32364134 GATGTCACAGGCCTGTGATGTGG - Intronic
1178970690 21:37174317-37174339 AACTTATCAGGCCTGTGATCTGG - Intronic
1178977559 21:37232592-37232614 AATTTGACAGAACTGTGTTCAGG - Intronic
1179032298 21:37731253-37731275 GATTTAAGGGGCTTGTGTTTGGG + Intronic
1179445199 21:41426035-41426057 GATTCAGCAGGCCTGGGTTCGGG + Intronic
1181095876 22:20504941-20504963 GTTTTGAAAGTCCTGTGTTCTGG - Intronic
1182991770 22:34774851-34774873 GATTTATCAGACCTGGGTTAGGG + Intergenic
952257869 3:31710996-31711018 CATTCAACAGGCTGGTGTTCTGG + Intronic
956191203 3:66610199-66610221 AATTTAACTGGCATGTGTCCAGG + Intergenic
958051454 3:88352711-88352733 GATATCACAAGCCTGTGGTCCGG - Intergenic
965507393 3:169531583-169531605 GAGTTAGGAGGCCTGGGTTCAGG - Intronic
965668677 3:171123435-171123457 GAAATAAAAGGCATGTGTTCTGG + Intronic
966070035 3:175864772-175864794 GATTTAAAAGATCTGTGTTATGG - Intergenic
966632993 3:182099089-182099111 GATTTAATAGACGTGTTTTCAGG - Intergenic
971585495 4:28400899-28400921 GATTTAACACTCATATGTTCTGG - Intronic
973918924 4:55664970-55664992 GTCTTTGCAGGCCTGTGTTCTGG + Intergenic
974335512 4:60539350-60539372 GATTTAACAGGTCTGGGATCGGG + Intergenic
976778456 4:88732018-88732040 GATTTGAAAGCCCTGTGTCCTGG + Exonic
979210359 4:118093684-118093706 GGTCTAACAGGCCTGTGATCTGG - Intronic
982469316 4:155768130-155768152 TTTTCAACATGCCTGTGTTCAGG + Intronic
982743986 4:159087294-159087316 TATTCAAGAGCCCTGTGTTCTGG - Intergenic
983986083 4:174061930-174061952 GAGTTCACAGGCCTGAGATCTGG - Intergenic
991609269 5:68434161-68434183 GATTTCACAGGCCCCTGCTCAGG - Intergenic
991732052 5:69599032-69599054 GATTCAACAGGCCTGTGATGGGG - Intergenic
991808485 5:70454175-70454197 GATTCAACAGGCCTGTGATGGGG - Intergenic
991862899 5:71028826-71028848 GATTCAACAGGCCTGTGATGGGG + Intergenic
993217928 5:85049144-85049166 GATTGAATAGGTCTGTGTACAGG - Intergenic
994956984 5:106545207-106545229 GATTTTTCAGGCCTGTCTTCGGG + Intergenic
998219499 5:140265085-140265107 ACTTTAAAAGGACTGTGTTCGGG + Intronic
999222714 5:149994472-149994494 GATTTAATAGGCCTGGGATATGG + Exonic
1000452160 5:161402915-161402937 AATTTAAGAGGCCTGTGGTGTGG + Intronic
1001120929 5:168979258-168979280 AATATCACAGGCCTGTGTTGGGG + Intronic
1002052568 5:176579580-176579602 GAATTAACTGGCCTGAGTTCAGG + Intronic
1008029275 6:46675048-46675070 GATTTACCAAGCCTCTGTACAGG - Intronic
1008131579 6:47725340-47725362 GATTTAACAGCCCTCAGTGCAGG + Intergenic
1011483008 6:87813960-87813982 GATAGAAGACGCCTGTGTTCCGG - Intergenic
1013390992 6:109686316-109686338 GTTTTAAAAGGCCAGTGGTCTGG + Intronic
1013737306 6:113242636-113242658 AATATAACAAGCCTGTGGTCTGG - Intergenic
1014707411 6:124764631-124764653 GCTTTAAGAAACCTGTGTTCAGG + Intronic
1022691618 7:32661970-32661992 GATTGAACAGTTCTGTTTTCAGG - Intergenic
1032847191 7:135761815-135761837 CATTGAAGAGGCCTCTGTTCAGG + Intergenic
1040585542 8:48737100-48737122 GATGTACTAGGCCTGTGTTGGGG + Intergenic
1044439762 8:92209465-92209487 CATTTAACATGACTGAGTTCAGG + Intergenic
1044778065 8:95714306-95714328 GATTTTACAGATCTTTGTTCAGG - Intergenic
1045227299 8:100261529-100261551 GTTTTAACAGGTGTGTGTTTTGG - Exonic
1048904971 8:139078799-139078821 GTTCTAACAGCCCAGTGTTCTGG - Intergenic
1051130018 9:13850311-13850333 GATTTAGATAGCCTGTGTTCCGG + Intergenic
1054948318 9:70821047-70821069 GATTTAACAGTCATCTTTTCTGG - Intronic
1059126044 9:111686503-111686525 CATTTAAATGGCCTGTGTGCAGG + Exonic
1060292272 9:122314920-122314942 GATTGAACAGGCATGTGGGCTGG + Intronic
1060491004 9:124084191-124084213 GATTTAGCAGGGCTGAGGTCAGG - Intergenic
1060780563 9:126409169-126409191 GATTGAAGAGGCCTGGGTTTTGG + Intronic
1060842730 9:126806188-126806210 TGTTTAACAGGCCTGTCTACAGG + Intronic
1061730347 9:132609298-132609320 GATTTAACAGGGCTTTATTTAGG - Intronic
1192008585 X:67242977-67242999 GCTTTCACAGGCTTGTGTTGAGG - Intergenic
1192197365 X:69037571-69037593 GCTTTAAGAGGCCTGAGTTCTGG + Intergenic
1193909073 X:87280282-87280304 GTTTTAACAGGCCCTTCTTCTGG + Intergenic
1196964138 X:121037304-121037326 GAATTATCAGGCCTGTGTCAAGG - Intergenic
1199460111 X:148074923-148074945 GATTTATTAGACCTGTTTTCAGG + Intergenic
1199656528 X:150000489-150000511 ACTTGAACAGGCTTGTGTTCAGG - Intergenic
1200927412 Y:8666905-8666927 GATAAAACCTGCCTGTGTTCCGG + Intergenic