ID: 1071525553

View in Genome Browser
Species Human (GRCh38)
Location 10:86355968-86355990
Sequence CCAGCTACGGGGACAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071525542_1071525553 18 Left 1071525542 10:86355927-86355949 CCACAGGGCTGAAGCCGTGGAAA 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1071525553 10:86355968-86355990 CCAGCTACGGGGACAGGGGGAGG No data
1071525543_1071525553 4 Left 1071525543 10:86355941-86355963 CCGTGGAAAGTGCAGACTTGCCA 0: 1
1: 1
2: 0
3: 30
4: 219
Right 1071525553 10:86355968-86355990 CCAGCTACGGGGACAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071525553 Original CRISPR CCAGCTACGGGGACAGGGGG AGG Intronic
No off target data available for this crispr