ID: 1071522805

View in Genome Browser
Species Human (GRCh38)
Location 10:86341423-86341445
Sequence TTTCCAGAAGGGCCCGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071522798_1071522805 -9 Left 1071522798 10:86341409-86341431 CCCTCCCTCACACGTTTCCAGAA 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522791_1071522805 24 Left 1071522791 10:86341376-86341398 CCCTGGTGGGACCCTGGGTACTT 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522797_1071522805 -8 Left 1071522797 10:86341408-86341430 CCCCTCCCTCACACGTTTCCAGA 0: 1
1: 0
2: 0
3: 14
4: 208
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522796_1071522805 12 Left 1071522796 10:86341388-86341410 CCTGGGTACTTACGCGGGTGCCC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522792_1071522805 23 Left 1071522792 10:86341377-86341399 CCTGGTGGGACCCTGGGTACTTA 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522795_1071522805 13 Left 1071522795 10:86341387-86341409 CCCTGGGTACTTACGCGGGTGCC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data
1071522799_1071522805 -10 Left 1071522799 10:86341410-86341432 CCTCCCTCACACGTTTCCAGAAG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071522805 Original CRISPR TTTCCAGAAGGGCCCGCTTA GGG Intronic
No off target data available for this crispr