ID: 1071526772

View in Genome Browser
Species Human (GRCh38)
Location 10:86363818-86363840
Sequence CGCGGCTGCCGAGGAACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071526761_1071526772 23 Left 1071526761 10:86363772-86363794 CCGCTGCCTAGGTGGGCCGGGGA 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526767_1071526772 -7 Left 1071526767 10:86363802-86363824 CCACCGCGCATGGCACCGCGGCT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526755_1071526772 30 Left 1071526755 10:86363765-86363787 CCCGGCGCCGCTGCCTAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526768_1071526772 -10 Left 1071526768 10:86363805-86363827 CCGCGCATGGCACCGCGGCTGCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526757_1071526772 29 Left 1071526757 10:86363766-86363788 CCGGCGCCGCTGCCTAGGTGGGC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526763_1071526772 17 Left 1071526763 10:86363778-86363800 CCTAGGTGGGCCGGGGAAGGCGC 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78
1071526764_1071526772 7 Left 1071526764 10:86363788-86363810 CCGGGGAAGGCGCGCCACCGCGC 0: 1
1: 0
2: 2
3: 8
4: 77
Right 1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071526772 Original CRISPR CGCGGCTGCCGAGGAACAGA GGG Intronic
900210981 1:1455773-1455795 CTGGGCTGCCGAGGAAGACAGGG - Exonic
900792534 1:4689839-4689861 CGCGGATGCCCAGCAGCAGAGGG + Intronic
904567250 1:31435208-31435230 CGCGGCTGCCGTGGTACGGAGGG - Intergenic
906701139 1:47859074-47859096 CTCAGCTGGCAAGGAACAGAGGG + Intronic
910688139 1:89939376-89939398 CGCAGCTGGCCAGGATCAGAGGG - Intergenic
917345138 1:174021969-174021991 CGCTGCCGCGGAGGAGCAGAGGG + Intronic
918305152 1:183239491-183239513 CGCTGCTGCTGATGCACAGAGGG + Exonic
920788302 1:209063905-209063927 AGCGGCTGCAGAGGAGCAGGCGG - Intergenic
921089530 1:211830322-211830344 CGCGGCTGCCTGCGGACAGAGGG + Intronic
922756290 1:228098762-228098784 CACGGCGACCGAGGGACAGATGG - Exonic
1064254137 10:13729655-13729677 CGCGGCTGCTTAGGGACAGGGGG + Intronic
1064917175 10:20472200-20472222 CTCGGCTGACTAGGAACAGAGGG + Intergenic
1069874493 10:71553329-71553351 CGGGGCTGCAGAGGAGCTGAGGG - Intronic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1072336493 10:94402835-94402857 CGCGGCGGCCGGGGAGCAGCTGG + Exonic
1075062774 10:119268374-119268396 CGGGGCTGCCCAGGGGCAGAAGG - Intronic
1078986696 11:16605154-16605176 CCCGGCTGCAGAGGAACGGCGGG + Intronic
1084683313 11:70679606-70679628 GGGTCCTGCCGAGGAACAGAGGG + Intronic
1092894532 12:13000005-13000027 CAGGGCTGCCGAGGACCTGAAGG - Intronic
1098297152 12:69015477-69015499 AGCTCCAGCCGAGGAACAGATGG + Intergenic
1100985656 12:100199830-100199852 CGCGGGGGCCGGGGAACAAACGG - Intronic
1101995420 12:109522053-109522075 CACGGCTGACTAGGAACAGCTGG - Intronic
1105745725 13:23375525-23375547 CGCGGCGGCCGAGGAGCAGGCGG + Intronic
1106906243 13:34412626-34412648 TGGGGCTACCAAGGAACAGAGGG + Intergenic
1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG + Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1124440893 15:29685613-29685635 CTCAGCTGTAGAGGAACAGAAGG + Intergenic
1125891217 15:43268614-43268636 CGAGGCAGCCGTGGGACAGAAGG - Intergenic
1131152996 15:90058573-90058595 AGTGACTGCAGAGGAACAGAGGG - Intronic
1131782946 15:95879871-95879893 TACTGCTGCTGAGGAACAGAGGG + Intergenic
1132780460 16:1621581-1621603 TGGGGCTGCCGAGGGGCAGAGGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136088524 16:27902508-27902530 CGCGGGTGCCGATGATGAGACGG + Intronic
1138660118 16:58511820-58511842 CCCGGCGGCCCAGGCACAGAAGG + Exonic
1139853907 16:69965834-69965856 GGCGGGAGCCGAGGAAGAGAAGG - Intergenic
1139882885 16:70188747-70188769 GGCGGGAGCCGAGGAAGAGAAGG - Intergenic
1139965421 16:70742494-70742516 CTCGTTTGCCGAGGGACAGAGGG + Intronic
1140369624 16:74406772-74406794 GGCGGGAGCCGAGGAAGAGAAGG + Intergenic
1142852677 17:2711735-2711757 CGCGGCTGCTGAGGGAAGGACGG + Intronic
1143030721 17:3965461-3965483 CCTGGCTGCAGAGGCACAGAAGG - Intergenic
1144171815 17:12665703-12665725 CGCAGCCGCCGAGGCACAGAGGG - Intergenic
1144935106 17:18891746-18891768 TGTGGCTGCCGAGGGACAGAAGG - Intronic
1147155346 17:38542007-38542029 AGAGGATGCTGAGGAACAGAGGG + Intronic
1148161091 17:45450575-45450597 CCCAGCTGCTGAGGGACAGAGGG - Intronic
1150392325 17:64797221-64797243 CCCAGCTGCTGAGGGACAGAGGG - Intergenic
1155300801 18:24426975-24426997 CGCGGCCGCCGAGGAGCCGCCGG - Intronic
1160052977 18:75454704-75454726 CTCGCCTGCCCAGGAACAGGGGG + Intergenic
1160920235 19:1516166-1516188 TGCTGGTGCCCAGGAACAGACGG - Intergenic
1161114508 19:2489168-2489190 CGCGCCTGGCGGGCAACAGAGGG - Intergenic
1162760809 19:12887171-12887193 CGAGGCAGCCGAGGAAGAGGAGG - Exonic
1166046065 19:40231934-40231956 CCCGGCTGCCGAGCCTCAGAGGG - Exonic
925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG + Intergenic
926197606 2:10773167-10773189 GGCAGCTGCAGAGGAGCAGAGGG + Intronic
929604261 2:43224871-43224893 CGCGGAGGCCGAGGAACAGGAGG + Exonic
932036436 2:68251871-68251893 GGCGGCGGCCGAGCAGCAGAGGG + Intronic
935697741 2:105784746-105784768 AGTGGCTGCTGAGGAACGGATGG - Intronic
937226846 2:120375167-120375189 TGTGGCTGCCGAGGAGCTGAGGG + Intergenic
1169065342 20:2692022-2692044 CGCGGCTGGGGAGAAACAGGAGG + Intergenic
1172966076 20:38836182-38836204 CGTGGCCGCCAAGGCACAGAGGG - Intronic
1173825555 20:46045617-46045639 AGCAGCTGCAGAGGACCAGATGG - Intronic
1181368956 22:22401273-22401295 AGGGGATGCCCAGGAACAGAGGG - Intergenic
1183457475 22:37930499-37930521 CGCAGCTGCCGAGGGAAAGCTGG + Intronic
1183688629 22:39375960-39375982 TGGGGAAGCCGAGGAACAGAGGG - Intronic
956452183 3:69385935-69385957 AGCGGCTGCCGCTGAACAGCAGG + Exonic
963570628 3:146990610-146990632 CGAGGCTGCAGAGGAAAATATGG + Intergenic
966883214 3:184361449-184361471 CGCGGCGGCGGAGGAAGGGATGG - Exonic
968165378 3:196460500-196460522 AGCGGCTGCTGAGAAACTGAAGG - Intergenic
972670978 4:41214063-41214085 CGGGGCTGCTGAGGGAAAGAGGG + Intronic
976184162 4:82429175-82429197 CGCGGCTCACGAGGAACGAAGGG + Intronic
987292108 5:16519154-16519176 CCCCGCTGCTGAGGAAGAGATGG + Intronic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
996483375 5:124001209-124001231 TGCGCCTGCCAATGAACAGAGGG + Intergenic
997788063 5:136731729-136731751 CACTGCTGCCAAGGAACTGAGGG - Intergenic
1002946404 6:1765635-1765657 GGCGGCTGAGCAGGAACAGAAGG + Intronic
1018093977 6:160368533-160368555 CTCAGCTGCAGAGGAACACAGGG - Intronic
1019732495 7:2635631-2635653 CCCGGCTGCCGACAATCAGAGGG + Intronic
1022092973 7:27119712-27119734 CTCCCCTGCAGAGGAACAGAAGG + Intronic
1022524548 7:31028740-31028762 CACGGCTACCGAGGGCCAGATGG - Intergenic
1024474727 7:49798462-49798484 AGAGGCTGCCAAGGAGCAGATGG - Intronic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1036668507 8:10764207-10764229 CGCGGATGAAGAGGAACAGCAGG + Intronic
1040017212 8:42709303-42709325 CGGGGCTGCCTAGGGACAGCAGG - Intronic
1049344146 8:142129453-142129475 CGAGGACGCCGAGGCACAGAGGG - Intergenic
1054870570 9:70044341-70044363 AGCGGCTGCGGAGGATCAGGAGG - Intronic
1056930129 9:90867343-90867365 CGCGGCTGCCCAGGAACAGCAGG - Intronic
1057173066 9:92975436-92975458 CGCAGCTGCCGAGGAGCCTAGGG - Intronic
1059341308 9:113599023-113599045 CACGGCTGCCGGGGAGCAGAGGG - Intergenic
1061540740 9:131276928-131276950 CGCGGCCGCCGAGGACCTGGTGG + Intergenic
1192360215 X:70434477-70434499 CGCGGCTGCCCGGCAACCGAGGG - Intergenic