ID: 1071523719

View in Genome Browser
Species Human (GRCh38)
Location 10:86346404-86346426
Sequence GCCTGTGTTTGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071523713_1071523719 -7 Left 1071523713 10:86346388-86346410 CCTTATCTCTGCCCAGGCCTGTG 0: 1
1: 0
2: 3
3: 51
4: 400
Right 1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG No data
1071523711_1071523719 -1 Left 1071523711 10:86346382-86346404 CCATAGCCTTATCTCTGCCCAGG 0: 1
1: 0
2: 0
3: 30
4: 207
Right 1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071523719 Original CRISPR GCCTGTGTTTGGAGGGCAGC TGG Intronic
No off target data available for this crispr