ID: 1071522813

View in Genome Browser
Species Human (GRCh38)
Location 10:86341463-86341485
Sequence CTGCTGAAAAGCCACCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071522813_1071522823 21 Left 1071522813 10:86341463-86341485 CCTTAAAGGTGGCTTTTCAGCAG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1071522823 10:86341507-86341529 CCCCACAGGGCTCCCGGCCACGG No data
1071522813_1071522818 8 Left 1071522813 10:86341463-86341485 CCTTAAAGGTGGCTTTTCAGCAG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1071522818 10:86341494-86341516 GGTGAGCATCCTCCCCCACAGGG No data
1071522813_1071522817 7 Left 1071522813 10:86341463-86341485 CCTTAAAGGTGGCTTTTCAGCAG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG No data
1071522813_1071522819 15 Left 1071522813 10:86341463-86341485 CCTTAAAGGTGGCTTTTCAGCAG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1071522819 10:86341501-86341523 ATCCTCCCCCACAGGGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071522813 Original CRISPR CTGCTGAAAAGCCACCTTTA AGG (reversed) Intronic
900586726 1:3436259-3436281 CTGCTGAAAAGACACGCTGAGGG - Exonic
901637335 1:10676415-10676437 CTGTTGAAAGGTCACCTTTTGGG - Intronic
902408702 1:16200440-16200462 CTGCTCAAAAGCCTCCATTAAGG + Intronic
905567540 1:38977776-38977798 CTGCGGACATGCCACCTTTAAGG - Intergenic
907254060 1:53164850-53164872 TTGCTGAAAAGACACCTTAATGG + Intergenic
907286965 1:53386913-53386935 CTGCAGAAAAGCCACCAGAAAGG + Intergenic
908351800 1:63293281-63293303 TTGCTCAAATGTCACCTTTAAGG + Intergenic
908835762 1:68228484-68228506 CTCCTGAAAAGGCAGCTTTGGGG - Intronic
909914828 1:81303818-81303840 TTCCTGAAATGCCACCATTAGGG - Intergenic
910431441 1:87163366-87163388 CTGCTGAAAAGACATCCTTAAGG + Intronic
912778029 1:112518665-112518687 ATACTGAAAATACACCTTTAGGG + Intronic
914984838 1:152447643-152447665 CTGCTCAAACGCCTCCTTTTGGG - Intergenic
916747700 1:167697322-167697344 CTGCTGAAAAGCCTCCTCTGAGG + Exonic
919443197 1:197666016-197666038 TTGCACAAAAGGCACCTTTAAGG + Intronic
920496291 1:206457149-206457171 CTGCTGAGAAGACAGATTTATGG - Intronic
920749784 1:208662863-208662885 CATCTGAAATGCCACCTTTGTGG + Intergenic
920931541 1:210393563-210393585 CAGCTCAAAAGCCACCTTCTCGG - Intronic
921285466 1:213605413-213605435 CTGCTGAAAATTCAGCTTTGTGG + Intergenic
921960017 1:221024682-221024704 TTGCTCAAATGCCACCTTTTTGG + Intergenic
923586884 1:235281080-235281102 CTGGTGAGAAGCCACCTTGATGG - Intronic
1064288450 10:14012656-14012678 ATGCTGAAAAGCCACGTGAAGGG + Intronic
1068200503 10:53778056-53778078 CTGCTGAAAACGCACATTTTTGG - Intergenic
1069955020 10:72044675-72044697 CTGCTGAAGGGCCGCCTTTGTGG + Intergenic
1070536511 10:77382126-77382148 CTGATGAAAAGCTTCCTTTGGGG + Intronic
1071522813 10:86341463-86341485 CTGCTGAAAAGCCACCTTTAAGG - Intronic
1072302683 10:94076783-94076805 CTGCTGGACACCCACCTTGAGGG + Intronic
1073319592 10:102606719-102606741 CTCCTGAACTGCCACCTTCAGGG - Intronic
1074941235 10:118237460-118237482 CTACTGAAATTCCACCTTTAGGG - Intergenic
1076154966 10:128197127-128197149 CTGCTGTAGAGCCACCATTTCGG - Intergenic
1080182371 11:29440823-29440845 GGGCTGAAAAGCCACCTATTGGG - Intergenic
1080277914 11:30523851-30523873 CTGCTCAAATGCCACCTCTTTGG - Intronic
1080874813 11:36265884-36265906 CTTCTGAAATGCCACCATTAGGG - Intergenic
1080975883 11:37339879-37339901 CAGCTGAAATGGCAGCTTTATGG + Intergenic
1082633392 11:55566942-55566964 TTTCTGAAAAACCACCTCTATGG - Intergenic
1088114635 11:106300795-106300817 CTGCTGAGAAGCCTACTTTTTGG + Intergenic
1088765626 11:112973344-112973366 CTGCTTAAAGTACACCTTTATGG - Intronic
1089667837 11:120031661-120031683 CGGGTCAAAAGCCACCATTATGG - Intergenic
1089755705 11:120684995-120685017 CAGCTTAAAAAGCACCTTTATGG - Intronic
1091779334 12:3204140-3204162 CTTCAGAAAAGCCTCCTTTTTGG - Intronic
1091970915 12:4786283-4786305 ATGCTGCAAAGTCACCTTGAAGG - Intronic
1095801670 12:46275480-46275502 CTGTTGAAAAGGTACCTTTTGGG + Intergenic
1099692502 12:85976440-85976462 CTGCTGAAAAGGCTCCCCTAAGG + Exonic
1099998012 12:89800355-89800377 CTGCTTTAAAGCCACATTTTCGG - Intergenic
1100398862 12:94210073-94210095 CTGCAATTAAGCCACCTTTAAGG - Intronic
1101209839 12:102524869-102524891 ATGCTGAAAACTCACCTTGAGGG + Intergenic
1101422349 12:104559979-104560001 CTGCTCAAAAGCCACCCTTCAGG - Intronic
1107631475 13:42347603-42347625 GGGCTGAAAAGCTACCTTTGGGG - Intergenic
1108735857 13:53282599-53282621 CTGTTGAAAACCTACTTTTAAGG - Intergenic
1109344240 13:61095690-61095712 ATGCTGAAAAGCCATATTTTGGG - Intergenic
1109785498 13:67169239-67169261 TTGTTGAAAATCCACCTTTTAGG + Intronic
1111058350 13:82979748-82979770 CCACTGAAAAGCCACCTTTGTGG - Intergenic
1111957081 13:94771078-94771100 CTGAAGAAAAGCCACCCTGATGG + Intergenic
1113210213 13:107969779-107969801 CTGCTGATTAGCCACCCTTTAGG - Intergenic
1115027291 14:28760000-28760022 AGGCTGAAAAGGCAACTTTAAGG + Intergenic
1115946344 14:38665604-38665626 CTGTTGAAAAGCCACCTCAGGGG - Intergenic
1116082202 14:40188372-40188394 ATGTTGAAAAGCAACATTTATGG + Intergenic
1116803611 14:49468824-49468846 CTACAGAAAAGCCCACTTTATGG + Intergenic
1122312477 14:100805882-100805904 CTGCTGAAAAGGCAACTTTCGGG - Intergenic
1123467520 15:20527935-20527957 AAGCAGAAAAGCCACCTCTAGGG - Intergenic
1123650594 15:22473107-22473129 AAGCAGAAAAGCCACCTCTAGGG + Intergenic
1123741002 15:23281949-23281971 AAGCAGAAAAGCCACCTCTAGGG + Intergenic
1123745996 15:23320609-23320631 AAGCAGAAAAGCCACCTCTAGGG - Intergenic
1124278267 15:28343926-28343948 AAGCAGAAAAGCCACCTCTAGGG - Intergenic
1124304435 15:28567682-28567704 AAGCAGAAAAGCCACCTCTAGGG + Intergenic
1124533311 15:30524149-30524171 AAGCAGAAAAGCCACCTCTAGGG + Intergenic
1124765346 15:32483496-32483518 AAGCAGAAAAGCCACCTCTAGGG - Intergenic
1127002012 15:54520034-54520056 CTGGTGGAAAGCCAGCTTGAAGG + Intronic
1128247026 15:66140083-66140105 CTCCTGAAAAGCAGCTTTTAGGG + Intronic
1131565201 15:93479218-93479240 ATACAGAAAAGCCACCTGTATGG - Intergenic
1132804805 16:1770517-1770539 CTGCTGAACATCCACCTGTCTGG - Exonic
1135202636 16:20451849-20451871 CAGAGGAAAAGGCACCTTTATGG + Intronic
1135517086 16:23145158-23145180 CTGCTCAGGAGCCACCTTTTTGG + Intronic
1137323091 16:47406540-47406562 CTGTTGAATAGCCACATTTTGGG - Intronic
1137711483 16:50569875-50569897 CTCCTGAAAATCCACCTATGCGG - Intronic
1138008220 16:53356642-53356664 AAGCAGAAAAGCCACCTCTAGGG - Intergenic
1138241404 16:55430221-55430243 TTGATGTAAAGCCACCATTAAGG + Intronic
1138696162 16:58815447-58815469 CAGCTGAAATGTCACCTTTCAGG + Intergenic
1139354191 16:66357511-66357533 CTTCTGAAAGGACACCTTTTGGG + Intergenic
1141687522 16:85578795-85578817 CTGCTCAGATGCCACCTTTGAGG + Intergenic
1145771413 17:27495954-27495976 CTGCGCATAAGCCTCCTTTAGGG + Intronic
1148019130 17:44542040-44542062 CGGCTGAAAAGGCAGCTTAAGGG - Intergenic
1148103551 17:45107337-45107359 CTGATGAAAATCCACCTTAGTGG - Exonic
1149316769 17:55445736-55445758 TTGCTGAAACTCCACCTTTTAGG - Intergenic
1149414055 17:56439760-56439782 CTACTGAAAAGCCTCTCTTAAGG - Intronic
1151375838 17:73688434-73688456 CTGCTGAACAGACACATCTAAGG + Intergenic
1151563424 17:74883236-74883258 CTGCAGAAGAGTCACCTCTAGGG - Intronic
1152944322 17:83190845-83190867 CTGCTGTAAAGAACCCTTTATGG - Intergenic
1155533281 18:26789584-26789606 CTGCTGAAAATACACCTTAAAGG + Intergenic
1155564453 18:27118555-27118577 TGGCTGAAAAGCCAGATTTAAGG + Intronic
1157887723 18:51384642-51384664 CTTCTGAAATGCCACCAGTAGGG - Intergenic
1158505035 18:58040185-58040207 CTGCTGAATAGTTCCCTTTAAGG + Intergenic
1162306334 19:9876476-9876498 CTCCTGAAAACCCACCTCCAAGG + Intronic
925951696 2:8919678-8919700 CTATTCAAAAGACACCTTTAAGG - Intronic
926328750 2:11807789-11807811 CTTCTGAAAACCCATCTTCAGGG + Intronic
928310871 2:30208676-30208698 CTGCTGCAAAGGCTCCTTTCAGG + Intergenic
928761159 2:34584868-34584890 TTGCTCAAAATCTACCTTTAGGG + Intergenic
933155604 2:78969732-78969754 CTGTTGAAAATCCTCCTTTAGGG + Intergenic
935568076 2:104630426-104630448 CTGCGGAAAAACCACCATAATGG - Intergenic
939233438 2:139460983-139461005 ATGCTGAGAAGCAACCCTTAGGG + Intergenic
946761814 2:223002070-223002092 CTGATAAAAAGCCATCTTGAGGG - Intergenic
947412881 2:229860519-229860541 CTGCTGACAGGTCACATTTAGGG - Exonic
947908834 2:233788638-233788660 CGGCTGACAAGCCACTCTTAAGG - Intronic
948319544 2:237058503-237058525 CTGCAGAACAGCCACCTGCAGGG - Intergenic
1172460979 20:35118530-35118552 CTGCTAAAAAGCCTCTTTAAGGG - Intronic
1178728143 21:35073523-35073545 CTTTTGAAAGGCCACCTTTTTGG + Intronic
1184462997 22:44650205-44650227 CTGCTGAAAAACCAAATCTAAGG + Intergenic
1185371357 22:50462411-50462433 CTGCTCAGAAGCCACGTCTAGGG + Exonic
950276183 3:11663250-11663272 CTGCTAAAAAGGAACCTCTAGGG - Intronic
951805452 3:26638935-26638957 CTGCTACAAAGCAACCTTCAGGG - Intronic
952091482 3:29892080-29892102 CTGCAGAAAAGTCATCTTCAGGG - Intronic
956603355 3:71047057-71047079 CTGCTGAAAAGCCAACTGCTGGG + Exonic
957212357 3:77276292-77276314 TTGTTGAAAAGACTCCTTTAAGG - Intronic
958984633 3:100766287-100766309 CTGCTGCAAAGCCCCATTTGGGG + Intronic
961974879 3:131012975-131012997 CAGCTTTAAAGCTACCTTTAGGG + Intronic
963009281 3:140754226-140754248 CTGAGGACAAGCCACCTATAGGG + Intergenic
966667195 3:182484839-182484861 CTGCTGAAACCCCATCTTTAGGG + Intergenic
968865411 4:3207459-3207481 CTGCAGTAAACCCACCTATAAGG - Intronic
969460606 4:7326890-7326912 CTGCTGAACAGCCCCATTGATGG + Intronic
970586715 4:17521415-17521437 CTGCTGAATACCCACCCTGATGG - Intronic
970837115 4:20422716-20422738 CAGATGTAAAGTCACCTTTATGG - Intronic
976047136 4:80964216-80964238 CTGCACAAAAGCCACCTGCAGGG - Intergenic
982952934 4:161723120-161723142 CTGCTGAAATGCTACTTGTAAGG + Intronic
984645954 4:182220074-182220096 CTTGTGAAAAGTCAGCTTTATGG + Intronic
985916131 5:2920315-2920337 CTGGTGAAACCCCACCTTTAAGG + Intergenic
986065259 5:4228943-4228965 CTGGTGAAAAGCCACTTATGAGG + Intergenic
986962712 5:13234921-13234943 CTGCTGGGAAGCCACCCTCAGGG + Intergenic
986999482 5:13645296-13645318 TTGCTGAAAAACCACCTTACAGG - Intergenic
987314046 5:16707712-16707734 CTGCTGAACAGCTGCGTTTACGG - Intronic
988391095 5:30632593-30632615 CAGTTGAAAAGCCACTTTTATGG + Intergenic
992192502 5:74307396-74307418 TTGCTGAAAAGGCTCCTTAATGG + Intergenic
993777513 5:92018591-92018613 CTGCTAAAAAGCCTCCCTTTTGG + Intergenic
994894087 5:105678964-105678986 CTGCTACAAAGCCACGTTTCAGG - Intergenic
997006870 5:129827446-129827468 CGGCTGAAAAGCTACCTGTTGGG + Intergenic
998389953 5:141780860-141780882 CTGCTGACAGGCCAACTTTATGG + Intergenic
1000352532 5:160363146-160363168 TTGCTGAAAATCCACTTTGATGG + Intronic
1001520710 5:172390251-172390273 CTGCAGAAAAGGCAAATTTATGG - Intronic
1002863440 6:1100364-1100386 GTGCTGAAGTGCCATCTTTAGGG - Intergenic
1004268200 6:14168219-14168241 CTCCAGAAAAGCCTCCTTTATGG + Intergenic
1005935655 6:30518966-30518988 CTCCAGATATGCCACCTTTAAGG + Intergenic
1011369047 6:86612675-86612697 CAGCTGACCATCCACCTTTACGG - Intergenic
1015462354 6:133505941-133505963 CTTCTGGAAAGTCACCTTTTTGG + Intronic
1016563812 6:145428899-145428921 GTGCTGAAAAGCTATCCTTAGGG + Intergenic
1018147856 6:160909957-160909979 TTGCTGAAAGGCCACATGTAAGG - Intergenic
1018214733 6:161516027-161516049 CTTCTTAAAAGCCAGCTTGATGG - Intronic
1019200191 6:170307482-170307504 CTGCTCAAATCCAACCTTTATGG - Intronic
1021183315 7:17533651-17533673 CTTCTTAAAAGGCACCTCTAGGG + Intergenic
1021838048 7:24700029-24700051 CAGCTGAAATGCCACATTGAGGG + Intronic
1023206022 7:37750519-37750541 TTGCTGAAAAGCCACTCATAGGG + Intronic
1024333724 7:48182043-48182065 CTGCTGTATGGCCACCTCTATGG + Intronic
1026091580 7:67304757-67304779 CTCTTGAAAACCCACCTTTGGGG - Intergenic
1028035150 7:85972539-85972561 CTGGTGAAACCCCACCTTCAAGG - Intergenic
1030006788 7:105128046-105128068 GTGCTGGAAAGGCACCTTTAAGG + Intronic
1031350536 7:120725141-120725163 CTGCTGAAATCCCACATTGAGGG + Intronic
1031541715 7:123003180-123003202 CTGCTTTAGAGCCACCTTTGTGG + Intergenic
1035920135 8:3667745-3667767 GTTCTGAAAAGCAACCTTCAGGG + Intronic
1036000130 8:4593218-4593240 CTGCTGAAAAGCAAGGTTAATGG + Intronic
1037595176 8:20348888-20348910 GTGCAGAAAAACCAACTTTAGGG - Intergenic
1041201188 8:55452990-55453012 CTGCTCAGAAGCCACTTCTAGGG + Intronic
1041481132 8:58320902-58320924 ATGTAGCAAAGCCACCTTTATGG - Intergenic
1042648838 8:71017112-71017134 CTACTGAAAAGCCATGTATAAGG - Intergenic
1046033163 8:108807512-108807534 AAGTTGAAAAGCCACCTTTCTGG + Intergenic
1048142217 8:131805417-131805439 CTTCTGAAAAGCCTTCCTTATGG + Intergenic
1054815483 9:69470731-69470753 CTCCAGAAAAGCCTCCTTCAAGG + Intronic
1056487157 9:87071030-87071052 TTGCTCACAAGCCACATTTATGG - Intergenic
1060496857 9:124125590-124125612 CTCCTGAAGAGCCAGCTTGAGGG - Intergenic
1186195767 X:7109147-7109169 GTGGTGAAAAGCCTCCTCTAAGG + Intronic
1187591812 X:20725031-20725053 GTGCTGAAAACCTACCTTTTGGG + Intergenic
1188261263 X:28027039-28027061 CTGCTCAAAAGTCACCTTAGCGG - Intergenic
1189085251 X:38016326-38016348 ATGGGGGAAAGCCACCTTTAAGG + Intronic
1189526190 X:41824575-41824597 CTGCTGTAAAGGCACCTGAAGGG - Intronic
1189782003 X:44524001-44524023 CTGCTGTAAAACAACCTATATGG - Exonic
1191663566 X:63674957-63674979 CTTCTGAGAAATCACCTTTAAGG + Intronic
1192164487 X:68818813-68818835 GGGCTGAAAAGCTACCTGTAGGG + Intergenic
1192698499 X:73443779-73443801 CTGCAGAGAAGCCACCTCTCTGG + Intergenic
1192775599 X:74241163-74241185 CTGCCTAAAAGCTACCTTTAAGG + Intergenic
1192888378 X:75362076-75362098 CTGCTGACTGGCCACTTTTATGG - Intergenic
1196061133 X:111409494-111409516 CTTCTAAAAAGCCTACTTTAGGG - Intronic
1201469258 Y:14315743-14315765 CTCCAGACATGCCACCTTTAAGG + Intergenic