ID: 1071522812

View in Genome Browser
Species Human (GRCh38)
Location 10:86341456-86341478
Sequence AAAGCCACCTTTAAGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071522812_1071522815 -6 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522815 10:86341473-86341495 GGCTTTTCAGCAGCCAGTGAGGG No data
1071522812_1071522823 28 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522823 10:86341507-86341529 CCCCACAGGGCTCCCGGCCACGG No data
1071522812_1071522818 15 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522818 10:86341494-86341516 GGTGAGCATCCTCCCCCACAGGG No data
1071522812_1071522817 14 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG No data
1071522812_1071522814 -7 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522814 10:86341472-86341494 TGGCTTTTCAGCAGCCAGTGAGG No data
1071522812_1071522819 22 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522819 10:86341501-86341523 ATCCTCCCCCACAGGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071522812 Original CRISPR AAAGCCACCTTTAAGGTCCT TGG (reversed) Intronic
No off target data available for this crispr