ID: 1071525553 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:86355968-86355990 |
| Sequence | CCAGCTACGGGGACAGGGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071525542_1071525553 | 18 | Left | 1071525542 | 10:86355927-86355949 | CCACAGGGCTGAAGCCGTGGAAA | 0: 1 1: 0 2: 0 3: 11 4: 128 |
||
| Right | 1071525553 | 10:86355968-86355990 | CCAGCTACGGGGACAGGGGGAGG | No data | ||||
| 1071525543_1071525553 | 4 | Left | 1071525543 | 10:86355941-86355963 | CCGTGGAAAGTGCAGACTTGCCA | 0: 1 1: 1 2: 0 3: 30 4: 219 |
||
| Right | 1071525553 | 10:86355968-86355990 | CCAGCTACGGGGACAGGGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071525553 | Original CRISPR | CCAGCTACGGGGACAGGGGG AGG | Intronic | ||
| No off target data available for this crispr | |||||