ID: 1071522736

View in Genome Browser
Species Human (GRCh38)
Location 10:86341135-86341157
Sequence CTGAACAATAAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071522736_1071522742 6 Left 1071522736 10:86341135-86341157 CCTCCCTCCTCCTTATTGTTCAG 0: 1
1: 0
2: 1
3: 21
4: 337
Right 1071522742 10:86341164-86341186 TTTAAGAAACCCCCTGCTCCAGG No data
1071522736_1071522749 27 Left 1071522736 10:86341135-86341157 CCTCCCTCCTCCTTATTGTTCAG 0: 1
1: 0
2: 1
3: 21
4: 337
Right 1071522749 10:86341185-86341207 GGGACTGTCCCTGATCCCCCAGG No data
1071522736_1071522743 7 Left 1071522736 10:86341135-86341157 CCTCCCTCCTCCTTATTGTTCAG 0: 1
1: 0
2: 1
3: 21
4: 337
Right 1071522743 10:86341165-86341187 TTAAGAAACCCCCTGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071522736 Original CRISPR CTGAACAATAAGGAGGAGGG AGG (reversed) Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
901186594 1:7377384-7377406 GAGAACAGTAAGGAGGAGGGAGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
904479764 1:30786563-30786585 CTGAGCAAGGAGGTGGAGGGAGG + Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
907274024 1:53307070-53307092 CTGAGCAATACTGAGTAGGGGGG + Intronic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
908643583 1:66252129-66252151 TTGAAGGATAAGGAAGAGGGAGG + Intronic
909328613 1:74385032-74385054 CTGATCAATTAGGAGGAGTGAGG - Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
912637591 1:111312381-111312403 CTGAAAAATAAGTAGGATGAGGG + Exonic
914049825 1:144122399-144122421 CTAAACCATAAGAGGGAGGGAGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915721019 1:157985711-157985733 CTGAACAATAGGATGGAGGTTGG + Intergenic
916184493 1:162117586-162117608 CTGAAAGACAAGGAGGAGTGAGG - Intronic
917038924 1:170780709-170780731 CTGGACATTGAGGAAGAGGGAGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917442722 1:175081170-175081192 CAGAACAAGATGGAGGATGGTGG + Intronic
918243882 1:182642536-182642558 CTGAAGAAGAAGGAGCAGGTGGG - Intergenic
920790042 1:209081424-209081446 ATGTAGAATAAAGAGGAGGGAGG - Intergenic
921913260 1:220576012-220576034 CTGAAAAGAAAGGATGAGGGAGG - Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
923267371 1:232327765-232327787 GGGAACAATAAGGAGGGAGGAGG - Intergenic
924006267 1:239615072-239615094 CTGAAGAAAAAGGATGCGGGAGG + Intronic
924172821 1:241358681-241358703 CTGAACAAGAGGGAAGAGAGAGG - Intergenic
924427119 1:243962073-243962095 CTGAAGATTGAGGATGAGGGTGG + Intergenic
924551843 1:245085476-245085498 CTGAACAAAAATGGGGAGGTAGG + Intronic
924945298 1:248842507-248842529 CTGAGCAATGAGTACGAGGGAGG + Intronic
1063781219 10:9327451-9327473 ATGAACAGTAAGGAGGAGCATGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1066454873 10:35564411-35564433 AAGAACAGTAAGGAGGCGGGTGG - Intronic
1067242733 10:44509726-44509748 CTGAGCTATAAGGAGAAAGGGGG - Intergenic
1068636436 10:59353129-59353151 CTGAAGAAGATGGAAGAGGGCGG + Intronic
1070722344 10:78765320-78765342 AGGAAAAATAAGGAGCAGGGTGG + Intergenic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1072286162 10:93917610-93917632 CTGAAGAATGAGGGGGAGTGGGG + Intronic
1072982655 10:100112639-100112661 CTGAATAAATAGGAGTAGGGTGG + Intergenic
1073079353 10:100848700-100848722 CCGTAATATAAGGAGGAGGGAGG + Intergenic
1074677307 10:115866256-115866278 CTGAACAATTATAAGGAGTGGGG + Intronic
1075834630 10:125443183-125443205 CTGGACCAAAAGGAGGAGGTTGG - Intergenic
1075906894 10:126089468-126089490 CTGTACAAAAAAGAAGAGGGAGG - Intronic
1077167690 11:1151151-1151173 TTACACAATAAGGAGGAAGGAGG - Intergenic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1080048734 11:27836694-27836716 TAGGACAATGAGGAGGAGGGTGG + Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081396107 11:42588220-42588242 CTGAACAATAAGCCAGAAGGAGG - Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082974858 11:59061390-59061412 CTGAAAAATAAGGAGGGAAGTGG - Intergenic
1082979281 11:59105120-59105142 CTGAAAAATAAGGAGGGAAGTGG - Intergenic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1086264621 11:84983026-84983048 TTGAATAAAAAGGATGAGGGTGG - Intronic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1088202976 11:107360106-107360128 CAGAAGAATAAGGGGGTGGGAGG - Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089774900 11:120829230-120829252 CTTAACAAGGAGGTGGAGGGAGG - Intronic
1090415048 11:126534883-126534905 GGGAACAATAAAGGGGAGGGGGG + Intronic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1091504522 12:1053584-1053606 ATGAAAAATAAATAGGAGGGAGG - Intronic
1091840464 12:3616831-3616853 CTGGCCAATAGGGAGGAAGGGGG + Intronic
1091887556 12:4027622-4027644 TGGAACAATATGCAGGAGGGGGG + Intergenic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1092020591 12:5199409-5199431 CTGAACATTCAGGAGGCTGGGGG + Intergenic
1093513916 12:19962546-19962568 CTAAAAAAAAAGGATGAGGGGGG - Intergenic
1094353063 12:29547708-29547730 GTGAAGAATAAGGAGGAAAGTGG + Intronic
1095338972 12:41065552-41065574 CTGAAGAATTCTGAGGAGGGTGG + Intronic
1095464732 12:42478451-42478473 CTGACCATTAAGGAGGTGTGTGG + Intronic
1096233703 12:49911827-49911849 CTGAACAATGATGAGGATGGTGG - Intergenic
1096257053 12:50069588-50069610 CTAAAGAATAAAGAGGAGGCTGG - Intronic
1097682415 12:62661167-62661189 CTGAAGAATAAACAGGAGCGAGG - Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098377415 12:69831958-69831980 TTGAAGAATAAAGAGGAGGCTGG + Intronic
1098805416 12:75015957-75015979 GGGAAAAAAAAGGAGGAGGGGGG + Intergenic
1099051402 12:77785468-77785490 GTGAAGAAGTAGGAGGAGGGAGG + Intergenic
1101467202 12:104960294-104960316 TTGAAGAATAAGGAGGAGTTAGG + Intergenic
1102081673 12:110103298-110103320 CATAACTACAAGGAGGAGGGAGG + Intergenic
1102712968 12:114944303-114944325 CAGAACATTAGGGAGGAGGAAGG + Intergenic
1102765480 12:115429271-115429293 CAGAACAATATGGAGGATGGGGG - Intergenic
1102805535 12:115776643-115776665 AGGAAGGATAAGGAGGAGGGAGG - Intergenic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1104072301 12:125356436-125356458 CTGAACACCCAGGAGGAAGGTGG - Intronic
1104374538 12:128252174-128252196 CTCACCAACCAGGAGGAGGGTGG + Intergenic
1106308445 13:28533034-28533056 CTGAACAAAAACTAGGAGGTGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106932060 13:34677092-34677114 GTAATTAATAAGGAGGAGGGAGG - Intergenic
1109332893 13:60952311-60952333 TTTAAAAAAAAGGAGGAGGGTGG - Intergenic
1109339061 13:61030953-61030975 CTGATGAATAATTAGGAGGGTGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109952786 13:69522570-69522592 AAGAACAATAAGAAGGATGGAGG - Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1112127267 13:96481726-96481748 CTAAAAAAGAAGGAGCAGGGTGG + Intronic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1117354564 14:54911439-54911461 ATGAACAATAAGGTGTGGGGAGG + Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1119026351 14:71155901-71155923 CTGGACAATGAGGATGGGGGCGG + Intergenic
1119309410 14:73633893-73633915 CTGAAGAGGAGGGAGGAGGGGGG - Intergenic
1120039873 14:79740147-79740169 CTGAATATAAAGGGGGAGGGAGG - Intronic
1120444137 14:84572351-84572373 CTGAAAAATAAGGAGGAAAGAGG - Intergenic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1121402014 14:93688341-93688363 CTGAACAATTAGGTGAAGAGAGG + Intronic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1123419693 15:20121648-20121670 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1123446171 15:20331888-20331910 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1123528916 15:21128184-21128206 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1124861394 15:33445297-33445319 TTGAGGAATAAGGATGAGGGAGG + Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1127185315 15:56473425-56473447 CTGAATACTAGGGGGGAGGGGGG - Intergenic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128527721 15:68423793-68423815 ATCAACAAGAAGGAGGAGGCCGG - Intronic
1130358807 15:83160904-83160926 GTGAACAATAAGGAAAAGGTTGG - Intronic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1132227707 15:100155321-100155343 CTGTCCAAGAAGGAGGAGAGAGG + Intronic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1133658181 16:7887496-7887518 CTGCACTAAAAGGAAGAGGGAGG + Intergenic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1135065310 16:19304766-19304788 GTGAACAAAAAAGAGGAAGGAGG + Intronic
1136401528 16:30021780-30021802 CTGAGCACTAAGGAGGGGGCGGG + Intronic
1136532189 16:30877073-30877095 GTGAACAGCAAGGAGGAGAGTGG + Intronic
1138187049 16:54984891-54984913 CTGAAAAATAAGGATGAGATGGG - Intergenic
1139187316 16:64822202-64822224 CAGAACAATATGGTGGAGAGTGG - Intergenic
1139321367 16:66117156-66117178 CCCAGCAATAAGGAGGAGGTAGG + Intergenic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1140855016 16:78970388-78970410 CTCAACAATAAGGACGATGCTGG - Intronic
1141093747 16:81148272-81148294 CTGAACAATCAGGAGGTTGATGG + Intergenic
1141337517 16:83170986-83171008 CTCAAAAAAAAGGAGGCGGGCGG - Intronic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1143948203 17:10612782-10612804 CTGTAAAATAAAGAGGGGGGGGG - Intergenic
1144420708 17:15095485-15095507 TTGAACAATAAGGAGGGCTGAGG + Intergenic
1144556437 17:16286592-16286614 CTGAACATTAAGGTCTAGGGCGG + Intronic
1146139117 17:30349551-30349573 TAGAACAAAAAGGTGGAGGGAGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148972777 17:51498815-51498837 CTTAATAAGAAGGAAGAGGGAGG - Intergenic
1149585595 17:57784069-57784091 CTGTACAATAAAGAAAAGGGAGG + Intergenic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1151563706 17:74885123-74885145 CTGCACAGTGAGGAGGAGGTGGG - Intronic
1152196767 17:78923216-78923238 CTGAGCATGAAGGAGGCGGGAGG + Intronic
1155110255 18:22707773-22707795 CTGAACAGTAAGGTAGAGAGTGG + Intergenic
1156402174 18:36749333-36749355 CTGGACATGAAGGTGGAGGGTGG - Intronic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1158870469 18:61682360-61682382 ATGTACAATAATGAGGTGGGAGG - Intergenic
1159965193 18:74588064-74588086 TTGAAGAATAATGTGGAGGGTGG - Intergenic
1161836295 19:6649353-6649375 GTGAAGAGTGAGGAGGAGGGCGG - Intergenic
1163247053 19:16102845-16102867 CTGAATAAATAGGAGTAGGGTGG - Intronic
1165281524 19:34802327-34802349 CAGCACAATGAGGAGGAGTGGGG + Intergenic
1165281732 19:34803664-34803686 CTCAACAATAAGAAGCAGGTGGG + Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
1168316110 19:55485449-55485471 CTGAATAATACGGGGGAGGGGGG + Intronic
1202689214 1_KI270712v1_random:74962-74984 CTAAACCATAAGAGGGAGGGAGG + Intergenic
925065081 2:923151-923173 CCGAACAGAAAGGAGGAGGAAGG - Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927157776 2:20231470-20231492 TTGAATAATATGGAGGAGGTGGG + Intergenic
927277351 2:21273154-21273176 CTGTACAGTAAGGAGGACCGAGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
930589125 2:53306061-53306083 CTGAAAAATTGGGAGGAGGAAGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933957222 2:87381129-87381151 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934241340 2:90273021-90273043 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934271834 2:91543665-91543687 CTAAACCATAAGAGGGAGGGAGG + Intergenic
934704721 2:96469083-96469105 CTCATCAATGAGGAGGTGGGTGG - Intergenic
935469694 2:103443492-103443514 CTGAAGGATAGGAAGGAGGGTGG + Intergenic
936240360 2:110783020-110783042 CTTAATAATGAGGAGCAGGGAGG + Intronic
936395547 2:112125564-112125586 CTCAAAAAGAAGGAGAAGGGAGG + Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938231026 2:129659185-129659207 CTGAAGATTAATGAGGGGGGTGG + Intergenic
938584605 2:132677570-132677592 ATACACAGTAAGGAGGAGGGAGG + Intronic
939366506 2:141239769-141239791 CCTCACAATAAGGAGAAGGGAGG + Intronic
939568197 2:143809840-143809862 CTGAAAAATAAGCAGGGTGGGGG + Intergenic
939602564 2:144211215-144211237 CTGAACACTAAGCATGTGGGAGG + Intronic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
941505539 2:166339431-166339453 ATGAAAAAATAGGAGGAGGGAGG + Intronic
941555590 2:166976248-166976270 CATAACAATAAGGGGGAGAGAGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
943901246 2:193440306-193440328 CTGAACAGTATGGAAGAGTGTGG + Intergenic
944099313 2:196005333-196005355 CAAAACAAGAAGGAGAAGGGAGG + Intronic
944311423 2:198237865-198237887 CTGAACAAAAGGGAGCAGAGAGG - Intronic
946148571 2:217749013-217749035 CAGAACAAAAGGGAGGGGGGTGG - Intronic
946661928 2:222010230-222010252 CTGAACAATGATGAGGTGAGAGG + Intergenic
946899119 2:224355378-224355400 ATGAAGAATGAGGAGGATGGAGG - Intergenic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
948091817 2:235301827-235301849 ATGAAGAGAAAGGAGGAGGGAGG - Intergenic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1172159439 20:32856046-32856068 TTCAAAATTAAGGAGGAGGGAGG - Intergenic
1172326056 20:34035604-34035626 ATGAACAAAAAGGAGGAGTGGGG - Intronic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1172830989 20:37834230-37834252 CTCAACAAGATGGGGGAGGGAGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1175764333 20:61582325-61582347 TTGAACAATAAGGAGGAGAGCGG - Intronic
1175780018 20:61676406-61676428 CTGAAAAAGAAGGTGGATGGGGG + Intronic
1177008288 21:15700666-15700688 GTTAAGAATAAGGAGCAGGGAGG + Intergenic
1177923339 21:27182610-27182632 CAGAACAAAAAGGTGGAGGGAGG - Intergenic
1178982499 21:37276694-37276716 CTGAACAATATGGAGAAAGAAGG + Intergenic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180223363 21:46374225-46374247 CTAAACAATCAGGAGGAGAGGGG - Intronic
1180552206 22:16549652-16549674 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1181351823 22:22264407-22264429 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1181545214 22:23598617-23598639 CTGAACGGCTAGGAGGAGGGAGG - Intergenic
1181801311 22:25349323-25349345 CTGAACGGCTAGGAGGAGGGAGG + Intergenic
1181815096 22:25431264-25431286 CTGAACGGCTAGGAGGAGGGAGG + Intergenic
1181871746 22:25904802-25904824 ATAGACACTAAGGAGGAGGGTGG + Intronic
1181973864 22:26714404-26714426 CTGGACAATAGGGACGAGAGGGG - Intergenic
1182001336 22:26922189-26922211 CTGAGCACTAAGGAGGAGAGTGG + Intergenic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1182928957 22:34154677-34154699 TTGAACAATTAGGTGGATGGTGG + Intergenic
1183881480 22:40835068-40835090 CTGAAAAATTAGGAGAAGGCGGG - Intronic
1183913499 22:41097352-41097374 ATGGATAATAGGGAGGAGGGAGG + Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
949875596 3:8624259-8624281 GTGGACACTTAGGAGGAGGGTGG - Intronic
950847771 3:16031461-16031483 CTTAATAAAAAGGAGGAGGTAGG + Intergenic
951170495 3:19536292-19536314 CTGAACAATGAGGGGCAAGGGGG + Intergenic
953329770 3:42043291-42043313 CTGGACAAAAAGGAGGAGACGGG - Intronic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
955153898 3:56396797-56396819 CTGAAGCATGGGGAGGAGGGTGG + Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
956056952 3:65309841-65309863 CTGGACAGTGAGGAAGAGGGAGG - Intergenic
956659643 3:71584330-71584352 CTGGAAAATAAGGGGCAGGGGGG + Intergenic
956964845 3:74447177-74447199 TTGAACAGTAAGGAGAAGTGAGG + Intronic
957129547 3:76205666-76205688 CTGAAAAGCAAAGAGGAGGGAGG - Intronic
961573026 3:127813944-127813966 GGGAAAAATAAGGAGGAGGAAGG - Intronic
961748286 3:129080103-129080125 CTGAAGAACAAAGAGGAGGTTGG + Intergenic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
968189712 3:196659122-196659144 ATGCAGAATAAGGAGGCGGGAGG - Intronic
970195059 4:13544341-13544363 CTCAACAAGAAAGAGGAGCGCGG - Exonic
970642670 4:18084724-18084746 CTGAACAAGAATGTGGAGGTGGG + Intergenic
972796095 4:42421192-42421214 ATGAAGAAAAAGGTGGAGGGAGG + Intronic
972949224 4:44298409-44298431 CAGAAAAATAAAGAGGTGGGGGG - Intronic
973295723 4:48518606-48518628 GTGAACAAGAAGGAGAGGGGTGG - Intronic
973558463 4:52109871-52109893 CTATACAATAAGGAGTAGTGAGG + Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974985354 4:69017698-69017720 CTGAACAATAAGCAGGAATAGGG - Intronic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
975621801 4:76304237-76304259 CTGCACAGTAAGGAGGTGAGTGG + Intronic
975710815 4:77158080-77158102 CTGAACAAAGAAGCGGAGGGAGG - Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
978437531 4:108701636-108701658 CTAAAGAAAAAGGAGGAAGGGGG - Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
981326489 4:143454435-143454457 CTGAATAACAAAGAGGAGGTTGG + Intronic
982074273 4:151722820-151722842 CTGAGCTCAAAGGAGGAGGGAGG + Intronic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983683846 4:170384539-170384561 CTTAACCTTAAAGAGGAGGGAGG - Intergenic
983973662 4:173904863-173904885 CTGTAGAATAAGTAGGAGAGGGG - Intergenic
985239307 4:187913090-187913112 TTCAACAATAAGGAGAAAGGAGG + Intergenic
985323795 4:188744365-188744387 CAGAAAACTAAGGGGGAGGGTGG - Intergenic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990988684 5:61664029-61664051 CTGAATATTTAGGAGGACGGGGG - Intronic
991412410 5:66358087-66358109 CTGAACAGAAAGGCAGAGGGCGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
993031195 5:82707668-82707690 CTTCACAATAGGGAGGAAGGGGG + Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
995250780 5:109991051-109991073 CTGAACAAAAAAGAGGTGGAGGG + Intergenic
996922769 5:128788304-128788326 CTGAACAATGTGGAGGTTGGGGG + Intronic
997453329 5:134000666-134000688 CTGAAGAAAAAGGAGTAGAGAGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997892951 5:137691318-137691340 TTGGACAATAAAGAGGGGGGTGG + Intronic
997896293 5:137720587-137720609 GTGAACAGGAAGGAAGAGGGAGG + Intronic
997949546 5:138231246-138231268 CTGACCAATTAGGAGTAGAGGGG + Intergenic
998013244 5:138712125-138712147 CTGAAAAATAAAGAGCAGGCCGG + Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004418798 6:15449235-15449257 TTAAAAAATAAGGGGGAGGGTGG - Intronic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1008339958 6:50352823-50352845 CAGAACAAGAAGGAGGCGAGAGG + Intergenic
1009440147 6:63668336-63668358 CTCAAAAAAAAGGGGGAGGGAGG - Intronic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1010912116 6:81571223-81571245 ATGAAAAATAAGTGGGAGGGAGG - Intronic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1013156109 6:107491578-107491600 ATGGAAAATAAGGAGGTGGGGGG - Intronic
1015173311 6:130278754-130278776 CTGCACAATAAGGAGCTGAGAGG + Intronic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017668635 6:156747762-156747784 CTTTGCAATAAGGAGGAGGATGG + Intergenic
1018090725 6:160345535-160345557 CTCAGCTATAAGGAGGAGAGGGG + Intergenic
1018651574 6:165996493-165996515 CTGAACAAGAAGCAGGACTGGGG + Intergenic
1019292840 7:258736-258758 CTGCGCAGTAGGGAGGAGGGTGG - Intronic
1021273061 7:18616112-18616134 TTAAAAAATAAGGAAGAGGGAGG - Intronic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022966840 7:35482097-35482119 CTGAACAGAAAGAATGAGGGAGG - Intergenic
1023126374 7:36958463-36958485 CTGATGAAAAATGAGGAGGGAGG - Intronic
1024642441 7:51341299-51341321 ATGAACAAAAAGGCAGAGGGAGG + Intergenic
1024782889 7:52872731-52872753 CTGAACAAAAAGGAGAAAGATGG + Intergenic
1024816855 7:53281779-53281801 CTAAATCATAAGGAGGAGGGTGG - Intergenic
1025015636 7:55436892-55436914 TTGTACAGTAAGGAGGAGGGTGG - Intronic
1025016154 7:55440562-55440584 CTGAACAGTGAGGTGGTGGGAGG - Intronic
1027132236 7:75599248-75599270 CTGAAAAACAAGAAGGGGGGAGG + Intronic
1027520728 7:79203431-79203453 CTGAACACTAGAGAGGAAGGAGG - Intronic
1027802572 7:82774033-82774055 CTAAAGAATCATGAGGAGGGAGG - Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1029446898 7:100618443-100618465 CTAAAAAAAAAGGAGGCGGGGGG + Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1033148716 7:138894240-138894262 CTGAAAGATGAGGAAGAGGGAGG - Intronic
1035312184 7:157976390-157976412 CTGAACAATAAAGAGAACAGAGG - Intronic
1035755533 8:2028374-2028396 CTGAACCTCTAGGAGGAGGGTGG + Intergenic
1036164256 8:6417496-6417518 CTGAACAATAATGAAGAAGAAGG - Intronic
1037086487 8:14857124-14857146 ATGAACAAGAGAGAGGAGGGAGG - Intronic
1039999867 8:42566732-42566754 CTAGACTATAAGGAGGACGGAGG + Intergenic
1041111749 8:54489418-54489440 CTGAACAGGAAGAAGGAAGGAGG + Intergenic
1042411767 8:68474342-68474364 ATGAACAATAAGGAAGAAAGAGG - Intronic
1043575314 8:81649927-81649949 CTGAACACCATGGAGGATGGAGG - Intergenic
1044351945 8:91176738-91176760 TAGAACAAAAAGGTGGAGGGAGG - Intronic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047584054 8:126249777-126249799 CTAGACAATGAGGAGGATGGTGG + Intergenic
1047911979 8:129540254-129540276 TTGCTCAATAAGCAGGAGGGAGG - Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048672686 8:136740609-136740631 CTGAACAGGAGGGAGGAGTGCGG + Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1051192789 9:14532834-14532856 CTGGTCAAAAATGAGGAGGGAGG + Intergenic
1051354799 9:16231884-16231906 ATCTACAATAAGGAGGATGGTGG + Intronic
1052325884 9:27216408-27216430 CTTAACAATTAGGAGGTGTGAGG + Intronic
1052579324 9:30333684-30333706 TTTAACAATAACGATGAGGGAGG - Intergenic
1054880212 9:70136634-70136656 ATGAAAAAAAAGGAGGAAGGGGG + Intronic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1059243822 9:112832356-112832378 CTGAACAAAAAAGAAAAGGGAGG + Intronic
1060260728 9:122071523-122071545 CTCAGCAGAAAGGAGGAGGGTGG + Intronic
1060320815 9:122559198-122559220 CTGAAGATTTAGGAGGAGTGGGG - Intergenic
1061486543 9:130923317-130923339 CAGAAGAAAAAGGAGGAGTGTGG - Intronic
1185514290 X:687576-687598 ATGAACAATAAGTAAAAGGGTGG + Intergenic
1188006366 X:25018130-25018152 CTGCACAAGGGGGAGGAGGGGGG - Intergenic
1190384650 X:49873089-49873111 GTGACCAAGAAGGAGGAGAGTGG - Intergenic
1190545322 X:51519638-51519660 CTAAACAATGAGCAGGATGGTGG - Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1191877417 X:65810365-65810387 CTGCCCAATAAGGAGAAGTGAGG - Intergenic
1193414410 X:81204042-81204064 CTGAAGACTACAGAGGAGGGAGG - Intronic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1195422780 X:104694231-104694253 CTCCCAAATAAGGAGGAGGGTGG - Intronic
1196663515 X:118293413-118293435 TTTAACAATAAAGAGAAGGGGGG - Intergenic
1196872710 X:120127849-120127871 TTGAATAACAAGGACGAGGGTGG + Intergenic
1197226480 X:123960798-123960820 CTGAGAAAGAAGGAGGAGTGGGG + Exonic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199861772 X:151807420-151807442 CTGAGCAAGAAAGAGGATGGTGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201589040 Y:15593496-15593518 CTGAACAAGAAGGAGAAGAGAGG - Intergenic