ID: 1071522817

View in Genome Browser
Species Human (GRCh38)
Location 10:86341493-86341515
Sequence GGGTGAGCATCCTCCCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071522813_1071522817 7 Left 1071522813 10:86341463-86341485 CCTTAAAGGTGGCTTTTCAGCAG 0: 1
1: 0
2: 0
3: 20
4: 157
Right 1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG No data
1071522812_1071522817 14 Left 1071522812 10:86341456-86341478 CCAAGGACCTTAAAGGTGGCTTT No data
Right 1071522817 10:86341493-86341515 GGGTGAGCATCCTCCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071522817 Original CRISPR GGGTGAGCATCCTCCCCCAC AGG Intronic
No off target data available for this crispr