ID: 1071524548

View in Genome Browser
Species Human (GRCh38)
Location 10:86350597-86350619
Sequence GATGATGCCCAGACAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071524545_1071524548 -8 Left 1071524545 10:86350582-86350604 CCAGGATTGTCCTGAGATGATGC 0: 1
1: 0
2: 1
3: 14
4: 118
Right 1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG No data
1071524544_1071524548 -7 Left 1071524544 10:86350581-86350603 CCCAGGATTGTCCTGAGATGATG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG No data
1071524542_1071524548 3 Left 1071524542 10:86350571-86350593 CCCTGTACTGCCCAGGATTGTCC 0: 1
1: 1
2: 2
3: 23
4: 363
Right 1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG No data
1071524543_1071524548 2 Left 1071524543 10:86350572-86350594 CCTGTACTGCCCAGGATTGTCCT 0: 1
1: 0
2: 2
3: 21
4: 274
Right 1071524548 10:86350597-86350619 GATGATGCCCAGACAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071524548 Original CRISPR GATGATGCCCAGACAGCTCT GGG Intronic
No off target data available for this crispr